Search

Purpose: To present a series of eyes with multifocal choroiditis and panuveitis (MFC) treated with fluocinolone acetonide intravitreal implants. All eyes developed recurrent choroidal neovascularization (CNV) and were treated with intravitreal bevacizumab or ranibizumab. Methods: Retrospective chart review. Data collected included demographics, details of previous immunosuppressive therapy, preinjection Snellen visual acuity, and central macular thickness measured by optical coherence tomography, total injections administered, and postinjection central macular thickness and visual acuity. Patients were followed up for a minimum of 25 months from the first fluocinolone acetonide implant. Duration from implantation to first injection and complications, including development of cataracts, glaucoma, and recurrent inflammation, were followed. Patients: Three patients treated for MFC at the Casey Eye Institute, a tertiary care referral center at Oregon Health & Science University, from 2005–2008 were studied. All three received fluocinolone acetonide implants and later underwent intravitreal anti–vascular endothelial growth factor (VEGF) therapy for CNV. Results: Preinjection visual acuity in 3 patients was 1.2, 0.54, and 0.48 logarithm of minimal angle of resolution (mean 0.74). Postinjection visual acuity in 3 patients was 1.0, 0.40, and 0.0 logarithm of minimal angle of resolution (mean 0.47). Preinjection central macular thicknesses were 855 μm, 215 μm, and 276 μm (mean 449 μm). Postinjection central macular thicknesses were 220 μm, 190 μm, and 223 μm (mean 211 μm). Anti-VEGF injections did not reactivate inflammation. Advancing cataracts contributed to worsening visual acuity postinjection. The total number of anti-VEGF injections until resolution of intraretinal and subretinal fluid associated with CNV was 6 injections for case 1, 1 for case 2, and 8 for case 3 (mean 5, range 1–8). Conclusion: Intravitreal anti-VEGF therapy was successful in treating recurrent CNV in MFC patients with well-controlled inflammation after insertion of fluocinolone acetonide implants. Anti-VEGF therapy should be considered in treating active CNV in eyes with MFC and quiescent inflammatory disease.

Purpose To describe an ocular manifestation of Castleman disease, a rare lymphoproliferative disorder characterized by sheets of abundant plasma cells in the interfollicular spaces of lymph nodes, most commonly in the abdomen, mediastinum, and cervical chain. Methods Clinicopathologic case report. Patient A 69-year-old man with lymphadenopathy and bilateral choroidal infiltrates. Results Initially, we suspected systemic lymphoma with ocular involvement. Lymph node biopsy revealed Castleman disease without a monoclonal component. Choroidal biopsy showed lymphocytic and plasma cell infiltration. Conclusion To our knowledge, this is the first clinicopathologic report of multicentric Castleman disease involving the eye.

AIM—To evaluate the clinical usefulness of methotrexate for patients with non-infectious orbital inflammatory disease who fail to respond to systemic corticosteroids and/or orbital irradiation. METHODS—The medical records of patients with non-infectious orbital inflammatory disease who were treated with methotrexate at Oregon Health Sciences University between June 1993 and June 2000 were examined. Methotrexate was administered at a median maximum dose of 20 mg per week (range 15-25 mg per week) in conjunction with folate supplementation. Patients were followed with regular ophthalmic examinations, as well as serum liver enzyme levels and blood cell counts. Clinical signs of regression of the orbital inflammation, visual acuity, dosage and duration of methotrexate therapy, requirement for concurrent corticosteroid administration, and adverse drug reactions were recorded. RESULTS—The study cohort included 14 patients (24 eyes) with diagnoses including non-specific orbital inflammation (n=7), Tolosa-Hunt syndrome (n=1), thyroid orbitopathy (n=3), Wegener's granulomatosis (n=1), sarcoidosis (n=1), and Erdheim-Chester disease (n=1). In all cases, methotrexate was commenced as a corticosteroid sparing agent. 10 patients (71%) completed a 4 month therapeutic trial of methotrexate. Median duration of treatment for the nine (64%) patients who experienced clinical benefit was 25 months (range 10-47 months). Six responders were ultimately able to cease methotrexate, including the single patient who required concurrent long term corticosteroid therapy. Complications included fatigue, gastrointestinal disturbance, hair thinning and mild, reversible serum liver enzyme elevation. Two patients (14%) discontinued treatment because of adverse effects. CONCLUSION—Methotrexate is a well tolerated immunosuppressive medication which may benefit patients with recalcitrant non-infectious orbital inflammatory disease.

Background: Primary antiphospholipid syndrome (PAPS) is a thrombotic condition which characteristically includes ocular vaso-occlusive pathology. Case: We present the case of a 47-year-old woman with PAPS presenting with retinal vascular leakage. Observations: Vascular leakage was an incidental finding on fundoscopy in a myopic Chinese woman, and initially this was diagnosed as diabetic retinopathy. However, a glucose tolerance test was negative. Subsequently, signs of retinal vaso-occlusion developed. Previous subclinical cerebral thrombosis, mild thrombocytopaenia and positive tests for antiphospholipid antibodies were consistent with the diagnosis of PAPS. Anticoagulation therapy with warfarin prevented further thrombotic episodes. Conclusion: The possibility of PAPS should be considered in patients presenting with retinal vascular disease without obvious vascular risk factors.

Objective To evaluate the clinical usefulness of tumor necrosis factor (TNF) inhibitors in patients with inflammatory eye disease that is resistant to conventional immunosuppressive therapies. Methods Sixteen patients (4 males and 12 females aged 7 to 78 years) who received etanercept (n = 14) or infliximab (n = 2) for either inflammatory eye disease or associated joint disease were studied retrospectively to determine the effect of these medications on their ocular inflammation. Results Nine cases of uveitis and 7 cases of scleritis were treated. Systemic diagnoses included rheumatoid arthritis (n = 8), juvenile rheumatoid arthritis (n = 3), ankylosing spondylitis (n = 1), and psoriatic spondylarthropathy (n = 1). Three patients had uveitis without associated systemic disease. Although 12 of 12 patients with active articular inflammation (100%) experienced improvement in joint disease, only 6 of 16 with ocular inflammation (38%) experienced improvement in eye disease. Five patients developed inflammatory eye disease for the first time while taking a TNF inhibitor. No patient discontinued treatment because of adverse drug effects. Conclusion TNF inhibitors are well tolerated immunosuppressive medications that may benefit certain subgroups of patients with inflammatory eye disease, but they appear to be more effective in controlling associated inflammatory arthritis.

Purpose: To describe posterior uveal cleft and chronic hypotony occurring in association with a fluocinolone acetonide implant (Retisert) that was successfully treated by vitrectomy, removal of the implant, and cryotherapy. Methods: A 57-year-old female patient with idiopathic uveitis, well-controlled with cyclosporine, developed chronic hypotony with maculopathy after insertion of a fluocinolone acetonide implant. Visual acuity in the affected eye was counting fingers, and intraocular pressure was 0 mmHg. Wound leakage, cyclodialysis cleft, and cyclitic membrane were excluded. Ultrasound biomicroscopy demonstrated a posterior uveal cleft at the site of implant, which was presumed to have created a channel for passage of intraocular fluid to the suprachoroidal space. The patient was treated with pars plana vitrectomy, removal of the implant, cryotherapy at the implant site, and intravitreal triamcinolone acetonide injection. Results: The procedure was well tolerated. Intraoperative appearance suggested incarceration of the implant, which did not show on ultrasound biomicroscopy. Intraocular pressure was normalized 5 days after the surgery. Postoperative visual acuity improved to 20/200 at 2 weeks after the surgery and remained stable through 1 year of follow-up. Uveitis remains well controlled with cyclosporine at 1 year after the procedure. Conclusion: Posterior uveal cleft may cause hypotony as a complication of insertion of a fluocinolone acetonide implant. The ultrasound biomicroscopy is a crucial investigation to establish the diagnosis and to exclude other pathologies including cyclodialysis cleft and cyclitic membrane. It may fail to demonstrate incarceration of an implant, however. Proper surgical technique may prevent this complication.

