Search

Owing to the unique synthetic routes, the nascent d-UHMWPE possesses nonequilibrium heterogeneous melt and significantly lower nascent entanglement density that endow nascent d-UHMWPE with optimized flowability, excellent solid-phase and melt processing performances. [Display omitted] The advent of nascent d-UHMWPE overcomes the intrinsic melting defects and crystal boundaries within the commercial UHMWPE (C-UHMWPE) based products, and opens the access to high value-added UHMWPE materials with long lifetime and improved qualities. The nascent d-UHMWPE derives from the disentanglement of UHMWPE that calls for suitable synthetic routes to d-UHMWPE. With a continuous development the synthesis of d-UHMWPE can be achieved either by single site catalysts or heterogeneous solid catalysts, and demonstrates a much easier processability within a wider temperature window. The processed d-UHMWPE demonstrates superior drawability, flexibility, toughness and thermal conductivity et al., and promises to be used in packages, bullet-proof armors, total knee/hip/ankle joint replacements, aerospace and marine engineering et al. The contribution systematically reviews the origin, catalytic synthesis, processing and applications of the nascent d-UHMWPE, and gives a detailed description on the conceptual proposal, the core and key points facing to the nascent d-UHMWPE. By analyzing the scientific problems still existing in the relating researches, the developmental trends and prospects of the nascent d-UHMWPE are envisioned. [ABSTRACT FROM AUTHOR]

• The mixed solvent of TBP and IPE was first used to extract H 3 PO 4 from the leachate of HCl and low-grade phosphate rocks. • The relation of total extraction percent and cross-flow extraction stages for all tested components were summarized. • The mass transfer of H 3 PO 4 extraction was studied in our work. • The mechanism of H 3 PO 4 extraction was discussed. The mixed solvent of tributylphosphate and isopropyl ether was used to extract H 3 PO 4 and separate Ca2+ and Cl− from low concentration wet process phosphoric acid prepared by low-grade collophane and 30 wt% hydrochloric acid solution. Then, the effects of extraction temperature, composition of solvent mixture, aqueous/organic phase ratio, extraction time and extraction stage were investigated, respectively. The result shows that the extraction process of H 3 PO 4 is an exothermic process and the enthalpy changes (ΔH) is −12.50 kJ mol−1. The McCabe–Thiele diagram shows two counter-current stages achieves about 76.9 wt% H 3 PO 4 extraction at 293 K. Based on the mass transfer theory of liquid–liquid extraction, extraction yields for all tested component were summarized as an exponential function of cross-flow extraction stages. Meanwhie, extraction mechanism studies show that the comlex of αH 3 PO 4 βTBP was formed in extraction process and higher Ca2+ concentration was beneficial for H 3 PO 4 extraction. Meanwhile, the effects of stripping temperature, aqueous/organic phase ratio and stripping time on the re-extraction performance of H 3 PO 4 , Ca2+ and Cl− were studied, respectively. The result of experiment will provide some theoretical support for the industrial application of HCl-route wet process phosphoric acid on low-grade phosphate rock and phosphate tailings. [ABSTRACT FROM AUTHOR]

The hydroxyl groups (-OH) was modified on the surface metal-organic framework UiO-66 to improve the adsorption capacity of cationic dye methylene blue (MB). In this work, a novel preparation method was adopted to obtain the adsorbents through adjusting the amount of hydrochloric acid (HCl), which is a regulator, in reactions to obtain non-crystalline materials (NCM-WIT) and crystalline materials (U-(OH) 2) which is modified MOFs by -OH groups. They both showed excellent MB adsorption performance in the pH range of 3–11. From the experimental analysis, the results were shown that the zeta potentials of adsorbents surface are more negative improving the adsorption capacity of cationic dye MB. The fitting results of their adsorption isotherms and adsorption kinetics fit the Langmuir model and pseudo-second-order kinetic, respectively. It was found that U-(OH) 2 has a more stable regeneration capacity just using solvent washing. This study provides a good idea for wastewater treatment containing cationic dyes. [Display omitted] [ABSTRACT FROM AUTHOR]

• Reduced graphene oxide assisted g-C 3 N 4 /rGO/NiAl-LDHs type II heterostructure is fabricated. • The composite exhibits excellent photocatalytic CO 2 reduction activity. • DFT calculation explores the possible mechanism. • rGO could act as an electron transfer bridge to facilitate the charge separation. Photocatalytic CO 2 reduction has been considered as a potential way to solve the energy problem and the greenhouse effect. In this work, layered g-C 3 N 4 /rGO/NiAl-LDHs heterojunctions were prepared by using a hydrothermal method, the optimized composite exhibited enhanced photocatalytic CO 2 reduction to CO (2.6 μmol h−1g−1) and CH 4 (20 μmol h−1g−1) activity, which was 3.7 and 14.2 times higher than that of pure g-C 3 N 4 , respectively. According to the experimental and density functional theory calculation (DFT) results, it is believed that with the large contact interface and excellent electron mobility rGO could act as an electron transfer bridge to facilitate the rapid charge migration and separation between g-C 3 N 4 and NiAl-LDHs. Thus, driven by the internal electric field, interfacial band edge bending, as well as the type II heterostructure, the activity of g-C 3 N 4 /rGO/NiAl-LDHs could be greatly enhanced. This work provides a possible way to rational design and fabrication of rGO-assisted composite systems with type II, Schottky, S-scheme, P-N and other heterojunctions. [ABSTRACT FROM AUTHOR]

