Search

The Snail superfamily of transcription factors plays a crucial role in metazoan development; one of the most important vertebrate members of this family is Snai1 which is orthologous to the Drosophila melanogaster esg gene. This review offers a comprehensive examination of the roles of the esg gene in Drosophila development, covering its expression pattern and downstream targets, and draws parallels between the vertebrate Snai1 family proteins on controlling the epithelial‐to‐mesenchymal transition and esg. This gene regulates stemness, ploidy, and pluripontency. esg is expressed in various tissues during development, including the gut, imaginal discs, and neuroblasts. The functions of the esg include the suppression of differentiation in intestinal stem cells and the preservation of diploidy in imaginal cells. In the nervous system development, esg expression also inhibits neuroblast differentiation, thus regulating the number of neurons and the moment in development of neuronal differentiation. Loss of esg function results in diverse developmental defects, including defects in intestinal stem cell maintenance and differentiation, and alters imaginal disc and nervous system development. Expression levels of esg also play a role in regulating longevity and metabolism in adult stages. This review provides an overview of the current understanding of esg's developmental role, emphasizing cellular and tissue effects that arise from its loss of function. The insights gained may contribute to a better understanding of evolutionary conserved developmental mechanisms and certain metabolic diseases. [ABSTRACT FROM AUTHOR]

Objectives The incidence of pituitary neuroendocrine tumors has been reported high at autopsy. This study aimed to detect many tumors in both anterior and posterior lobes to prove tumor histogenesis. Methods In total, 150 pituitary glands were studied from the University of Kansas Medical Center from 1995 to 2000. The pituitary gland was sagittally sliced from anterior to posterior into 6 to 8 sections. When H&E-stained sections revealed tumors, the tumors were immunohistochemically stained for 6 pituitary hormones. Results Among 150 autopsy cases, 38 (25.3%) harbored microadenomas, including 4 cases with double tumors. Twenty-three (54.7%) cases were negative to all pituitary hormones. Of the remaining 19 tumors, 13 (30.9%) were lactotrophs, with 4 cases being concomitantly somatotrophs and gonadotrophs, and 2 cases were corticotropes. More than 85% of pituitary neuroendocrine tumors were adjacent to the capsule. Thirteen (8.7%) granular cell pituicytomas were found in the posterior lobe. There were pituicytes transforming into granular cell tumors. Conclusions The incidence was 25.3% for pituitary neuroendocrine tumors and 8.7% for granular cell pituicytomas. Since most pituitary neuroendocrine tumors were adjacent to the pituitary capsule, the capsule appeared to be the germinal center. Both pituitary tumors belonged to the 2 different transcription factor lineages. [ABSTRACT FROM AUTHOR]

In yeast, control of sulfur amino acid metabolism relies upon Met4 , a transcription factor that activates the expression of a network of enzymes responsible for the biosynthesis of cysteine and methionine. In times of sulfur abundance, the activity of Met4 is repressed via ubiquitination by the SCF Met30 E3 ubiquitin ligase, but the mechanism by which the F-box protein Met30 senses sulfur status to tune its E3 ligase activity remains unresolved. Herein, we show that Met30 responds to flux through the trans-sulfuration pathway to regulate the MET gene transcriptional program. In particular, Met30 is responsive to the biological gas hydrogen sulfide, which is sufficient to induce ubiquitination of Met4 in vivo. Additionally, we identify important cysteine residues in Met30 's WD-40 repeat region that sense the availability of sulfur in the cell. Our findings reveal how SCF Met30 dynamically senses the flow of sulfur metabolites through the trans-sulfuration pathway to regulate the synthesis of these special amino acids. [ABSTRACT FROM AUTHOR]