AIMS: To examine the hypothesis that apoptosis of infiltrating cells contributes to spontaneous resolution of uveitis in clinically relevant rodent models. METHODS: Experimental melanin induced uveitis (EMIU) was induced in Fischer 344 rats by immunisation with 250 microg bovine ocular melanin. Endotoxin induced uveitis (EIU) was induced by injection of 200 microg Escherichia coli lipopolysaccharide. Formalin fixed, paraffin embedded ocular cross sections were stained by terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate biotin nick end labelling (TUNEL) to identify apoptotic cells. Indirect immunoperoxidase staining of paraformaldehyde lysine periodate fixed tissue cross sections was used to demonstrate expression of inducible nitric oxide synthase (iNOS). RESULTS: TUNEL positive mononuclear cells were observed in the anterior uvea during both EMIU and EIU at all selected time points. However, whereas the majority of mononuclear cells appeared apoptotic from the outset of disease, neutrophils were notably TUNEL negative at all time points examined. Many infiltrating neutrophils expressed iNOS. CONCLUSION: Apoptosis occurs early in the course of rat EMIU and EIU, and may contribute to resolution of these diseases. In general, infiltrating mononuclear cells die rapidly, while neutrophils survive, producing inducible nitric oxide synthase which may contribute to disease pathogenesis.

Purpose: A case of linear IgA disease is reported to alert ophthalmologists and physicians to this unusual cause of chronic cicatrizing conjunctivitis. Methods: Clinical records of a patient suffering from linear IgA disease were reviewed. Results: A 65-year-old woman with a complicated medical history experienced rapidly progressive chronic cicatrizing conjunctivitis leading to corneal perforation. Undiagnosed gingivitis and palatal ulceration had been present for 5 years prior to the onset of ocular symptoms and vitamin C deficiency had followed the consequent dietary restrictions. A diagnosis of linear IgA disease was made on conjunctival biopsy, which demonstrated linear deposits of IgA along the epithelial basement membrane. The perforation was managed successfully with a conjunctival pediculate flap. Control of the inflammation was achieved with systemic prednisolone and cyclophosphamide but at the expense of serious systemic side-effects. Conclusions: Linear IgA disease causes progressive conjunctival cicatrization in many affected individuals. Although dapsone generally controls the inflammation, heavier systemic immunosuppression was required in this case. Involvement of skin or other mucosal surfaces may become symptomatic before the conjunctivitis, and physicians must be educated to refer patients for ophthalmological review on diagnosis. Conversely, ophthalmologists encountering ocular linear IgA disease should be aware of the possibility of other mucosal involvement requiring physician intervention.

SUMMARY Experimental melanin-induced uveitis (EMIU) is a rodent model of acute anterior uveitis which was described in 1993. We investigated strain susceptibility, and age and gender characteristics of the model, undertook histological and immunohistochemical studies to investigate underlying cellular mechanisms, and examined several treatment options. Rats were immunized with bovine ocular melanin (250 μg), and disease was followed by slit lamp examination. Lewis, Fischer 344 and Porton rats were found to be susceptible to EMIU, whereas Wistar-Furth, DA, and Hooded Wistar strains were resistant. EMIU was neither age- nor gender-dependent. In Fischer 344 rats, EMIU was characterized clinically by florid anterior segment inflammation. Histopathological findings included infiltration of ciliary body and iris with mononuclear cells and neutrophils. Both CD4+ and CD8+ T lymphocytes were prominent. Rats were then treated with intraperitoneal injections of anti-CD4, anti-CD8 or irrelevant isotype-matched MoAb on days −3, 0, 3, 6 and 9 with respect to melanin immunization. Incidence of uveitis was significantly reduced in rats treated with a non-depleting cocktail of anti-CD4 MoAbs (P = 0.007), whereas a depleting anti-CD8 antibody had no effect on the disease. Mannose-6-phosphate inhibits lymphocyte migration in some models of T cell-mediated inflammation. This simple sugar was administered to additional rats via intraperitoneal osmotic pumps for 14 days following disease induction, but did not influence the uveitis. We conclude that EMIU is controlled by CD4+ T cells, and disease may be abrogated by treatment with anti-CD4 MoAbs.

Intraocular lymphoma is an aggressive non-Hodgkin B cell lymphoma involving the posterior eye. Basic research on this tumour has been hindered by an inability to expand the malignant B cell population. We developed a cell culture system, in which endothelial cell monolayers were infected with adenoviral vectors encoding HIV-1 proteins, Vpu and Tat. These monolayers permitted adhesion and proliferation of CD20-positive B cells from specimens of cerebrospinal fluid obtained from patients with intracranial tumor. The system provides a method for expansion of the malignant B cell population present in small volumes of fluid that are available for research use. Primary intraocular lymphoma (PIOL) is a diffuse large B cell lymphoma with poor prognosis due to frequent intracranial involvement;1 ocular and/or cerebral tumour is more generally described as “primary central nervous system lymphoma” (PCNSL).2 Expansion of the malignant cells has proved difficult and is a priority for studies of pathogenesis.3 AIDS-related lymphomas demonstrate aggressive growth at extranodal sites, where HIV-1 infection of endothelial cells (EC)4 may …

Acute anterior uveitis is a recurrent inflammatory disease of the eye that occurs commonly, is distressing for the patient, and may have potentially blinding sequelae. The pathogenesis of the disease is poorly understood, and anti-inflammatory treatment is consequently non-specific and may be associated with significant complications. Animal models are a possible key to a better understanding of this disease. In one model, rats and mice develop a relatively short-lived anterior uveal inflammation almost immediately after systemic injection of bacterial endotoxin. Accumulating evidence suggests that cytokine production by resident uveal macrophages initiates endotoxin-induced uveitis which is characterized by an infiltration of neutrophils and mononuclear cells. A second model displays features in keeping with a delayed-type hypersensitivity immune response. Experimental melanin-induced uveitis is an acute recurrent uveitis with delayed onset but extended duration, observed when rats are immunized with bovine ocular melanin. Both animal models have clinical features in common with acute anterior uveitis, although experimental melanin-induced uveitis appears to mimic the human disease more closely. Novel treatment options to target implicated inflammatory cells and molecules are currently under consideration.