[Display omitted] • S-doped g-C 3 N 4 was synthesized via pyrolyzing a mixture of urea and thiourea. • P123 was used to envelop S-g-C 3 N 4 to form core–shell S-g-C 3 N 4 @P123 sample. • The pyrolysis of S-g-C 3 N 4 @P123 yielded N-S-C catalyst. • N-S-C catalyst exhibits a half-wave potential of 0.863 V in alkaline media. The advantage of g-C 3 N 4 as nitrogen-rich precursor for synthesizing nitrogen-doped carbon-based oxygen reduction reaction (ORR) catalyst has not been brought into full play. Herein, a simple approach with S-doped g-C 3 N 4 (S-g-C 3 N 4) and P123 as precursor for synthesizing nitrogen and sulfur co-doped carbon (N-S-C) catalysts highly efficient for ORR was developed. S-g-C 3 N 4 synthesized via pyrolysis of a mixture of urea and thiourea was used as nitrogen and sulfur source, and P123 serving as carbon source was used to envelop S-g-C 3 N 4 to form core–shell S-g-C 3 N 4 @P123 sample, whose pyrolysis yielded N-S-C catalyst. Characterization shows that the N-S-C catalyst synthesized at 900 °C with a S-g-C 3 N 4 /P123 mass ratio of 2:1 (N-S-C-2) exhibits the largest nitrogen and sulfur content and the highest half-wave potential of 0.863 V vs. RHE in alkaline media, which can be ascribed to the selection of the mixture of urea and thiourea for S-g-C 3 N 4 synthesis, and the suitable S-g-C 3 N 4 /P123 mass ratio and pyrolysis temperature. N-S-C-2 also shows good ORR catalytic stability, excellent methanol tolerance, and high performance as the cathodic catalyst of Zn-air battery. This study gives full play to the advantage of g-C 3 N 4 and provides a novel route for synthesizing N-S-C catalysts highly efficient for ORR. [ABSTRACT FROM AUTHOR]

Carbon-based electrodes are usually poor in volumetric supercapacitor performance in terms of volumetric capacitance (<200 F/cm3) and energy density (usually <10 Wh/L) resulted from low packing density. Herein, we propose a strategy for the preparation of nanocarbon electrodes that are ultrahigh in volumetric supercapacitor performance by creating nanocarbon with high packing density and rich pseudocapacitive nitrogen doping, in which the nitrogen doping is to provide extra capacitance. The derived nanocarbons (ZHNCs) have not only large packing density of 1.14–1.49 g/cm3 and rich nitrogen content (12.3–24.8 atom%), but also homogeneous element distribution. Benefited from the synergetic effect of the above characteristics, the ZHNCs-based electrodes exhibit superior volumetric performances of ultrahigh capacitance of 528 F/cm3 in 1.0 M H 2 SO 4 and 465 F/cm3 in 6.0 M KOH, large energy density of 26.8 Wh/L at 2682 W/L, and impressive cycling stability with about 95% capacitance retention after continual charge/discharge of 20 000 cycles at current density of 20 A/g, indicative of potential applications in the fields of energy storage. [Display omitted] • Nanocarbons (ZHNCs) with high density and rich nitrogen (24.3 atom%) were fabricated. • ZHNCs achieves large gravimetric- (464 F/g) and ultrahigh volumetric capacitances (528 F/cm3). • The ZHNCs based electrode shows a large energy density of 26.8 Wh/L at 2682 W/L. • ZHNCs electrode exhibits superior stability with about 95% capacitance retention after 20 000 cycles. [ABSTRACT FROM AUTHOR]

• The mixed solvent of nBA and IPE was first used to extract H 3 PO 4 from HCl-route WPA. • The relation of E i, tal and N for all tested components were summarized. • The thermodynamic data of extraction process was calculated. • The mechanism and stage of H 3 PO 4 extraction were analyzed. Solvent extraction of phosphoric acid from wet process phosphoric acid produced by decomposing low grade phosphate with hydrochloric acid was investigated by the mixture of n-butanol (nBA) and isopropyl ether (iPE). The experimental results show that the mixture has good performance on P 2 O 5 extraction and Ca2+ purification from HCl-route wet-process phosphoric acid. Optimization of extraction process shows that nBA has good performance for H 3 PO 4 separation at the condition of 5:1 O/A phase ratio, 293 K extraction temperature, 9:1 V B /V E ratio and 15 min extraction time. Based on the Van't Hoff equation, the enthalpy changes of P 2 O 5 extraction was calculated to be −16.41 kJ.mol−1. The results from liquid-liquid mass transfer show three stages can achieved about 90 wt% P 2 O 5 extraction regardless of the countercurrent and cocurrent extraction. And the relation of total extraction percent and cross-flow extraction stages for all tested components were summarized. Moreover, the extraction mechanism between H 3 PO 4 and nBA was discussed by researching the extraction equilibrium under different conditions. The result showed that phosphoric acid was extracted in the form of H 3 PO 4 ·nBA, H 3 PO 4 ·2 nBA and H 3 PO 4 ·3 nBA complexes. Stripping operations using Deionized water as a extractant for phosphoric acid was also investigated at different conditions. [ABSTRACT FROM AUTHOR]

The unreacted shrinking core model for the degradation scheme of a mineral particle. • The leaching behaviors of potassium and aluminum were investigated. • Potassium was preferentially leached compared to aluminum. • The higher dissolved fraction of potassium compared with aluminum was successfully interpreted. • The leaching kinetics obeys a semiempirical kinetic model based on the classical shrinking core model. • There are two distinct stages in the leaching process controlled by the chemical reaction. The leaching behaviours of potassium and aluminum from phosphorus-potassium associated ore in HCl-CaF 2 media were investigated at temperature from 60 to 90 °C. The higher dissolved fraction of potassium compared with aluminum was found in this study though they were mainly incorporated into the same mineralogical phase of potash feldspar in the ore. Moreover, the dissolved fraction of potassium was always higher than aluminum in all the investigated conditions due to the existence of secondary precipitation phase such as amorphous alumino-silicate or the formation of insoluble AlF complex in the leaching process. In addtion, the leaching kinetic data were successfully examined by a semiempirical kinetic model based on the classical shrinking core model. It was found that there are two distinct stages in the leaching process and the kinetics of both stages follows the semiempirical kinetic model with chemical reaction being the rate-controlling step. The activation energies for potassium and aluminum from the ore were 39.031 and 44.260 kJ·mol−1 at first leaching stage, and 59.274 and 62.944 kJ·mol−1 at second leaching stage, respectively. [ABSTRACT FROM AUTHOR]