The synaptonemal complex (SC) is a meiotic interface that assembles between parental chromosomes and is essential for gamete formation. While the dimensions and ultrastructure of the SC are conserved across eukaryotes, its protein components are highly divergent. Recently, an unexpected component of the SC has been described in the nematode Caenorhabditis elegans : the Skp1-related proteins SKR-1/2, which are components of the Skp1, Cullin, F-box (SCF) ubiquitin ligase. Here, we find that the role of SKR-1 in the SC is conserved in Pristionchus pacificus. The P. pacificus Skp1 ortholog, Ppa-SKR-1 , colocalizes with other SC proteins throughout meiotic prophase, where it occupies the middle of the SC. Like in C. elegans , the dimerization interface of Ppa-SKR-1 is required for its SC function. A dimerization mutant, ppa-skr-1F105E , fails to assemble SC and produces almost no progeny. Interestingly, the evolutionary trajectory of SKR-1 contrasts with other SC proteins. Unlike most SC proteins, SKR-1 is highly conserved in nematodes. Our results suggest that the structural role of SKR-1 in the SC has been conserved since the common ancestor of C. elegans and P. pacificus , and that rapidly evolving SC proteins have maintained the ability to interact with SKR-1 for at least 100 million years. [ABSTRACT FROM AUTHOR]

During challenge of Caenorhabditis elegans with human bacterial pathogens such as Pseudomonas aeruginosa and Enterococcus faecalis , the elicited host response can be damaging if not properly controlled. The activation of Nrf (nuclear factor erythroid-related factor)/CNC (Cap-n-collar) transcriptional regulators modulates the response by upregulating genes that neutralize damaging molecules and promote repair processes. Activation of the C. elegans Nrf ortholog, SKN-1 , is tightly controlled by a myriad of regulatory mechanisms, but a central feature is an activating phosphorylation accomplished by the p38 mitogen-activated kinase (MAPK) cascade. In this work, loss of CDC-48, an AAA+ ATPase, was observed to severely compromise SKN-1 activation on pathogen and we sought to understand the mechanism. CDC-48 is part of the endoplasmic reticulum (ER)-associated degradation (ERAD) complex where it functions as a remodeling chaperone enabling the translocation of proteins from the ER to the cytoplasm for degradation by the proteosome. Interestingly, one of the proteins retrotranslocated by ERAD, a process necessary for its activation, is SKN-1A, the ER isoform of SKN-1. However, we discovered that SKN-1A is not activated by pathogen exposure in marked contrast to the cytoplasmic-associated isoform SKN-1C. Rather, loss of CDC-48 blocks the antioxidant response normally orchestrated by SKN-1C by strongly inducing the unfolded protein response (UPRER). The data are consistent with the model of these 2 pathways being mutually inhibitory and support the emerging paradigm in the field of coordinated cooperation between different stress responses. [ABSTRACT FROM AUTHOR]

Double B-box (DBB) proteins are plant-specific transcription factors (TFs) that play crucial roles in plant growth and stress responses. This study investigated the classification, structure, conserved motifs, chromosomal locations, cis-elements, duplication events, expression levels, and protein interaction network of the DBB TF family genes in common wheat (Triticum aestivum L.). In all, twenty-seven wheat DBB genes (TaDBBs) with two conserved B-box domains were identified and classified into six subgroups based on sequence features. A collinearity analysis of the DBB family genes among wheat, Arabidopsis, and rice revealed some duplicated gene pairs and highly conserved genes in wheat. An expression pattern analysis indicated that wheat TaDBBs were involved in plant growth, responses to drought stress, light/dark, and abscisic acid treatment. A large number of cis-acting regulatory elements related to light response are enriched in the predicted promoter regions of 27 TaDBBs. Furthermore, some of TaDBBs can interact with COP1 or HY5 based on the STRING database prediction and yeast two-hybrid (Y2H) assay, indicating the potential key roles of TaDBBs in the light signaling pathway. Conclusively, our study revealed the potential functions and regulatory mechanisms of TaDBBs in plant growth and development under drought stress, light, and abscisic acid. [ABSTRACT FROM AUTHOR]