Uveal mast cells have previously been considered to be vital mediators of experimental uveitis. We extended the study of these cells to experimental melanin-induced uveitis (EMIU), a recently described clinically relevant model, and re-examined their role in endotoxin-induced uveitis (EIU) using genetically mast cell-depleted mice on a single background. EMIU was induced in Fischer 344 rats by immunisation with bovine ocular melanin (250 µg). Animals were killed immediately, and on days 1 and 3 of clinical disease. Numbers of uveal mast cells and the percentage of degranulated cells were counted in whole-mount preparations. There was no significant change in either measure across the selected time points. To induce EIU, normal and mast cell-depleted DBA/2 mice were injected with Escherichia coli lipopolysaccharide (400 µg). Cells infiltrating the eye 24 h after injection were quantified in 5 µm ocular cross-sections. Disease was not significantly reduced in the mast cell-depleted mutants. We conclude that uveal mast cells are not required for the development of EMIU or, in contrast to earlier work, EIU.

The authors report a case of typical acute posterior multifocal placoid pigment epitheliopathy in which an ocular coherence tomographic scan was performed through an acute lesion and then repeated through the same lesion 12 months later. The initial ocular coherence tomographic scan showed marked anterior displacement of both neuroretina and outer reflective band. A subsequent ocular coherence tomographic scan revealed resolution of the prior displacement, increased reflectance of the outer reflective band and mild disruption of the outer retinal layers. These findings are consistent with a primary choroiditis.

To determine whether rituximab, a monoclonal antibody against the B-lymphocyte antigen CD20, is effective in the treatment of refractory noninfectious scleritis.Prospective, dose-ranging, randomized, double-masked phase I/II clinical trial.Twelve patients with noninfectious scleritis refractory to systemic corticosteroid and ≥1 other systemic immunosuppressive agent were enrolled from January 2007 to March 2010.Subjects were randomly assigned to 500 (n = 5) or 1000 mg (n = 7) dosing arms of rituximab intravenous infusions (500 or 1000 mg), given at study days 1 and 15. Initial responders with breakthrough inflammation after study week 24 were offered treatment with an additional cycle of 2 open-label rituximab 1000 mg infusions.Primary outcomes were reduction of inflammation, as measured with a validated scleritis disease grading scale (SGS) and reduction in corticosteroid dose by ≥50%. Patients were characterized as responders to study therapy if ≥1 of these endpoints showed improvement and neither showed evidence of worsening. Secondary outcomes were improvement in visual acuity, reduction in pain, and improvement in patient and physician-reported global health assessment.Of 12 enrolled patients, 9 met the SGS endpoint at or before week 24, and 4 additionally were able to reduce corticosteroid dose by ≥50%. With regard to secondary outcome measures, 11 and 9 patients showed improvement in patient and physician global health scores, respectively, and 7 patients had reduction in pain. Of 9 initial responders, 7 experienced breakthrough inflammation after 24 weeks and were treated with a second cycle of rituximab infusions. Four patients had significant objective or subjective worsening within 8 weeks of receiving rituximab; this event was averted in subsequent patients by treatment with peri-infusional oral corticosteroid. No other significant adverse events were noted. No differences in efficacy, toxicity, or likelihood of retreatment were noted between the dosing arms.Rituximab was effective treatment for 9 of 12 enrolled patients with refractory, noninfectious scleritis at 24 weeks, although 7 required reinfusion with rituximab to maintain inflammatory control. The treatment was well-tolerated, and peri-infusional inflammatory exacerbations were managed successfully with oral corticosteroids. Further long-term studies are warranted to determine the safety and efficacy of rituximab in treating noninfectious scleritis and other ocular inflammatory diseases.

Aim: To investigate the role of arachidonic acid derived chemotactic factor, LTB4, in the development of endotoxin induced uveitis (EIU), using mice deficient in the BLT1 gene which encodes the high affinity LTB4 receptor. Methods: BLT1 gene deficient and wild type BALB/c mice were injected intravitreally with Escherichia coli 055:B5 lipopolysaccharide (250 ng/2 μl). Number of leukocytes invading the anterior chamber 24 hours later were counted on tissue cross sections. Results: In all mice, EIU was characterised by a polymorphonuclear and mononuclear cell infiltrate. Numbers of infiltrating cells did not differ significantly between control and BLT1 gene knockout mice. Conclusion: Chemotactic factors other than LTB4 are primarily responsible for leukocyte migration into the eye during murine EIU.

In chickens, single functional immunoglobulin variable and joining gene segments at each of the heavy and light chain loci undergo V(D)J rearrangement. Diversity is subsequently introduced by conversions templated by upstream pseudo V region genes in such a way that practically all V regions in mature B cells have identical ends. This greatly simplifies the representative amplification of V region genes. Furthermore, the entire naive repertoire of the adult chicken is produced in the bursa of Fabricius of the young bird. These special properties of the generation of immunoglobulin diversity in chickens have been exploited in the development of procedures to produce large libraries of diverse antibody combining sites derived from chicken Ig genes and expressed on filamentous bacteriophage. The utility of this library was assessed by selection of specifically binding phage using three solid phase-bound protein antigens, hen egg white lysozyme, bovine thyroglobulin and bovine serum albumin. The sequences of the V region genes thus isolated demonstrated that selection was specific and that the library contained useful diversity of binding sites. This library provides access to a repertoire whose diversity is based on a mechanism different from that underlying previously available libraries. The demonstrated feasibility of generating chicken phage antibodies may lead to the production of monoclonal reagents from immunised chickens, and the derivation of reagents for studying immunoglobulin mediated selection in avian B cell development.

Introduction of highly active antiretroviral therapy has altered the course of disease for persons infected with human immunodeficiency virus by elevating CD4+ T-lymphocyte levels. Changes in the spectrum of systemic diseases encountered in human immunodeficiency virus-positive individuals are reported in the general medical literature.Retrospective case series.Sixty-one individuals infected with human immunodeficiency virus, who presented with uveitis when the peripheral CD4+ T-lymphocyte count was over 200 cells/μL.Standardized data collection at seven tertiary-referral inflammatory eye disease clinics.Standardization of Uveitis Nomenclature anatomic classification and descriptors, cause of uveitis, and visual acuityPeripheral CD4+ T cell counts varied between 207 and 1777 (median = 421) cells/μL at the time of diagnosis of uveitis. Uveitis was classified anatomically as anterior (47.5%), intermediate (6.6%), anterior/intermediate (16.4%), posterior (14.8%) and pan (14.8%). Specific causes of uveitis included infections (34.4%), with syphilis responsible for 16.4% of all cases, and defined immunological disorders (27.0%); no cause for the inflammation was identified in 34.4% of persons. Visual acuity was better than 6/15 in 66.7% and 6/60 or worse in 11.8% of 93 eyes at presentation, and better than 6/15 in 82.4% and 6/60 or worse in 8.8% of 34 eyes at 1 year of follow-up.Both infectious and non-infectious forms of uveitis occur in individuals who are infected with human immunodeficiency virus and have preserved or restored peripheral CD4+ T cell levels. Individuals who are human immunodeficiency virus-positive and present with uveitis should be evaluated in the same way all patients with uveitis are assessed.