• The high energetic materials were designed based on coupling between TKX-50 and polymers. • The mechanical responses and coupling behavior were studied in microscopic scale. • The microscopic behaviors of deformation of TKX-50/polymer were studied using NEMD simulations. • The elastic moduli of nanocomposites TKX-50/polymer reduced with the increases of the polymer concentration. TKX-50 (dihydroxylammonium 5,5′-bistetrazole-1,1′-diolate) has high energy storage, high detonation speed, low sensitivity and low toxicity. The addition of polymer binders can provide better flexibility for TKX-50 to improve safety when they are subjected to external mechanical stimuli. In this work, four polymer binders, i.e. glycidyl azide polymer (GAP), polyglycidyl nitrate (PGN), polyethylene glycol (PEG) and polytetrahydrofuran (poly-THF), are added to TKX-50 with a mass fraction from 1% to 12%. Matrix notation calculations showed that the elastic moduli of nanocomposites TKX-50/polymers reduced with the increase of the polymer concentration. The microscopic behavior of deformation of TKX-50/polymers were studied using non-equilibrium molecular dynamics (NEMD) simulations. Dependence of tensile strength and Young's modulus on the mass fractions and structure of polymer binders was investigated. It is found that the GAP and PGN self-crimp on the surface of TKX-50, while PEG and poly-THF are extended on the surface of TKX-50. Our results showed that polymer binders can improve the mechanical properties of TKX-50 with an order of poly-THF ≈ PEG > PGN > GAP. [ABSTRACT FROM AUTHOR]

Hermetia illucens larvae are known for their ability to recycle organic waste, but their capacity to recover waste oils and the role of gut microorganisms in this process are not fully understood. To gain further insights, the biological recovery of waste frying oil into valuable lipids and the influence of gut bacteria on this biotransformation were investigated. The larvae efficiently digested and absorbed waste frying oil, demonstrating their potential for converting various oils into insect fat. The presence of different fatty acids in their diet significantly altered gut bacterial communities, enriching certain genera such as Actinomyces, Enterococcus, and Providencia. Redundancy analysis revealed that the composition and structure of these bacterial communities were predictive of their function in the biotransformation of fatty acids and the lipid biosynthesis in the larvae. Specific bacteria, including Corynebacterium&#95;1, Providencia, Actinomyces, Escherichia-Shigella, and others, were identified to play specialized roles in the digestion and absorption of fatty acids, contributing to lipid synthesis and storage. These findings highlight the potential of Hermetia illucens in the biological recovery of waste frying oil and underscore the crucial role of gut microbiota in this process, offering a sustainable approach to waste management and bioenergy production., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

To explore the oncogenic mechanism of FOXM1 in the tumor microenvironment (TME) regarding triple negative breast cancer (TNBC) promotion. The mRNA and protein levels of target genes in TNBC cells and their exosomes were detected by RT-qPCR and western blot. Co-culture models of TNBC cells and THP-1/M0 macrophages was established to detect the impact of co-culture on FOXM1 expression and macrophage polarization direction. The bioinformatics website was used to predict the binding sites between the FOXM1 and IDO1 promoter, which were further validated using dual-luciferase reporter assay and chromatin immunoprecipitation (ChIP) assay. Finally, after erastin-induced ferroptosis, Cell Counting Kit-8 (CCK-8), terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL), and other experiments were conducted to investigate whether the FOXM1/IDO1 axis regulates M2 macrophage polarization through ferroptosis. It was found that FOXM1 was highly expressed in exosomes derived from TNBC cells, and TNBC cells upregulated FOXM1 expression in THP-1 cells through exosomes to promote M2 macrophage polarization. Furthermore, FOXM1 upregulated IDO1 in M2-type TAMs by regulating transcription. Lastly, FOXM1/IDO1 inhibited ferroptosis, promoting M2 macrophage polarization, thereby advancing TNBC progression. In conclusions, FOXM1 derived from TNBC cell-derived exosomes activated IDO1 transcription in TAMs to inhibit ferroptosis, promoting TAMs' M2 polarization and exerting carcinogenic effects.