Transcriptional regulation, orchestrated by the interplay between transcription factors (TFs) and enhancers, governs gene expression dynamics crucial for cellular processes. While gross qualitative fluctuations in transcription factor-dependent gene expression patterning have a long history of characterization, the roles of these factors in the nuclei retaining expression in the presence or absence of these factors are now observable using modern techniques. Our study investigates the impact of Suppressor of Hairless (Su(H)), a broadly expressed transcription factor, on enhancer-driven transcriptional modulation using Drosophila early embryos as a model system. Building upon previous findings, we employ super-resolution microscopy to dissect Su(H)'s influence on sog-Distal (sogD) enhancer activity specifically in nuclei with preserved sogD-driven expression in the absence of Su(H) binding. We demonstrate that Su(H) occupancy perturbations alter expression levels and bursting dynamics. Notably, Su(H) absence during embryonic development exhibits region-specific effects, inhibiting expression dorsally and stabilizing expression ventrally, implying a nuanced role in enhancer regulation. Our findings shed light on the intricate mechanisms that govern transcriptional dynamics and suggest a critical patterning role for Notch/Hairless signaling in sog expression as embryos transition to gastrulation. [ABSTRACT FROM AUTHOR]

Simple Summary: Although the zinc finger transcription factor 281 (ZNF281)/ZBP-99 protein has been shown to promote tumor progression, its role in the development of cervical cancer remains unclear. We find that its level is higher in cervical cancer tissues than in normal cervical tissues. And it promotes metastasis in HeLa cell lines by facilitating the epithelial-mesenchymal transition process, thereby enhancing the migration of HeLa cells in vivo. Our research might provide a new marker for predicting the development of cervical cancer. Background: Cervical cancer is the fourth most common cancer among women worldwide. The zinc finger transcription factor 281 (ZNF281)/ZBP-99 protein specifically binds to GC-rich DNA sequences and regulates gene expression, and it has been shown to promote tumor progression. In this study, we aim to investigate the function and molecular mechanism of ZNF281 in uterine cervical carcinoma. Methods: We conducted immunohistochemistry and Western blot assays to determine the expression of ZNF281 in eight human cervical cancer tissues. And, xenograft experiments involving the injection of HeLa cells into nude mice was used to determine the function of ZNF281 on proliferation. Transwell assays were used to detect the migration and invasion of HeLa cells after indicated that ZNF281 overexpression. Results: Our results indicated that ZNF281 protein levels were higher in cervical cancer tissues compared to normal cervical tissues. Additionally, ZNF281 was expressed in human cervical carcinoma cell lines, including HeLa, SiHa, C-33 A, CaSki, and HT-3, and is localized in both the cell nucleus and cytoplasm. ZNF281 overexpression did not influence HeLa cell proliferation or tumor size in situ. Moreover, nude mice injected with ZNF281-overexpressing cell lines developed more tumor lesions in the lungs compared to those injected with control cell lines. Conclusions: These findings suggest that ZNF281 is associated with tumor metastasis without affecting cell proliferation, both in vivo and in vitro. [ABSTRACT FROM AUTHOR]

Simple Summary: A CRISPR knockout screen was performed targeting all genes of the human genome with about 12 knockout sgRNAs each. By comparing pancreatic cancer cells with high or low metastatic capacity, genes were identified that affect the viability of metastatic cells while not affecting cell viability of non-metastatic cells. Further functional studies looked at some of the identified candidate genes. For one of the metastasis-related genes—MYBL2—a change in its interaction with another regulator gene was found to be implicated in metastasis. Background/Objectives: Early and aggressive metastasis is a major feature of pancreatic ductal adenocarcinoma. Understanding the processes underlying metastasis is crucial for making a difference to disease outcome. Towards these ends, we looked in a comprehensive manner for genes that are metastasis-specific. Methods: A genome-wide CRISPR-Cas9 gene knockout screen with 259,900 single guide RNA constructs was performed on pancreatic cancer cell lines with very high or very low metastatic capacity, respectively. Functional aspects of some of the identified genes were analysed in vitro. The injection of tumour cells with or without a gene knockout into mice was used to confirm the effect on metastasis. Results: The knockout of 590 genes—and, with higher analysis stringency, 67 genes—affected the viability of metastatic cells substantially, while these genes were not vital to non-metastasizing cells. Further evaluations identified different molecular processes related to this observation. One of the genes was MYBL2, encoding for a well-known transcription factor involved in the regulation of cell survival, proliferation, and differentiation in cancer tissues. In our metastasis-focussed study, no novel functional activity was detected for MYBL2, however. Instead, a metastasis-specific transformation of its genetic interaction with FOXM1 was observed. The interaction was synergistic in cells of low metastatic capacity, while there was a strong switch to a buffering mode in metastatic cells. In vivo analyses confirmed the strong effect of MYBL2 on metastasis. Conclusions: The genes found to be critical for the viability of metastatic cells form a basis for further investigations of the processes responsible for triggering and driving metastasis. As shown for MYBL2, unexpected processes of regulating metastasis might also be involved. [ABSTRACT FROM AUTHOR]