Toxoplasma gondii, the parasite responsible for ocular toxoplasmosis, accesses the retina from the bloodstream. We investigated the dendritic cell as a potential taxi for T. gondii tachyzoites moving across the human retinal endothelium, and examined the participation of adhesion molecules and chemokines in this process.CD14-positive monocytes were isolated from human peripheral blood by antibody-mediated cell enrichment, and cultured in granulocyte-macrophage colony-stimulating factor and interleukin-4 to generate dendritic cells. Transmigration assays were performed over 18 hours in transwells seeded with human retinal endothelial cells and using dendritic cells exposed to laboratory or natural strains of T. gondii tachyzoites. Parasites were tagged with yellow fluorescent protein to verify infection. In some experiments, endothelial monolayers were preincubated with antibody directed against adhesion molecules, or chemokine was added to lower chambers of transwells.Human monocyte-derived dendritic cell preparations infected with laboratory or natural strain T. gondii tachyzoites transmigrated in larger numbers across simulated human retinal endothelium than uninfected dendritic cells (P ≤ 0.0004 in 5 of 6 experiments). Antibody blockade of intercellular adhesion molecule (ICAM)-1, vascular cell adhesion molecule (VCAM)-1, and activated leukocyte cell adhesion molecule (ALCAM) inhibited transmigration (P ≤ 0.007), and CCL21 or CXCL10 increased transmigration (P ≤ 0.031).Transmigration of human dendritic cells across retinal endothelium is increased following infection with T. gondii. Movement may be impacted by locally produced chemokines and is mediated in part by ICAM-1, VCAM-1, and ALCAM. These findings have implications for development of novel therapeutics aimed at preventing retinal infection by T. gondii.

PURPOSE Oxygen-induced retinopathy in the mouse is the standard experimental model of retinopathy of prematurity. Assessment of the pathology involves in vitro analysis of retinal vaso-obliteration and retinal neovascularization. The authors studied the clinical features of oxygen-induced retinopathy in vivo using topical endoscopy fundus imaging (TEFI), in comparison to standard investigations, and evaluated a system for grading these features. METHODS Postnatal day (P)7 mice were exposed to 75% oxygen for five days to induce retinopathy or maintained in room air as controls. Retinal vascular competence was graded against standard photographs by three masked graders. Retinal photographs were obtained at predetermined ages using TEFI. Postmortem, retinal vaso-obliteration was measured in whole mounts with labeled vasculature, and retinal neovascularization was quantified in hematoxylin- and eosin-stained ocular cross sections. RESULTS Fundus photography by TEFI was possible from P15, when retinal vascular incompetence, including dilatation and tortuosity, was significant in mice with oxygen-induced retinopathy in comparison to controls. Vascular incompetence peaked in severity at P17 and persisted through P25. Comparison with in vitro analyses indicated that vascular changes were most severe after retinal avascularity had begun to decrease in area, and coincident with the maximum of retinal neovascularization. A weighted Fleiss-Cohen kappa indicated good intra- and interobserver agreement for a 5-point grading system. CONCLUSIONS Topical endoscopy fundus imaging demonstrates retinal vascular incompetence in mice with oxygen-induced retinopathy. The technique complements standard postmortem analysis for following the course of the model. TRANSLATIONAL RELEVANCE Topical endoscopy fundus imaging has application in the evaluation of novel biologic drugs for retinopathy of prematurity.

To determine the prevalence of serous retinal detachments (SRD) using optical coherence tomography (OCT) in a large database of patients with uveitis from a tertiary referral setting, to describe clinical features of patients with SRD, and to ascertain retinal architectural features found in association with SRD. Main outcome measures Prevalence of SRD in uveitis patients imaged with OCT, correlation of visual acuity with SRD, anatomic subtypes of uveitis identified, and association of SRD with various subtypes of macular edema (focal and diffuse) and retinal architectural abnormalities. Design Retrospective, single-setting cross-sectional study of all OCTs in a digital imaging base ordered on patients from a tertiary referral uveitis clinic between July 2006 and March 2008. Results SRD were identified in 17 of 111 uveitis patients (15 %) reviewed; bilateral SRD were found in 5 of 17 patients (29 %). Intermediate uveitis was the most common disease association (47 %), but other conditions identified included Vogt-Koyanagi-Harada syndrome, multifocal choroiditis/panuveitis, and sarcoidosis. Retinal architectural features identified in association with SRD included focal macular edema (59 %), diffuse macular edema (50 %), any intraretinal edema (77 %), both diffuse and focal macular edema (32 %), and retinal pigment epithelial alteration (27 %). Moderate or severe visual impairment, defined as visual acuity 20/50 or poorer was seen in 71 % of patients with SRD. Poorer visual acuity was correlated with increased central subfield thickness in patients with SRD (r2=0.41, p, This work is supported in part by an Unrestricted Grant from Research to Prevent Blindness (Casey Eye Institute, Emory Eye Center), the Stan and Madelle Rosenfeld Family Trust (JTR), the William and Mary Bauman Foundation (JTR), the William C. Kuzell Foundation (JTR), and the Ronald G. Michels Fellowship Foundation (SY).

Purpose Tuberculous optic neuropathy may follow infection with Mycobacterium tuberculosis or administration of the bacille Calmette–Guerin. However, this condition is not well described in the ophthalmic literature. Methods Ophthalmologists, identified through professional electronic networks or previous publications, collected standardized clinical data relating to 62 eyes of 49 patients who they had managed with tuberculous optic neuropathy. Results Tuberculous optic neuropathy was most commonly manifested as papillitis (51.6 %), neuroretinitis (14.5 %), and optic nerve tubercle (11.3 %). Uveitis was an additional ocular morbidity in 88.7 % of eyes. In 36.7 % of patients, extraocular tuberculosis was present. The majority of patients (69.4 %) had resided in and/or traveled to an endemic area. Although initial visual acuity was 20/50 or worse in 62.9 % of 62 eyes, 76.7 % of 60 eyes followed for a median of 12 months achieved visual acuities of 20/40 or better. Visual field defects were reported for 46.8 % of eyes, but these defects recovered in 63.2 % of 19 eyes with follow-up. Conclusion Visual recovery from tuberculous optic neuropathy is common, if the diagnosis is recognized and appropriate treatment is instituted. A tuberculous etiology should be considered when evaluating optic neuropathy in persons from endemic areas., Research to Prevent Blindness (unrestricted grant to Casey Eye Institute) provided partial support for this work.