Hermetia illucens larvae can enhance the degradation of oxytetracycline (OTC) through its biotransformation. However, the underlying mechanisms mediated by gut metabolites and proteins are unclear. To gain further insights, the kinetics of OTC degradation, the functional structures of gut bacterial communities, proteins, and metabolites were investigated. An availability-adjusted first-order model effectively evaluated OTC degradation kinetics, with degradation half-lives of 4.18 and 21.71 days for OTC degradation with and without larval biotransformation, respectively. Dominant bacteria in the larval guts were Enterococcus, Psychrobacter, Providencia, Myroides, Enterobacteriaceae, and Lactobacillales. OTC exposure led to significant differential expression of proteins, with functional classification revealing involvement in digestion, transformation, and adaptability to environmental stress. Upregulated proteins, such as aromatic ring hydroxylase, acted as oxidoreductases modifying the chemical structure of OTC. Unique metabolites, aclarubicin and sancycline identified were possible OTC metabolic intermediates. Correlation analysis revealed significant interdependence between gut bacteria, metabolites, and proteins. These findings reveal a synergistic mechanism involving gut microbial metabolism and enzyme structure that drives the rapid degradation of OTC and facilitates the engineering applications of bioremediation., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Hermetia illucens larvae showcases remarkable bioremediation capabilities for both antibiotics and heavy metal contaminants. However, the distinctions in larval intestinal microbiota arising from the single and combined effects of antibiotics and heavy metals remain poorly elucidated. In this study, we delved into the details of larval intestinal bacterial communities and microbial metabolites when exposed to single and combined contaminants of oxytetracycline (OTC) and hexavalent chromium (Cr(VI)). After conversion, single contaminant-spiked substrate showed 75.5% of OTC degradation and 95.2% of Cr(VI) reductiuon, while combined contaminant-spiked substrate exhibited 71.3% of OTC degradation and 93.4% of Cr(VI) reductiuon. Single and combined effects led to differences in intestinal bacterial communities, mainly reflected in the genera of Enterococcus, Pseudogracilibacillus, Gracilibacillus, Wohlfahrtiimonas, Sporosarcina, Lysinibacillus, and Myroide. Moreover, these effects also induced differences across various categories of microbial metabolites, which categorized into amino acid and its metabolites, benzene and substituted derivatives, carbohydrates and its metabolites, heterocyclic compounds, hormones and hormone-related compounds, nucleotide and its metabolites, and organic acid and its derivatives. In particular, the differences induced OTC was greater than that of Cr(VI), and combined effects increased the complexity of microbial metabolism compared to that of single contaminant. Correlation analysis indicated that the bacterial genera, Preudogracilibacillus, Enterococcus, Sporosarcina, Lysinibacillus, Wohlfahrtiimonas, Ignatzschineria, and Fusobacterium exhibited significant correlation with significant differential metabolites, these might be used as indicators for the resistance and bioremediation of OTC and Cr(VI) contaminants. These findings are conducive to further understanding that the metabolism of intestinal microbiota determines the resistance of Hermetia illucens to antibiotics and heavy metals., Competing Interests: Declaration of competing interest The authors declare no competing financial interest., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Root rot caused by Fusarium spp. is the most destructive disease on Atractylodes lancea , one of the large bulks and most common traditional herbal plants in China. In this study, we isolated a bacterial strain, CF3, from the rhizosphere soil of A. lancea and determined its inhibitory effects on F. oxysporum in both in vitro and in vivo conditions. To deeply explore the biocontrol potential of CF3, we sequenced the whole genome and investigated the key pathways for the biosynthesis of many antibiotic compounds. The results revealed that CF3 is a member of Burkholderia ambifaria , harboring two chromosomes and one plasmid as other strains in this species. Five antibiotic compounds were found that could be synthesized due to the existence of the bio-synthesis pathways in the genome. Furthermore, the synthesis of antibiotic compounds should be confirmed by in vitro experiments and novel compounds should be purified and characterized in further studies.

Breast cancer has a high incidence and a heightened propensity for metastasis. The absence of precise targets for effective intervention makes it imperative to devise enhanced treatment strategies. Exosomes, characterized by a lipid bilayer and ranging in size from 30 to 150 nm, can be actively released by various cells, including those in tumors. Exosomes derived from distinct subsets of immune cells have been shown to modulate the immune microenvironment within tumors and influence breast cancer progression. In addition, tumor-derived exosomes have been shown to contribute to breast cancer development and progression and may become a new target for breast cancer immunotherapy. Tumor immunotherapy has become an option for managing tumors, and exosomes have become therapeutic vectors that can be used for various pathological conditions. Edited exosomes can be used as nanoscale drug delivery systems for breast cancer therapy, contributing to the remodeling of immunosuppressive tumor microenvironments and influencing the efficacy of immunotherapy. This review discusses the regulatory role of exosomes from different cells in breast cancer and the latest applications of exosomes as nanoscale drug delivery systems and immunotherapeutic agents in breast cancer, showing the development prospects of exosomes in the clinical treatment of breast cancer., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Wang, Ma, Wang, Xing, Li, Wang and Wang.)

Atractylodes lancea is a perennial herb whose rhizome (AR) is a valuable traditional Chinese medicine with immense market demand. The cultivation of Atractylodes lancea faces outbreaks of root rot and deterioration in herb quality due to complex causes. Here, we investigated the effects of Trichoderma spp., well-known biocontrol agents and plant-growth-promoters, on ARs. We isolated Trichoderma strains from healthy ARs collected in different habitats and selected three T . harzianum strains (Th2, Th3 and Th4) with the strongest antagonizing effects on root rot pathogens ( Fusarium spp.). We inoculated geo-authentic A . lancea plantlets with Th2, Th3 and Th4 and measured the biomass and quality of 70-day-old ARs. Th2 and Th3 promoted root rot resistance of A . lancea . Th2, Th3 and Th4 all boosted AR quality: the concentration of the four major medicinal compounds in ARs (atractylon, atractylodin, hinesol and β-eudesmol) each increased 1.6- to 18.2-fold. Meanwhile, however, the yield of ARs decreased by 0.58- to 0.27-fold. Overall, Th3 dramatically increased the quality of ARs at a relatively low cost, namely lower yield, showing great potential for practical application. Our results showed selectivity between A. lancea and allochthonous Trichoderma isolates, indicating the importance of selecting specific microbial patches for herb cultivation.