Simple Summary: Uveal melanoma (UM) is an aggressive cancer emerging from mutations in the GNAQ and GNA11 genes. These mutations are also linked to other conditions with distinct morphological features (skin capillary malformations, hemangiomas, Sturge–Weber syndrome, choroidal nevi, blue nevi, hepatic small vessel neoplasm, Blitz nevi, iris and ciliary body melanocytoma, primary central nervous system melanocytic neoplasms, and aldosterone-producing adenomas). By examining the molecular pathways influenced by these mutations, we provide insights into potential targeted therapies for UM and related disorders. Additionally, we address the involvement of SOX10-positive perivascular cells in the complex pathophysiology of GNAQ/GNA11-related conditions. Uveal melanoma (UM), recognized as the most prevalent primary intraocular malignancy in adults, is primarily driven by mutations in the GNAQ and GNA11 genes. These genetic alterations are also implicated in other conditions, which exhibit distinct morphological characteristics. In this article, we investigate the role of GNAQ and GNA11 mutations across varied disorders (e.g., UM, skin blue nevi, and hemangiomas), emphasizing the shared pathogenic mechanisms that connect them despite their differing clinical manifestations. By investigating the molecular pathways affected by these mutations, we provide insights into the potential for targeted therapies that could address not only UM but also other disorders associated with GNAQ/GNA11 mutations. Moreover, we discuss the role of SOX10-positive perivascular cells that may be implicated in the complex pathophysiology of GNAQ/GNA11-related entities. Understanding the common molecular foundation of these conditions opens new ways for research and treatment opportunities, potentially leading to more effective, personalized therapeutic strategies. [ABSTRACT FROM AUTHOR]

Simple Summary: TRPS1 (trichorhinophalangeal syndrome type 1) is a protein that has become an important marker for diagnosing breast cancer, especially in difficult-to-diagnose cases like triple-negative breast cancer. This review explores the expression of TRPS1 in various cancers beyond breast tissue, such as prostate, lung, and ovarian cancers, and discusses its role as a diagnostic tool. While TRPS1 is a highly sensitive marker for breast cancer, its presence in other tumor types poses challenges for pathologists. Our review aims to raise awareness of these diagnostic pitfalls and emphasizes the importance of using multiple markers to improve accuracy. Understanding the broader expression of TRPS1 can help to improve cancer diagnosis and treatment strategies. Background/Objectives: Immunohistochemical expression of TRPS1 (trichorhinophalangeal syndrome type 1) protein is usually used by pathologists to confirm breast origin for triple-negative breast cancers (TNBC) or metastatic carcinomas of unknown primary. However, recent studies have reported TRPS1 expression in a variety of non-breast lesions. This review aims to provide a comprehensive evaluation of TRPS1 expression across various tumor types, highlighting both its diagnostic utility and potential pitfalls that may arise in clinical practice. Methods: A thorough search of the PubMed database on TRPS1 immunoexpression in tumor pathology was conducted. While the gene itself has been known for several decades, most studies regarding its use in immunohistochemistry emerged in the late 2010s. Particular emphasis was placed on case reports and cohort studies that examined the implications of TRPS1 expression in non-breast tissues, as well as variations in the results between commercially available TRPS1 clones, which may influence the staining intensity and specificity. Results: TRPS1 demonstrated a strong diagnostic utility in identifying primary breast lesions, particularly in TNBC cases. However, its expression in a growing number of non-breast cancers, such as lung adenocarcinoma, prostate adenocarcinoma, urothelial carcinoma, ovarian high-grade serous carcinoma, and endometrial adenocarcinoma, as well as up to 96% of synovial sarcomas with SS18-SSX fusion, emphasizes the need for caution when interpreting TRPS1 positivity and suggests a multi-marker approach in order to increase the diagnostic accuracy. Conclusions: While TRPS1 remains a highly sensible immunohistochemical marker for confirming breast primary lesions, pathologists should be aware of its low specificity and incorporate complementary diagnostic methods in order to ensure accurate clinical management. Further research should focus on elucidating the molecular pathways regulating TRPS1 expression in various tumor types, which may better define its clinical utility. [ABSTRACT FROM AUTHOR]