Dear Editor, CD44 is a widely expressed type I transmembrane glycoprotein that functions as the receptor for hyaluronic acid, as well as multiple other ligands.1 In humans, the extracellular domain of “standard isoform” CD44 is encoded by 7 invariant exons (i.e., exons 1 – 5 and exons 15 – 16), but 9 additional alternatively spliced exons (i.e., exons 6 – 14) code for numerous “variant isoforms”.2, 3 Exon 17 encodes a transmembrane segment, and exons 18 or 19 encode a cytoplasmic domain. Although the function of specific variant isoforms is still a subject of investigation, it is clear that differences in CD44 structure translate to differences in function.1 Studies in experimental models have implicated retinal endothelial CD44 in leukocyte trafficking in posterior uveitis,4 and choroidal endothelial CD44 in the neovascularization that characterizes wet age-related macular degeneration (AMD).5 Human retinal and choroidal endothelial cells express CD44.6 Surprisingly, however, the CD44 isoform(s) present in these cell populations are unknown. Using standard RT-PCR and dye-terminator sequencing, and human primary ocular endothelial cell isolates, we confirmed the presence of standard CD44 and investigated the potential expression of CD44 variants in human retinal and choroidal endothelial cells. Retinal and choroidal endothelial cells were isolated from paired eyes of 5 human cadaver donors with no history of ocular pathology, according to our previously described method.6 In brief, isolation involved type II collagenase (Sigma-Aldrich, St. Louis, MO) and Dispase (GIBCO-Invitrogen, Grand Island, NY) digestion of dissected tissue, followed by endothelial purification using magnetic Dynabeads (Dynal-Invitrogen, Brown Deer, WI) conjugated to murine anti-human CD31 antibody (BD Pharmingen, San Diego, CA). Timing was as short as practical to minimize processing-related gene expression changes; isolation was commenced 14 to 19 hours after death, and cells were used in experiments at passage 2 to 5. Total RNA was prepared from confluent endothelial cultures, using the RNeasy Mini Kit (Qiagen, Valencia, CA) with optional on-column DNAse treatment, and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). The PCR was performed on a GeneAmp PCR System 9700 Thermal Cycler (Applied Biosystems, Carlsbad, CA), using published primers designed to recognize sequence in invariant CD44 exons 4 (forward: 5’- ACATCAGTCACAGACCTGCC -3’) and 17 (reverse: 5’- GCAAACTGCAAGAATCAAAGCC-3),3 as well as GAPDH (5’-AGCTGAACGGGAAGCTCACTGG-3’ and 5-GGAGTGGGTGTCGCTGTGAAGTC-3’).6 Additional PCRs were performed using forward primers for variant CD44 exons 6 (5’- CCTGGGATTGGTTTTCATGGTT -3’), 8 (5’- AACCAGGACTGGACCCAGTGGAA -3’), 10 (5’- AGGAACAGTGGTTTGGCAAC-3’) and 12 (5’- GACAGGACCTCTTTCAATGAC -3’), designed in-house, and the reverse primer for invariant exon 17. All CD44 PCR products was purified with QIAquick Gel Extraction kit (Qiagen, Valencia, CA) and sequenced on the ABI 3130xl Genetic Analyzer (Applied Biosystems). By RT-PCR using primers located at either side of the variant exon sequence in the extracellular domain of CD44, we confirmed the expression of standard CD44 in retinal and choroidal endothelial cells from the five human donors. In addition, with forward primers located within the variant exon sequence and a reverse primer in conserved sequence, we detected 10 alternatively spliced transcripts containing one or more of the 9 variant exons, although interestingly, choroidal endothelial cells from some donors did not express all isoforms (Table 1). Table 1 Exonic sequence of the variable segment of the extracellular domain in CD44 variant isoforms. Nine alternatively spliced exons (i.e., exons 6 – 14) encode for variants. Results are for human retinal and choroidal endothelial isolates from 5 human ... Our work demonstrates that, not unexpectedly, human retinal and choroidal endothelial cells express standard CD44. However, and importantly, multiple variant CD44 isoforms are synthesized by these cell types, although not universally. We identified 10 variant isoforms in both ocular endothelial cell populations, with all variant exons represented, and we anticipate additional isoforms would be detected by other methods. CD44 has been identified as a potential therapeutic target in ocular vascular disease.5 Given that the function of CD44 may vary, depending on the isoform, our findings have implications for further studies in this area. In such work, it would be critical to identify the specific CD44 isoform(s) involved in any pathological process(es) responsible for the disease in question. The potential for donor-specific splicing events should be an additional consideration.

Most primary central nervous system lymphomas (PCNSLs) and primary vitreoretinal lymphomas (PVRLs) are B-cell lymphomas that produce high levels of interleukin (IL)-10, which is linked to rapid disease progression. The IL-10 (-1082) G → A polymorphism (IL-10 SNP) is associated with improved survival in certain non-CNS lymphoma patients. PDCD4 is a tumor suppressor gene and upstream regulator of IL-10. This study examined the correlation between the IL-10 SNP, PDCD4 mRNA expression, and IL-10 expression (at transcript and protein levels) in these lymphoma cells.Single-nucleotide polymorphism (SNP)-typing at IL-10 (-1082) was performed after microdissecting cytospun PVRL cells from 26 specimens. Vitreal IL-10 and IL-6 levels were measured by ELISA. PCNSL cells from 52 paraffin-embedded sections were microdissected and SNP typed on genomic DNA. RT-PCR was performed to analyze expression of IL-10 and PDCD4 mRNA. IL-10 (-1082) SNP typing was performed on blood samples of 96 healthy controls. We measured IL-10 (-1082) SNP expression in 26 PVRLs and 52 PCNSLs and examined its relationship with IL-10 protein and gene expression, respectively.More PVRL patients expressed one copy of the IL-10 ( -1082 ) G → A SNP with the GA genotype compared to controls. The frequencies of the three genotypes (AA, AG, GG) significantly differed in PVRL versus controls and in PCNSL versus controls. In PVRLs, the vitreal IL-10/IL-6 ratio was higher in IL-10 (-1082) AG and IL-10 (-1082) AA patients, compared to IL-10 (-1082) GG patients. IL-10 mRNA expression was higher in IL-10 (-1082) AG and IL-10 (-1082) AA PCNSLs, compared to IL-10 (-1082) GG PCNSLs. No correlation was found between IL-10 and PDCD4 expression levels in 37 PCNSL samples.PVRL and PCNSL patients had similar IL-10 (-1082) A allele frequencies, but genotype distributions differed from healthy controls. The findings suggest that the IL-10 (-1082) A allele is a risk factor for higher IL-10 levels in PVRLs and PCNSLs. Higher IL-10 levels have been correlated with more aggressive disease in both PVRLs and PCNSLs, making this finding an important and potentially clinically significant observation.

Objective To develop a set of core outcome measures for use in randomized controlled trials (RCTs) and longitudinal observational studies in juvenile idiopathic arthritis (JIA)–associated uveitis. Methods The literature relating to outcome measures used in studies of uveitis in childhood and adolescence was reviewed. A set of core outcomes and domains was established using the Delphi process. This was reviewed by a representative multinational interdisciplinary working group. Nominal group technique consensus was reached on face and content validity of the range and content of the domains. The outcomes and the appropriate instruments for uveitis trials were adapted to the age ranges of patients with JIA-associated uveitis. Results Consensus was reached that data should be reported at defined time points in longitudinal studies with patients stratified by prognostic markers. Visual acuity testing should be age appropriate. The severity of uveitis (measured as anterior chamber cell grade) and duration of active inflammation should be documented. Visually significant structural complications should be recorded and quantified with standard measures. The responses to treatment and corticosteroid-sparing effects of treatment should be documented. Patient-reported disease activity and age-specific uveitis-related quality of life should be reported using appropriate questionnaires. Conclusion The proposed outcome measures in JIA-associated uveitis should aid in the standardization and comparison of future RCTs of the treatment regimens for this disease. The proposed outcome measures will be verified in a prospective validation study.

Retinal lymphoma, the most common form of intraocular lymphoma, is a high-grade malignancy, usually of B-cell type, and is associated with a poor prognosis because of frequent central nervous system (CNS) involvement. The neoplastic B-cells of retinal lymphoma have a characteristic morphology and immunophenotype, express certain chemokines and chemokine receptors, and produce interleukins (IL), e.g. IL-10. Together with the cytological features of these tumors, the immunophenotype, presence of immunoglobulin rearrangements, and biochemical profile aid the diagnosis of retinal lymphomas. Immunophenotyping and somatic mutation analysis suggest derivation of most retinal lymphomas from an early post-germinal centre B-cell. Chromosomal translocation data would suggest, however, that a subgroup of these neoplasms may arise from germinal centre B-cells, and these could be associated with a better prognosis. Further investigations, such as gene expression profiling, are required to identify oncogenic pathways potentially involved in retinal lymphoma development, and to identify new prognostic/therapeutic markers for this tumor.