Hermetia illucens larvae are recognized for their ability to mitigate or eliminate contaminants by biodegradation. However, the biodegradation characteristics of microplastics and phthalic acid esters plasticizers, as well as the role of larval gut microorganisms, have remained largely unrevealed. Here, the degradation kinetics of plasticizers, and biodegradation characteristics of microplastics were examined. The role of larval gut microorganisms was investigated. For larval development, microplastics slowed larval growth significantly (P < 0.01), but the effect of plasticizer was not significant. The degradation kinetics of plasticizers were enhanced, resulting in an 8.11 to 20.41-fold decrease in degradation half-life and a 3.34 to 3.82-fold increase in final degradation efficiencies, compared to degradation without larval participation. The depolymerization and biodeterioration of microplastics were conspicuously evident, primarily through a weight loss of 17.63 %-25.52 %, variation of chemical composition and structure, bio-oxidation and bioerosion of microplastic surface. The synergistic effect driven by larval gut microorganisms, each with various functions, facilitated the biodegradation. Specifically, Ignatzschineria, Paenalcaligenes, Moheibacter, Morganella, Dysgonomonas, Stenotrophomonas, Bacteroides, Sphingobacterium, etc., appeared to be the key contributors, owing to their xenobiotic biodegradation and metabolism functions. These findings offered a new perspective on the potential for microplastics and plasticizers biodegradation, assisted by larval gut microbiota., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Astragalus mongholicus Bge. [A. membranaceus Bge. var. mongholicus (Bge.) Hsiao] is a highly valuable perennial medicinal plant mainly distributed in China, whose dry roots are known as Huangqi in traditional Chinese medicine for reinforcing vital energy, strengthening superficial resistance, and promoting tissue regeneration (Lin et al. 2000). A. mongholicus roots of high quality are produced in Northwest and North China. Since July 2021, powdery mildew outbreaks happened annually on the leaves of A. mongholicus in a plantation (123° 56' 40'' E, 47° 22' 20'' N) in Qiqihar city, Heilongjiang Province, China. Disease incidence reached 100% by October (Fig. 1A-C), causing severe impairment of growth. Powdery mildew spots of circular or irregular shapes emerged on upper surface of leaf, resulting in plentiful lesion specks. Dense white hyphae appeared chaotically intertwined. Hyphae were hyaline and highly flexuous, 5.3 - 10.7 μm in diameter (n = 20). Chasmothecia were globose or slightly ovoid-shaped and turned dark brown when matured. Chasmothecia (diameter: 135.2 - 222.9 μm, n = 20) existed abundantly on the diseased leaves in the fields. Conidiophores were 89.0 - 129.9 μm in length (n = 20) and composed of one cylindrical, straight foot cell, followed by two cells and one to three conidia. Conidia were slim ellipsoid-shaped, occasionally ovoid-shaped, measuring 14.6 - 24.7 μm by 6.4 to10.4 μm, length/width ratio was 1.8 - 3.0 (n = 30). Hyphal appressoria were nipple-shaped and appeared in singular, occasionally in pairs. Unbranched germ tube emerged reaching out of the germinating conidia while forming an acute angle with the long axis. Comprehensively, the pathogen exhibited micro-morphology of the genus Erysiphe. For molecular identification, pathogen was carefully scraped off diseased leaves for DNA extraction. We used the DNA samples of three biological replicates for the sequencing of the ITS rDNA fragment (primers by (White et al. 1990). All the samples resulted in an identical ITS sequence (deposited in GenBank as OQ390098.1). It displayed 99.83% identity with OP806835.1 of an E. astragali voucher collected in Iran (Fig. 1D-M, O). Hence, our pathogen was identified as an E. astragali stain. Additionally, we amplified the Mcm7 sequence (using primers by (Ellingham et al. 2019), deposited as OQ397582.1). We propagated 40-day-old A. mongholicus plants via germinating seeds in pot soil and performed pathogenicity tests. Firstly, we incubated detached healthy leaves of propagated plants with severely symptomatic leaves collected from the fields in petri dishes under saturated moisture content and room temperature. Powdery mildew symptoms emerged on each healthy leaf (n = 5) after two weeks. Further, we infected healthy plants (n = 5) by gently pressing and rubbing symptomatic leaves on each healthy leaf, and kept them in a greenhouse (24 ℃, 80% humidity, 16/8-hour light/dark cycle). After a month, symptoms emerged on a number of leaves of each infected plant. We performed micromorphology observation (Fig. 1N-P) and ITS sequencing to confirm that the results fulfilled Koch's postulates. Powdery mildew caused by E. astragali on A. strictus in Tibet (Wang and Jiang 2023) and on A. scaberrimus in Inner Mongolia (Sun et al. 2023) have been reported. Here we report powdery mildew caused by E. astragali on Astragalus mongholicus for the first time. These Astragalus spp. are all acknowledged to have medicinal values in China but their usages are quite different.

Metalloporphyrin compounds have excellent electron transfer and visible light absorption ability, demonstrating broad application prospects in the field of photocatalysis. In this work, the nitrogen vacancies (NVs) were successfully introduced into zinc porphyrin (ZnTCPP) ultrathin nanosheets through surface N 2 plasma treatment, which is environmentally friendly and can react in low temperatures. Furthermore, the prepared nitrogen vacancies-zinc porphyrin (NVs-ZnTCPP) materials exhibited excellent photocatalytic CO 2 reduction activity and selectivity, specifically, the CO production rate of ZnTCPP-1 (N 2 plasma treatment, 1 min) achieved as high as 12.5 µmol g -1 h -1 , which is about 2.7 times greater than that of untreated ZnTCPP. Based on the experimental and density functional theory calculation (DFT) results, it is found that the promoted photocatalytic performance of NVs-ZnTCPP could be mainly attributed to nitrogen vacancy-induced spin polarization by reducing the reaction barriers and inhibiting the recombination of photoexcited carriers. This work provides a new perspective for the construction of vacancy-based metalloporphyrin, and further explores the intrinsic mechanism between the electron spin property and the performance of the photocatalyst., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Janus membranes with asymmetric wettability have been considered cutting-edge for energy/environmental-sustainable applications like water/fog harvester, breathable skin, and smart sensor; however, technical challenges in fabrication and accurate regulation of asymmetric wettability limit their development. Herein, by using water-assisted hydrogen-bonded (H-bonded) assembly of small molecules at water/oil interface, a facile strategy is proposed for one-step fabrication of membranes with well-regulable asymmetric wettability. Asymmetric orderly patterns, beneficial for mass transport based on abundant high-permeability sites and large surface area, are constructed on opposite membrane surfaces. Upon tuning water-assisted H-bonding via H-sites/configuration design and temperature/pH modulation, double-hydrophobic, double-hydrophilic, and hydrophobic-hydrophilic membranes are facilely fabricated. The Janus membranes show smart vapor-responsive curling and unidirectional water transport with promising flux of 1158±25 L m -2  h -1 under natural gravity and 31500±670 L·(m -2  h -1  bar -1 ) at negative pressure. This bottom-up approach offers a feasible-to-scalable avenue to precise-manipulation of Janus membranes for advanced applications, providing an effective pathway for developing tailor-made self-assembled nanomaterials., (© 2023 The Authors. Advanced Science published by Wiley-VCH GmbH.)