Transforming growth factor (TGF-β1) is a critical profibrotic mediator in chronic lung disease, and there are no specific strategies to mitigate its adverse effects. Activation of TGF-β1 signaling is a multipart process involving ligands, transmembrane receptors, and transcription factors. In addition, an intricate network of adaptor proteins fine-tunes the signaling strength, duration, and activity. Namely, Smad7 recruits growth arrest and DNA damage (GADD34) protein that then interacts with the catalytic subunit of phosphoprotein phosphatase 1 (PP1c) to inactivate TGF-β receptor (TβR)-I and downregulate TGF-β1 signaling. Little is known about how TGF-β1 releases TβR-I from the GADD34-PP1c inhibition to activate its signaling. Transmembrane lemur tyrosine kinase 2 (LMTK2) is a PP1c inhibitor, and our published data showed that TGF-β1 recruits LMTK2 to the cell surface. Here, we tested the hypothesis that TGF-β1 recruits LMTK2 to inhibit PP1c, allowing activation of TβR-I. First, LMTK2 interacted with the TGF-β1 pathway in the human bronchial epithelium at multiple checkpoints. Second, TGF-β1 inhibited PP1c by an LMTK2-dependent mechanism. Third, TGF-β1 used LMTK2 to activate canonical Smad3-mediated signaling. We propose a model whereby the LMTK2-PP1c and Smad7-GADD34-PP1c complexes serve as on-and-off switches in the TGF-β1 signaling in human bronchial epithelium. NEW & NOTEWORTHY: Activation of the transforming growth factor (TGF)-β1 signaling pathway is complex, involving many ligands, transmembrane receptors, transcription factors, and modulating proteins. The mechanisms of TGF-β1 signaling activation/inactivation are not fully understood. We propose for the first time a model by which transmembrane lemur tyrosine kinase 2 (LMTK2) forms a complex with phosphoprotein phosphatase 1 (PP1c) to activate TGF-β1 signaling and Smad7, growth arrest and DNA damage (GADD34), and PP1C form a complex to inactivate TGF-β1 signaling in human bronchial epithelium. [ABSTRACT FROM AUTHOR]