Age-related macular degeneration (AMD), a leading cause of blindness worldwide, is as prevalent as cancer in industrialized nations. Most blindness in AMD results from invasion of the retina by choroidal neovascularisation (CNV). Here we show that the eosinophil/mast cell chemokine receptor CCR3 is specifically expressed in choroidal neovascular endothelial cells in humans with AMD, and that despite the expression of its ligands eotaxin-1, -2 and -3, neither eosinophils nor mast cells are present in human CNV. Genetic or pharmacological targeting of CCR3 or eotaxins inhibited injury-induced CNV in mice. CNV suppression by CCR3 blockade was due to direct inhibition of endothelial cell proliferation, and was uncoupled from inflammation because it occurred in mice lacking eosinophils or mast cells, and was independent of macrophage and neutrophil recruitment. CCR3 blockade was more effective at reducing CNV than vascular endothelial growth factor A (VEGF-A) neutralization, which is in clinical use at present, and, unlike VEGF-A blockade, is not toxic to the mouse retina. In vivo imaging with CCR3-targeting quantum dots located spontaneous CNV invisible to standard fluorescein angiography in mice before retinal invasion. CCR3 targeting might reduce vision loss due to AMD through early detection and therapeutic angioinhibition.

Immunologic pathways involved in sarcoidosis pathogenesis are largely unknown. We hypothesized that patients with sarcoidosis have characteristic mRNA profiles. Microarray analysis of gene expression was done on peripheral blood (12 patients, 12 controls), lung (6 patients, 6 controls) and lymph node (8 patients, 5 controls). Comparing peripheral blood from patients with sarcoidosis to controls, 872 transcripts were upregulated and 1039 were downregulated at > 1.5-fold change and a significant q value. Several transcripts associated with interferon and STAT1 were upregulated. Lung and lymph node analyses also showed dramatic increases in STAT1 and STAT1-regulated chemokines. Granulomas in lymph nodes of patients with sarcoidosis expressed abundant STAT1 and phosphorylated STAT1. STAT1 might play an important role in sarcoidosis. This novel hypothesis unites seemingly disparate observations with regard to sarcoidosis including implication of a casual role for interferons, a suspected infectious trigger, TH1 predominating lymphocytes in bronchoalveolar lavage, and the association with hypercalcemia.

Objectives To correlate clinical and histopathologic features of an eye with retinal angiomatous proliferation (RAP) secondary to age-related macular degeneration and to investigate the expression of von Willebrand factor (VWF) and vascular endothelial growth factor (VEGF) in this condition. Methods Histopathologic features from serial sections through the globe of an 87-year-old woman with RAP were studied and compared with fluorescein angiography and color fundus photographs obtained 4 months before death. Commercially available anti bodies were used to detect expression of VWF and VEGF in tissue sections. Results The pathologic correlate of RAP was a circumscribed intraretinal angiomatous complex within the outer part of the neurosensory retina overlying a large pigment epithelial detachment. There were no breaks in the Bruch membrane. No choroidal neovascularization was present. Endothelial cells within the RAP lesion immunostained positively for VWF and VEGF. The Bruch membrane expressed VWF adjacent to the RAP. Conclusions Fundus examination and fluorescein angiography images of RAP in a patient with age-related macular degeneration correlated histopathologically with a neovascular intraretinal angiomatous complex, without the presence of sub–retinal pigment epithelial neovascularization. Immunostaining demonstrated that RAP expresses VWF and VEGF.

EphB4 receptors and their ephrinB2 ligands are essential for vascular development, but also play a role in pathological neovascularization (NV). We previously reported that soluble (s) forms of EphB4 and ephrinB2 significantly reduced retinal NV in a model of oxygen-induced retinopathy. This study investigates if these molecules suppress retinal NV by stimulation of endothelial cell (EC) apoptosis.C57BL/6 mice at postnatal day 7 (P7) were exposed to 75% oxygen for 5 days (P12) and allowed to recover in room air to induce retinal NV. One eye was injected intravitreally with 150 ng in 1.5 microL of sEphB4 or sEphrinB2 on P12 and P14, while contralateral eyes were injected with IgG antibody as control. Eyes were enucleated for histological analysis. At P16 TUNEL analysis and caspase-3 immunohistochemistry was performed on retinal sections to compare the apoptotic response between sEphB4 or sEphrinB2 injected eyes and controls. In vitro studies were performed with human retinal microvascular EC (HREC).Quantification of TUNEL positive vascular cells, located in areas of retinal NV, revealed approximately 2.5-fold increase in apoptosis in sEphrinB2 injected eyes compared to control eyes. Immunohistochemistry studies revealed co-localization of both TUNEL positive cells and caspase-3 positive cells with the endothelial marker, von Willebrand factor. Cultured HREC demonstrated significantly higher caspase-3 activity after a 3 h stimulation with sEphrinB2+/-VEGF compared to IgG control+/-VEGF (P0.005). sEphB4 stimulation had no significant effect on caspase-3 activity in HREC cultures.These data suggest that modulation of the endogenous ephrin signaling mechanism by sEphrinB2 may induce suppression of retinal NV via induction of apoptosis. Results of the in vitro studies suggest that sEphrinB2 may directly induce apoptosis of EC during pathological neovascularization.

Background: Toxoplasma gondii infection is a leading cause of posterior uveitis. Human retinal endothelial cells (HREC) are more susceptible to infection with T gondii tachyzoites than other subpopulations of endothelial cells. It is hypothesised that this phenomenon reflects differences in invasion efficiency. Methods: YFP-expressing RH strain T gondii tachyzoites were added to confluent HREC or human dermal endothelial cells (HDEC) (MOI = 50:1). Tachyzoite invasion after 1 h was determined by microplate reading of fluorescence intensity or parasite counts obtained using image analysis software. Selected cultures were incubated for three subsequent days, at which time fluorescence intensity indicated intracellular tachyzoite proliferation. Results: HREC-tachyzoite cultures were more fluorescent than HDEC-tachyzoite cultures after 1 h (p = 0.020, paired t test, 3 experiments). Parasite counts also indicated that more tachyzoites invaded HREC than HDEC (p = 0.042, paired t test, 5 experiments). At 3 days, fluorescence intensity remained higher in HREC-tachyzoite cultures (p⩽0.002, t test, 3 experiments). Conclusion: In culture, T gondii tachyzoites invade HREC with greater efficiency than they invade HDEC. This observation suggests that the relative susceptibility of HREC to infection may reflect a high efficiency of tachyzoite invasion which may be relevant to understanding how T gondii infects human retina.