Panax notoginseng (Burk.) F. H. Chen, a species of the genus Panax, radix has been traditionally used to deal with various hematological diseases and cardiovascular diseases since ancient times in East Asia. P. notoginseng produces recalcitrant seeds which are sensitive to desiccation and difficult to store for a long time. However, few data are available on the mechanism of the desiccation sensitivity of P. notoginseng seeds. To gain a comprehensive perspective of the genes associated with desiccation sensitivity, cDNA libraries from seeds under control and desiccation processes were prepared independently for Illumina sequencing. The data generated a total of 70,189,896 reads that were integrated and assembled into 55,097 unigenes with a mean length of 783 bp. In total, 12,025 differentially expressed genes (DEGs) were identified during the desiccation process. Among these DEGs, a number of central metabolism, hormonal network-, fatty acid-, and ascorbate-glutathione-related genes were included. Our data provide a comprehensive resource for identifying the genes associated with the desiccation sensitivity of P. notoginseng seeds.

Pinelliae rhizoma is the dried tuber of Pinellia ternata (Thunb.) Breit., and has been used for thousand of years in traditional Chinese medicine as an antivomit, anticough, and analgesic (Ying et al. 2007). In September 2022, P. ternata planted in Bijie, Guizhou Province, showed severe soft rot symptoms with incidence of about 50%. The diseased plants showed water-soaked symptoms and produced a foul soft rot smell, and finally the whole plant collapsed. Lesions were first observed at the tip of a leaf or wound, and symptoms of the disease spread rapidly, with the entire plant collapsing and dying within a week. The tissue sections of six plants with typical symptoms from the diseased field were disinfected with 75% ethanol for 30 seconds and 0.3% NaClO for 3 minutes. The tissue sections were then washed with sterile water for three times. A small piece of tissue (5x5mm) was removed from the edge of the lesion and mashed in a 1.5 ml centrifuge tube containing 20 μl of sterile water. The tissue liquid was then diluted 100 times with prepared sterile water. The bacteria were streaked on LB (tryptone/yeast extract/NaCl) AGAR medium and cultured at 37°C for 48 h (Kravitz, 1962). Isolated colonies were streaked on Luria-Bertani (LB) AGAR medium to obtain single colonies for further identification. A total of 13 representative isolates were selected for PCR amplification using primers targeting the conserved region of the 16S rDNA gene, which were in turn analyzed via the BLASTn search engine on the NCBI website. The results of the analysis revealed that seven of the isolates were similar to P. aroidearum strain SCRI 109 (GenBank accession no. NR&#95;159926), with strain BX13 exhibiting the highest similarity to P. aroidearum (99.93% similarity), and therefore, this strain was selected for further investigation. The strain BX13 was incubated on LB solid medium for 24 h at 37 °C, and the single colonies were creamy white, translucent and round, slightly elevated in the center, with smooth surfaces and neat edges (Figure S1 B1). Then,the Scanning Electron Microscope revealed that the thalli of strain BX13 were short rod-shaped and somewhat blunt round at both ends (Figure S1 B2). The steward genes (icdA, gapA, proA) of BX13 were amplified and sequenced for further identification. The sequences of the amplified fragments were all deposited in GenBank 16S rDNA (OQ874505,) icdA (OQ954122)，gapA (OQ954123), proA (OQ954124). Sequence analysis using the BLASTn program at the NCBI revealed gene icdA, gapA, and proA had 100% identity to P. aroidearum strain QJ002 (GenBank accession no. CP090597).. Meanwhile, a maximum likelihood phylogenetic tree was constructed based on multigene sequence analysis of BX13 16S rDNA and steward genes (gapA, icdA, proA) by MEGA X (Liang et al. 2022). Phylogenetic results also showed that BX13 and P. aroidearum strain QJ002 gathered in the same clade(Figure S2). Accordingly, the morphological and molecular characteristics of strain BX13 indicate that it is P. aroidearum. (Nabhan S., et al.2013,Xu et al. 2020). In order to confirm the pathogenicity of strain BX13, a bacterial suspension containing 107 CFU/ml (10 ml/ inoculation point) was injected into the base of a one-week-old P. ternata stems, control seedlings were inoculated with sterile water, inoculated and control seedlings (each of six plants) were kept in a growth chamber maintained at 26°C with a relative humidity range of 70% to 80%. Plants were watered as needed. After 3 days, the stem base of the plants inoculated with bacteria solution showed water-soaked necrosis and stems began to rot, while the plants inoculated with water did not show this symptom. The strains were then successfully re-isolated from the symptomatic P. ternata. Then the strain re-isolated was identified using the BLASTn program at the NCBI and found that it has the same 16S rDNA, icdA, gapA, and proA sequences as strain BX13, thus completing the Koch's postulates. To our knowledge, this is the first report of P. aroidearum causing P. ternata soft rot in China, which expands its known host range. Accordingly, this study provides essential information for the breeding of P. ternata resistant to bacterial soft rot and the development of control measures in China.