Growing evidence supports a role for versican as an important component of the inflammatory response, with both pro- and anti-inflammatory roles depending on the specific context of the system or disease under investigation. Our goal is to understand the regulation of macrophage-derived versican and the role it plays in innate immunity. In previous work, we showed that LPS triggers a signaling cascade involving Toll-like receptor (TLR)4, the Trif adaptor, type I interferons, and the type I interferon receptor, leading to increased versican expression by macrophages. In the present study, we used a combination of chromatin immunoprecipitation, siRNA, chemical inhibitors, and mouse model approaches to investigate the regulatory events downstream of the type I interferon receptor to better define the mechanism controlling versican expression. Results indicate that transcriptional regulation by canonical type I interferon signaling via interferon-stimulated gene factor 3 (ISGF3), the heterotrimeric transcription factor complex of Irf9, Stat1, and Stat2, controls versican expression in macrophages exposed to LPS. This pathway is not dependent on MAPK signaling, which has been shown to regulate versican expression in other cell types. The stability of versican mRNA may also contribute to prolonged versican expression in macrophages. These findings strongly support a role for macrophage-derived versican as a type I interferon-stimulated gene and further our understanding of versican's role in regulating inflammation. NEW & NOTEWORTHY: We report the novel finding that versican expression is regulated by the interferon-stimulated gene factor 3 (ISGF3) arm of canonical type I Ifn signaling in LPS-stimulated macrophages. This pathway is distinct from mechanisms that control versican expression in other cell types. This suggests that macrophage-derived versican may play a role in limiting a potentially excessive inflammatory response. The detailed understanding of how versican expression is regulated in different cells could lead to unique approaches for enhancing its anti-inflammatory properties. [ABSTRACT FROM AUTHOR]

Cellulases and xylanases are plant cell wall-degrading enzymes (CWDEs) that are critical to sustainable bioproduction based on renewable lignocellulosic biomass to reduce carbon dioxide emission. Currently, these enzymes are mainly produced from filamentous fungi, especially Trichoderma reesei and Penicillium oxalicum. However, an in-depth comparison of these two producers has not been performed. Although both P. oxalicum and T. reesei harbor CWDE systems, they exhibit distinct features regulating the production of these enzymes, mainly through different transcriptional regulatory networks. This review presents the strikingly different modes of genome-wide regulation of cellulase and xylanase biosynthesis in P. oxalicum and T. reesei, including sugar transporters, signal transduction cascades, transcription factors, chromatin remodeling, and three-dimensional organization of chromosomes. In addition, different molecular breeding approaches employed, based on the understanding of the regulatory networks, are summarized. This review highlights the existence of very different regulatory modes leading to the efficient regulation of CWDE production in filamentous fungi, akin to the adage that "every road leads to Rome." An understanding of this divergence may help further improvements in fungal enzyme production through the metabolic engineering and synthetic biology of certain fungal species. [ABSTRACT FROM AUTHOR]

Activation-induced cytidine deaminase (AID, encoded by Aicda) plays a key role in somatic hypermutation and class switch recombination in germinal center B cells. However, off-target effects of AID are implicated in human leukemia and lymphoma. A mouse model of precursor B cell acute lymphoblastic leukemia driven by deletion of the related transcription factors PU.1 and Spi-B revealed C->T transition mutations compatible with being induced by AID. Therefore, we hypothesized that PU.1 negatively regulates Aicda during B cell development. Aicda mRNA transcript levels were increased in leukemia cells and bone marrow pre-B cells lacking PU.1 and/or Spi-B, relative to wild type cells. Using chromatin immunoprecipitation, PU.1 was found to interact with a negative regulatory region (R2–1) within the first intron of Aicda. CRISPR-Cas9-induced mutagenesis of R2–1 in cultured pre-B cells resulted in upregulation of Aicda in response to lipopolysaccharide stimulation. Mutation of the PU.1 interaction site and neighboring sequences resulted in reduced repressive ability of R2–1 in transient transfection analysis followed by luciferase assays. These results show that a PU.1-interacting intronic region negatively regulates Aicda transcription in developing B cells. • Aicda transcription is dysregulated in the absence of PU.1. • The transcription factor PU.1 interacts with the first intron of Aicda. • CRISPR-Cas9 mutation of a PU.1 site in Aicda intron 1 dysregulates transcription. • A PU.1-interacting site in intron 1 is a negative regulator of Aicda transcription. [ABSTRACT FROM AUTHOR]