Purpose To describe the disease characteristics and visual outcome of pediatric uveitis. Design Retrospective, longitudinal observation. Participants Five hundred twenty-seven pediatric uveitis patients from the National Eye Institute, University of Illinois, Chicago, and Oregon Health Sciences University. Methods Retrospective chart review. Main Outcome Measures Demographics, uveitis disease characteristics, complications, treatments, and visual outcomes were determined at baseline and at 1-, 3-, 5-, and 10-year time points. Results The patient population was 54% female; 62.4% white, 12.5% black, 2.7% Asian, 2.1% multiracial, and 14.61% Hispanic. Median age at diagnosis was 9.4 years. The leading diagnoses were idiopathic uveitis (28.8%), juvenile idiopathic arthritis-associated uveitis (20.9%), and pars planitis (17.1%). Insidious onset (58%) and persistent duration (75.3%) were most common. Anterior uveitis was predominant (44.6%). Complications were frequent, and cystoid macular edema (odds ratio [OR] 2.94; P = 0.006) and hypotony (OR, 4.54; P = 0.026) had the most significant visual impact. Ocular surgery was performed in 18.9% of patients. The prevalence of legal blindness was 9.23% at baseline, 6.52% at 1 year, 3.17% at 3 years, 15.15% at 5 years, and 7.69% at 10 years. Posterior uveitis and panuveitis had more severe vision loss. Hispanic ethnicity was associated with a higher prevalence of infectious uveitis and vision loss at baseline. Conclusions The rate and spectrum of vision threatening complications of pediatric uveitis are significant. Prospective studies using standard outcome measures and including diverse populations are needed to identify children most at risk. Financial Disclosure(s) The authors have no proprietary or commercial interest in any of the materials discussed in this article.

Purpose To report seven cases of uveitis occurring in patients with autoimmune hepatitis (AIH), raising the possibility that uveitis may be an extrahepatic feature of AIH. Design Multicenter, retrospective, observational case series of patients with AIH and uveitis. Methods One index case was identified at Oregon Health & Science University. Further cases were identified by a web-based survey of members of the American Uveitis Society, the International Uveitis Study Group, the Proctor Foundation mailing list server, and the First SUN International Workshop. Respondents were asked to provide clinical information about uveitis phenotype, AIH features, and treatment. Results Clinical information was obtained for seven individuals (four females and three males; age range, seven to 67 years) who suffered from AIH and uveitis. Average duration of follow-up was 5.5 years. All patients had chronic, persistent bilateral uveitis that was anterior (n = 3), intermediate (n = 1), or pan (n = 3) in location. Every patient had complications arising from his or her uveitis, including cataract (n = 5), glaucoma (n = 3), cystoid macular edema (n = 3), and posterior synechiae (n = 3). Final visual acuities ranged from 20/16 to hand movements. To treat the uveitis and/or AIH, the majority of patients required oral prednisone and all seven patients were treated with systemic immunosuppression. Conclusion Despite the small size of this study, our findings suggest an association between AIH and uveitis. The uveitis is chronic, bilateral, and associated with sight-threatening complications, necessitating systemic immunosuppression in some individuals.

Clinical trials of small interfering RNA (siRNA) targeting vascular endothelial growth factor-A (VEGFA) or its receptor VEGFR1 (also called FLT1), in patients with blinding choroidal neovascularization (CNV) from age-related macular degeneration, are premised on gene silencing by means of intracellular RNA interference (RNAi). We show instead that CNV inhibition is a siRNA-class effect: 21-nucleotide or longer siRNAs targeting non-mammalian genes, non-expressed genes, non-genomic sequences, pro- and anti-angiogenic genes, and RNAi-incompetent siRNAs all suppressed CNV in mice comparably to siRNAs targeting Vegfa or Vegfr1 without off-target RNAi or interferon-alpha/beta activation. Non-targeted (against non-mammalian genes) and targeted (against Vegfa or Vegfr1) siRNA suppressed CNV via cell-surface toll-like receptor 3 (TLR3), its adaptor TRIF, and induction of interferon-gamma and interleukin-12. Non-targeted siRNA suppressed dermal neovascularization in mice as effectively as Vegfa siRNA. siRNA-induced inhibition of neovascularization required a minimum length of 21 nucleotides, a bridging necessity in a modelled 2:1 TLR3-RNA complex. Choroidal endothelial cells from people expressing the TLR3 coding variant 412FF were refractory to extracellular siRNA-induced cytotoxicity, facilitating individualized pharmacogenetic therapy. Multiple human endothelial cell types expressed surface TLR3, indicating that generic siRNAs might treat angiogenic disorders that affect 8% of the world's population, and that siRNAs might induce unanticipated vascular or immune effects.

Immune-mediated uveitis is a collective term referring to a group of potentially blinding intraocular inflammations which may coexist with systemic inflammatory diseases. T lymphocytes appear to play an important pathogenic role in uveitis, and these cells are therefore the logical target of drug therapy. Corticosteroids act nonspecifically, but are highly effective in controlling the inflammation rapidly. They are administered locally when disease is confined to the anterior portion of the eye.However, posterior eye involvement often requires systemic corticosteroid therapy,carrying a high risk of serious adverse effects when used for extended periods. In this situation, steroid-sparing agents are used. Few relevant randomised, controlled clinical trials have been performed, and the choice of systemic immunosuppressive regimen is usually guided by individual patient characteristics, cost, drug availability and physician preference. Patients should actively participate in therapeutic decision-making. Our first choice for steroid-sparing medication is often methotrexate, an antimetabolite which carries a low risk of adverse reactions when appropriately prescribed and monitored, is relatively inexpensive, and has once-weekly ease of use. For more severe uveitis, we may combine the immunomodulating agent cyclosporin with methotrexate and a corticosteroid. Azathioprine and cyclophosphamide are other treatment options. Steroid-sparing drugs also have significant potential for causing adverse effects, albeit less frequently than corticosteroids. Future therapies aim to reduce this problem by increasing the specificity of the therapeutic action.

The ocular vascular endothelium plays a key role in the development of several leading retinal causes of blindness in Western nations. Choroidal endothelial cells are integral to the subretinal neovascular lesions that characterize the exudative form of late age-related macular degeneration (AMD), and retinal endothelial cells participate in the initiation of diabetic retinopathy and posterior uveitis. Vascular endothelial cells at different sites exhibit considerable molecular diversity. This diversity has implications for understanding the pathogenesis of tissue-specific diseases and for the development of targeted therapies to treat these conditions. Previous work from our group has identified significant differences in the gene transcript profiles of human retinal and choroidal endothelial cells. Because the proteome ultimately determines the behavior of any given cell, however, it is critical to determine whether molecular differences exist at the level of protein expression.Retinal and choroidal endothelial cells were separately isolated from five sets of human eyes by enzymatic digestion with type II collagenase followed by anti-CD31 antibody-conjugated magnetic bead separation. Cells were washed to remove serum peptides in the culture medium, and lysed by sonication in buffer containing 2% sodium dodecyl sulfate. Protein was then precipitated with acetone. Retinal and choroidal endothelial samples from each donor were labeled with Cy3 and Cy5, respectively, mixed with a Cy2-labeled pooled protein sample to facilitate spot matching across gels, and separated by two-dimensional difference gel electrophoresis (2D-DIGE). Following a global normalization, differentially abundant protein spots that were visible in at least four of five donor gels were detected by the significance analysis of microarrays method, with false discovery rate set at 5%. Corresponding spots were excised from additional DIGE-labeled or Coomassie-stained 2D electrophoretic gels. Protein identification was performed by liquid chromatography and tandem mass spectrometry.Of 123 protein spots detected by 2D-DIGE that qualified for statistical analysis, we found 31 spots that demonstrated a significant difference in abundance between retinal endothelial samples versus choroidal endothelial samples. For 17 proteins, over 50% of the spectral counts could be matched to a single protein in the digested spot. Eleven proteins were more abundant in retinal endothelial cells (i.e., inorganic pyrophosphatase, protein disulfide isomerase A3, calreticulin, peroxiredoxin-4, protein disulfide isomerase, serpin B9, F-actin capping protein subunit beta, coactosin-like protein, vimentin, cathepsin B, and a high molecular weight form of annexin A3). Six proteins were more abundant in choroidal endothelial cells (i.e., glutathione peroxidase 1, ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCH-L1), heat-shock protein beta-1, superoxide dismutase (Cu-Zn), nucleoside diphosphate kinase A, and a low molecular weight form of annexin 3).Our data indicate that the proteomes of retinal and choroidal vascular endothelial cells are different. Several differentially expressed proteins are implicated in the regulation of angiogenesis; these include cathepsin B and UCH-L1, proteins with transcripts that were also differently expressed according to microarray. Our observations further suggest that angiogenesis within the retina, a component of severe diabetic retinopathy and posterior uveitis, may be controlled by different mechanisms to those regulating choroidal neovascularization, as occur in exudative AMD. Future studies to establish the role of these angiogenic proteins in disease may suggest potential new targets for tissue-specific therapies.