An integrated purification procedure through the LC-MS/MS-based molecular networking strategy combined with bioactive evaluation was first ushered for discovering bioactive ophiobolins from Bipolaris eleusines . Ophiobolins were mainly dispersed in five clusters, which were classified based on different ring systems and functional groups. Nine undescribed ophiobolins ( 1 - 6 and 9 - 11 ) and an undescribed natural product ( 8 ) along with two known analogs ( 7 and 12 ) were isolated in target. The undescribed structures were characterized by HR-ESI-MS, NMR spectra, and X-ray diffraction experiments. Compounds 3 - 12 exhibited strong phytotoxic effects on green foxtails by producing visible lesions, and compounds 1 - 10 and 12 displayed different levels of cytotoxic activities against cancer cell lines B16, Hep G2, and MCF-7, from which the possible structure-activity relationships were then suggested. The results have supported that bioactivity-guided molecular networking is an efficient strategy to expedite the discovery of undescribed bioactive natural products.

The Chinese yam, an important orphan crop with both high nutrient and health promoting value, is mainly produced in the Yellow-Huai-Hai plain near the river basins in China. The protected designation of origin (PDO)-labeled Chinese yam differs greatly from others in market acceptance and price, which has led to fakes and the need for reliable authentication methods. Hence, stable isotope ratios of δ 13 C, δ 15 N, δ 2 D, and δ 18 O and 44 multielemental contents were used to explore the authentication of geographical origins and the effect of environmental factors. Twenty-two elements and δ 15 N were selected as the key variables to authenticate Chinese yams from three river basins as well as to authenticate them among traditional PDOs and others in the Yellow River basin. Moreover, six environmental factors, including the moisture index, maximum temperature, photosynthetically active radiation, soil organic carbon, total nitrogen and pH, were found to be highly related to these variances., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2023 The Author(s).)

Alpinia oxyphylla Miq. is mainly distributed in Hainan, Guangdong and Guangxi provinces of China. Between July and August 2021, a leaf spot disease was observed in Ledong, Hainan Province, China (18°70'20.50″ N, 109°25'25.47″E) on A.oxyphylla . The incidence of infected leaves ranged from 8% to 10%, and the incidence rate of infected plants was about 50%. Symptoms appeared as primary yellow-brown withered spots on the diseased leaves, which further developed into irregular red-brown spots. The center of the lesions was gray-black, and the tissue was irregularly necrotic, ruptured or perforated, and there were yellow chlorotic halos around the edges of the lesions (Figure 1A). Tissues 5 mm in diameter were taken from the junction of diseased and healthy tissue for pathogen isolation, Successively, a total of 8 isolates were obtained from the affected leaves. Three single spore isolates (YZ-HN-001, YZ-HN-043 and YZ-HN-051) were obtained and confirmed to be identical based on morphological characteristics. Therefore, the representative isolate YZ-HN-001 was selected for morphological and molecular identification. On Potato Dextrose Agar(PDA), the colony was gray-white at first and gradually turned dark green to dark brown with lead gray on the back, growth was slow, and mycelium was short and dense (Figure 1B and Figure 1C). Pycnidia were epiphyllous, globose, brown (about 120-140 µm in diameter), and conidia were elliptical, colorless, single celled and smooth (8-12×4-7 µm) (Figure 1D). Molecular identification was performed by partially sequencing the internal transcribed spacer gene (ITS), 18S rRNA gene and the actin gene (ACT) by using the primers ITS1/ITS4 (White et al. 1990), EF4/Fungi5 (Khodaparase et al. 2005) and ACT-512F/ACT-783R (Carbone and Kohn. 1999). The sequences of the amplified fragments were deposited in GenBank, the ITS sequence (ON005130, 616 bp) showed 100% identity with Phyllosticta capitalensis strain CGMCC3.14345 (JN791605.1), the 18S rRNA sequence (ON005129, 541 bp) showed 99% identity with P. capitalensis isolate MUCC0029 (AB454185.1) and the ACT sequence (ON049348, 251 bp) showed 100% identity with P. capitalensis strain DZSN202005-2 (MW533248.1). A phylogenetic analysis was conducted in MEGA X using the neighbor-joining method and showed that isolate YZ-HN-001 clustered together with P. capitalensis (Figure 2). Based on the above morphological and molecular characteristics, the isolate was determined to be P. capitalensis . Pathogenicity tests were conducted in three replicates by inoculating surface-sterilized leaves of A. oxyphylla . The leaves were wounded and inoculated with colonized PDA plugs (5×5 mm) from 15-day-old cultures. Control leaves wounded in the same way and were inoculated with sterile PDA plugs (5×5 mm). Leaves were moisturized by spraying with sterile water every three days. After 20 days at room temperature (23 to 28℃), similar symptoms were observed in the inoculated leaves as in the field (Figure 1E), but no symptoms were observed on the control leaves (Figure 1F). The same P. capitalensis was reisolated in the inoculated leaves, confirming Koch's postulates. Phyllosticta capitalensis has been reported to cause leaf spots or black spots on various host plants around the world (Wikee et al. 2013), including on oil palm (Nasehi et al. 2020), tea plant (Cheng et al. 2019 ), and castor (Tang et al. 2020). Nevertheless, to our knowledge, this is the first report of leaf spot caused by P. capitalensis on A. oxyphylla worldwide.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±  62.5 μm (492.4 to 716.4 μm); maximum body width (W) = 377.0  ±  28.6 μm (329.7 to 436.1 μm); stylet length  =  17.0  ±  1.8 μm (14.2 to 20.5 μm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±  0.3 μm (2.8 to 3.9 μm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±  29.3 μm (358.2 to 456.1 μm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±  1.0 (26.7 to 30.4); stylet length =  10.3  ±  0.6 μm (9.1 to 11.2 μm); DGO  =  2.4  ±  0.1 μm (2.1 to 2.6 μm); and tail length  =  49.3  ± 2.8 μm (45.2 to 54.7 μm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

Photocatalytic nitrogen fixation is a promising approach owing to its environmental friendliness and cost-effectiveness. The 2D/2D BiVO 4 /rGO hybrid developed in this study exhibits a high nitrate-production rate of 1.45 mg h -1 g -1 and an apparent quantum efficiency (QE) of 0.64% at 420 nm, which represents one of the most highly active photocatalysts reported thus far.