Saxidomus purpurata extract (SPE) is a highly consumable seafood worldwide with known health-related benefits. However, there are no reports of its' anti-obesity effect. This study explores the potential of SPE for anti-obesity effects by modulating adipogenesis and lipolysis. SPE reduced intracellular lipid and triglyceride accumulation while increasing free glycerol release in adipocytes. SPE inhibited lipogenesis protein expressions and increased the phosphorylation of hormone-sensitive lipase and Adenosine monophosphate-activated protein kinase (AMPK) to promote lipolysis. In addition, SPE suppressed adipogenesis by downregulating protein expression of key adipogenic markers, peroxisome proliferator-activated receptor gamma (PPARγ), CCAAT/enhancer-binding protein α (C/EBPα), and sterol regulatory element-binding protein 1 (SREBP1) via Wnt/β-catenin signaling. SPE augmented the heme oxygenase-1 (HO-1) expression. Thus, pharmacological intervention with Zinc protoporphyrin (ZnPP-HO-1 antagonist) was employed to validate the HO-1 role. The presence of ZnPP increased the lipid accumulation and reduced the free glycerol release. At the molecular level, adipogenic transcription factors (PPARγ, C/EBPα, and SREBP1) expressions were restored in the presence of ZnPP. GC-MS analysis revealed that SPE was comprised of several fatty acids, contributing to its anti-obesity activity. SPE is an effective nutraceutical that can be used to reduce the progression of obesity. HO-1 expression during adipogenesis might be the mechanism of action for the anti-obesity effect of SPE. [ABSTRACT FROM AUTHOR]

The steroidogenic acute regulatory (STAR) protein is an essential cholesterol transporter that shuttles cholesterol from the outer to the inner mitochondrial membrane in the major steroidogenic endocrine organs. It is a key player in the acute regulation of steroid hormone biosynthesis in response to tropic hormone stimulation. Its discovery 30 years ago sparked immediate interest in understanding how STAR action is controlled. Since increased STAR gene expression is a classic feature of the acute regulation of steroidogenesis, a special emphasis was placed on defining the transcriptional regulatory mechanisms that underlie its rapid induction in response to tropic hormone stimulation. These mechanisms include the effects of enhancers, the regulation of chromatin accessibility, the impact of epigenetic factors, and the role of transcription factors. Over the past three decades, understanding the transcription factors that regulate STAR gene expression has been the subject of more than 170 independent scientific publications, making it one of, and if not the best, studied genes in the steroidogenic pathway. This intense research effort has led to the identification of dozens of transcription factors and their related binding sites in STAR 5' flanking (promoter) sequences across multiple species. STAR gene transcription appears to be complex in that a large number of transcription factors have been proposed to interact with either isolated or overlapping regulatory sequences that are tightly clustered over a relatively short promoter region upstream of the STAR transcription start site. Many of these transcription factors appear to work in unique combinatorial codes and are impacted by diverse hormonal and intracellular signaling pathways. This review provides a retrospective overview of the transcription factors proposed to regulate both basal and acute (hormonal) STAR gene expression, and how insights in this area have evolved over the past 30 years. [ABSTRACT FROM AUTHOR]

Pancreatic cancer cells have a much higher metabolic demand than that of normal cells. However, the abundant interstitium and lack of blood supply determine the lack of nutrients in the tumour microenvironment. Although pancreatic cancer has been reported to supply extra metabolic demand for proliferation through autophagy and other means, the specific regulatory mechanisms have not yet been elucidated. In this study, we focused on transcription factor EB (TFEB), a key factor in the regulation of autophagy, to explore its effect on the phenotype and role in the unique amino acid utilisation pattern of pancreatic cancer cells (PCCs). The results showed that TFEB, which is generally highly expressed in pancreatic cancer, promoted the proliferation and metastasis of PCCs. TFEB knockdown inhibited the proliferation and metastasis of PCCs by blocking the catabolism of branched‐chain amino acids (BCAAs). Concerning the mechanism, we found that TFEB regulates the catabolism of BCAAs by regulating BCAT1, a key enzyme in BCAA metabolism. BCAA deprivation alone did not effectively inhibit PCC proliferation. However, BCAA deprivation combined with eltrombopag, a drug targeting TFEB, can play a two‐pronged role in exogenous supply deprivation and endogenous utilisation blockade to inhibit the proliferation of pancreatic cancer to the greatest extent, providing a new therapeutic direction, such as targeted metabolic reprogramming of pancreatic cancer. [ABSTRACT FROM AUTHOR]