Although the pathogenesis of primary central nervous system lymphoma (PCNSL) remains unclear, it is hypothesized that specific chemokine-chemokine receptor interactions may attract malignant B lymphocytes into the CNS. Formalin-fixed, paraffin-embedded brain biopsy specimens from 40 patients with PCNSL were immunostained by an indirect immunohistochemical method incorporating antigen retrieval to detect the presence of B-cell chemokines, stromal cell-derived factor-1 (SDF-1; CXCL12) and macrophage inflammatory protein-3alpha (MIP-3alpha, CCL20), and the SDF-1 receptor, CXCR4. To assist in phenotyping of SDF-1 + cells, specimens were also stained for CD20 (B cells). Positive staining for SDF-1 was identified in all PCNSL cases and in tonsil. In biopsy specimens, SDF-1 expression was localized to resident brain cells and, in 80% of specimens, CD20+ malignant lymphocytes. Tumor cells also stained positively for CXCR4. In contrast, although expression ofMIP-3alpha was detected in tonsil, no expression of this chemokine could be demonstrated in PCNSL biopsy specimens. Our observations raise the possibility of targeting the SDF-1-CXCR4 signaling pathway as a potential treatment for PCNSL.

Multiple immunosuppressive drugs have been used to manage inflammatory eye disease when control cannot be achieved by corticosteroid alone. However, although clinical studies support the effectiveness of most of these agents, comparative studies have not been undertaken. Retention time, a measure of the duration of treatment with any given drug, is a crude indicator of drug effectiveness and tolerability that facilitates such a comparison. The retention time was compared for corticosteroid-sparing immunosuppressive agents in patients attending our tertiary referral inflammatory eye disease clinic.The clinical records of all patients attending an inflammatory eye disease clinic at the Casey Eye Institute over a 1-year period (2003) were reviewed. From these records, we collected the following clinical data: age; sex; ocular diagnosis; and use of steroid-sparing systemic immunosuppression, including drugs, duration of treatment and, if ceased, reasons for cessation. Cox regression analysis, adjusted for clustering, was used to compare other drugs against methotrexate.107 of 302 (35%) patients seen at the inflammatory eye disease clinic in 2003 had a total of 193 current or past prescriptions for systemic steroid-sparing immunosuppressive agents. The treated group, most of whom had uveitis, included 32 men and 75 women, aged 5-86 years. Most commonly prescribed were methotrexate (66 uses, 34%), ciclosporin (37 uses, 19%), azathioprine (26 uses, 13%), mycophenolate mofetil (22 uses, 11%) and cyclophosphamide (15 uses, 8%). Patients were retained significantly less on ciclosporin (p = 0.004), azathioprine (p = 0.04), mycophenolate mofetil (p = 0.04) and cyclophosphamide (p0.001) compared with methotrexate. Reasons for cessation included adverse events, lack of effectiveness, success or remission, cost and desire for fertility.In patients with inflammatory eye disease, methotrexate may offer a superior combination of effectiveness and tolerability over other commonly used corticosteroid-sparing immunosuppressive agents. In this study, there was a twofold risk of not being retained on azathioprine, mycophenolate mofetil and ciclosporin and a fourfold risk of not being retained on cyclophosphamide compared with methotrexate.

Purpose Tubulointerstitial nephritis and uveitis syndrome (TINU) is a specific form of uveitis that is unfamiliar to most ophthalmologists. Thus, it is frequently overlooked in differential diagnosis. We hypothesized that recognition of subsets of uveitis can facilitate the diagnosis of rare entities such as TINU. Design Retrospective case series. Participants One thousand nine hundred eighty-five patients with uveitis. Methods We performed a computerized database analysis of patients evaluated for uveitis at the Casey Eye Institute from September 1985 until May 2005. The database includes details about ocular inflammation, including specific diagnosis, anatomic location, laterality, continuity, onset, complications, HLA-B27 status, and relative diagnostic certainty. Additionally, we reviewed all charts of patients diagnosed with TINU or with a presentation of uveitis that was typical of TINU (i.e., bilateral sudden-onset anterior uveitis). Main Outcome Measures Prevalence of TINU in identifiable subsets of patients with uveitis, visual acuity (VA), and renal function. Results Individuals with TINU (n = 33) represented 1.7% of all patients with uveitis. However, TINU was diagnosed in 32 of the 316 patients (10%) presenting with bilateral sudden-onset anterior uveitis and in 20 of 62 of these patients (32%) who were younger than 20 years. Creatinine levels were more likely to be elevated in patients older than 40. Most patients maintained excellent VA and did not develop clinically significant renal impairment. Conclusion Tubulointerstitial nephritis and uveitis syndrome is a common cause of uveitis among patients who present with bilateral sudden-onset anterior uveitis. The size of this series clarifies the understanding of the relationship between renal and ocular disease; facilitates recognition of the syndrome; and adds to the knowledge on prognosis, complications, and role of antecedent medications.

The term scleritis describes a chronic inflammation that involves the outermost coat and skeleton of the eye. Disease can be isolated to the eye, but in up to half of affected individuals it occurs in the context of an immune-mediated systemic inflammatory condition, such as rheumatoid arthritis or Wegener's granulomatosis. Although uncommon, scleritis is often extremely painful, can lead to vision-threatening complications (and involvement of other ocular tissues), and is considered to confer an increased risk of mortality in patients with rheumatoid arthritis. Pathogenic mechanisms in scleritis are poorly understood, but enzymatic degradation of collagen fibrils by resident cells and infiltrating leukocytes seems to be a key feature. Several forms of inflammation can be distinguished histologically; interestingly, although the disease typically presents with engorgement of scleral vessels, vasculitis is not universally present at the microscopic level. Although some patients with scleritis respond well to treatment with NSAIDs, aggressive systemic therapy is often required to obtain a favorable outcome, particularly when systemic disease coexists. The mainstay of treatment is oral prednisone, but this agent is usually combined with a steroid-sparing immunosuppressive drug. New therapies presently under investigation for scleritis include local corticosteroid injections and various biologic agents.