In this study, stable isotopes and multi-element signatures combined with chemometrics were used to distinguish conventional and organic Chinese yams based on field trials. Four light stable isotopes δD, δ 13 C, δ 15 N, δ 18 O, and 20 elements (e.g. Li, Na, Mn) were determined, then evaluated using significance analysis and correlation analysis, and modeling of various chemometrics methods. Consequently, the RandomForest model showed the best performance with AUC value of 0.972 and predictive accuracy of 97.3%, and Mn, Cr, Se, Na, δD, As, and δ 15 N were screened as significant variables. Moreover, many chemical components and antioxidant activity of yam samples were determined spectrophotometrically. The results indicated that organic yams had advantages in secondary metabolites such as polyphenol, flavonoid and saponin; conversely, conventional samples had more primary metabolites like protein and amino acids. Above all, this work provides a beneficial case in the authentication and quality evaluation of conventional and organic yams., (Copyright © 2020 Elsevier Ltd. All rights reserved.)

Porous liquids, a new porous material with fluidity, can be applied in numerous fields, such as gas storage and/or separation. In this work, the separation of binary gas mixtures CO 2 /N 2 and CO 2 /CH 4 with porous liquids was examined by molecular dynamics (MD) simulations. The pure gas adsorption capacity was analyzed with different concentrations of porous liquids. The dependence of the separation effect of a gas mixture on the total pressure and temperature was investigated. Meanwhile, for both CO 2 /N 2 and CO 2 /CH 4 systems, the adsorption and separation effects of porous liquids with a cage:solvent ratio of 1:12 are better than those of 1:91 and 1:170. The results of the spatial distribution function and/or trajectories indicated that porous liquids prefer CO 2 , leading to the location of CO 2 in the channels formed in porous liquids. However, N 2 and CH 4 are hardly adsorbed into the bulk. The diffusion of gas molecules follows the order of CO 2 > N 2 (for CO 2 /N 2 ) and CH 4 > CO 2 (for CO 2 /CH 4 ) in the bulk and N 2 > CO 2 (for CO 2 /N 2 ) and CH 4 > CO 2 (for CO 2 /CH 4 ) at the interface of porous liquids. Upon increasing the concentrations of porous liquids, the working capacities of CO 2 show small decreases in CO 2 /N 2 and CO 2 /CH 4 systems, but the sorbent selection parameters are higher in pressure- and temperature-swing adsorption processes. The porous liquid with a cage:solvent ratio of 1:12 is more suitable for the separation of CO 2 /N 2 and CO 2 /CH 4 systems than ratios of 1:91 and 1:170.

Background: Cervical lymph node metastasis is a prognostic factor of papillary thyroid carcinoma (PTC). Skip metastasis (central lymph node negative and lateral lymph node positive) of PTC is not uncommon. This study aimed to retrospectively investigate the risk factors for skip metastasis in PTC and develop a prediction model for skip metastasis., Methods: A total of 745 PTC patients underwent total thyroidectomy and central plus lateral lymph node dissection at the First Affiliated Hospital of Chongqing Medical University from January 2012 to December 2017. Clinicopathological characteristics were collected and analyzed. Univariate and multivariate analyses were performed to detect the risk factors for skip metastasis. A prediction model was established based on the results of multivariate analyses., Results: The skip metastasis rate was 9.7% (72/745). Age > 55 years (OR 2.63, 95% CI 1.34-5.04, p = 0.004), tumor located in the upper portion (OR 4.15, 95% CI 2.30-7.63, p = 0.001), and unilaterality (OR 2.76, 95% CI 1.14-8.23, p = 0.040) were independent risk factors for skip metastasis. Clinically lymph node-negative (cN0) patients with tumor in the upper portion (24.6%, 43/175) had higher possibility of skip metastasis than those of clinically lateral lymph node-positive (cN1b) patients (5.9%, 10/169) (p = 0.001). The area under the receiver operating characteristic curve of prediction model was 0.734 and 0.740 in derivation group and validation group, respectively. However, skip metastasis was not associated with tumor-free survival rate of PTC patients (p = 0.274)., Conclusion: Age > 55 years, tumor located in the upper portion, and unilaterality may increase the risk of skip metastasis. We developed the first prediction model for skip metastasis based on clinicopathological parameters in PTC patients.

The leaching kinetics of K-feldspar in H 2 SO 4 -CaF 2 system with the assistant of ultrasound was investigated. The effects of various factors, such as sulfuric acid concentration, liquid-to-solid ratio, CaF 2 dosage and leaching temperature were comprehensively studied. The dissolution fraction of potassium can reach more than 83% under the optimum operation conditions with ultrasound. Because of the cavitation effect, the intensified effect with ultrasound has more obvious at lower temperature than higher temperature. The leaching kinetics of K-feldspar with and without ultrasound was successfully modeled by a classic shrinking core model with the product layer diffusion as the rate-controlling step. The activation energies over the temperature range from 60 to 90°C with and without ultrasound were found to be 55.67kJmol -1 and 72.33kJmol -1 , respectively. It was found that the rate constant increases greatly in the presence of ultrasound due to the decreased apparent activation energy, resulting in the improved dissolution fraction of potassium., (Copyright © 2016 Elsevier B.V. All rights reserved.)