The in‐depth mechanisms of microRNA regulation of premature ovarian failure (POF) remain unclear. Crispr‐cas9 technology was used to construct transgenic mice. The qPCR and Western blot was used to detect the expression level of genes. H&E staining were used to detect ovarian pathological phenotypes. We found that the expression levels of microRNA‐3061 were significantly higher in ovarian granulosa cells (OGCs) of POF mouse models than in controls. The miR‐3061+/−/AMH‐Cre+/− transgenic mice manifested symptoms of POF. RNA‐Seq and luciferase reporter assay confirmed that the PAX7 was one of the target genes negatively regulated by microRNA‐3061 (miR‐3061–5p). Moreover, PAX7 mediated the expression of non‐canonical Wnt/Ca2+ signalling pathway by binding to the motifs of promoters to stimulate the transcriptional activation of Wnt5a and CamK2a. In contrast, specific knock‐in of microRNA‐3061 in OGCs significantly downregulated the expression levels of PAX7 and inhibited the expression of downstream Wnt/Ca2+ signalling pathway. We also discerned a correlation between the expression levels of mRNAs of the Wnt/Ca2+ signalling pathway and the levels of E2 and FSH in POF patients by examining gene expression in the follicular fluid‐derived exosomes of women. We confirmed that overexpression of microRNA‐3061 induced proliferative inhibition of OGCs and ultimately induced POF in mice by suppressing the transcription factor PAX7 and downregulating expression levels of its downstream Wnt/Ca2+ signalling pathway genes. [ABSTRACT FROM AUTHOR]

Transmembrane serine protease 2 (TMPRSS2) is a membrane-bound protease belonging to the type II transmembrane serine protease (TTSP) family. It is a multidomain protein, including a serine protease domain responsible for its self-activation. The protein has been implicated as an oncogenic transcription factor and for its ability to cleave (prime) the SARS-CoV-2 spike protein. In order to characterize the TMPRSS2 biochemical properties, we expressed the serine protease domain (rTMPRSS2_SP) in Komagataella phaffii using the pPICZαA vector and purified it using immobilized metal affinity (Ni Sepharose™ excel) and size exclusion (Superdex 75) chromatography. We explored operational fluorescence resonance energy transfer FRET peptides as substrates. We chose the peptide Abz-QARK-(Dnp)-NH2 (Abz = ortho-aminobenzoic acid, the fluorescence donor, and Dnp = 2,4-dinitrophenyl, the quencher group) as a substrate to find the optimal conditions for maximum enzymatic activity. We found that metallic ions such as Ca2+ and Na+ increased enzymatic activity, but ionic surfactants and reducing agents decreased catalytic capacity. Finally, we determined the rTMPRSS2_SP stability for long-term storage. Altogether, our results represent the first comprehensive characterization of TMPRSS2's biochemical properties, providing valuable insights into its serine protease domain. [ABSTRACT FROM AUTHOR]

COVID-19 pandemic is caused by the SARS-CoV-2 virus, whose internalization and infection are mediated by the angiotensin-converting enzyme 2 (ACE2). The identification of novel approaches to tackle this step is instrumental for the development of therapies for the management of COVID-19 and other diseases with a similar mechanism of infection. Thalidomide, a drug sadly known for its teratogenic effects, has potent immunomodulatory and anti-inflammatory properties. Treatment with this drug has been shown to improve the immune functions of COVID-19 patients and proposed for the management of COVID-19 in clinical practice through drug repositioning. Here, we investigated the molecular details linking thalidomide to ACE2 and COVID-19, showing that in conditions mimicking SARS-CoV-2-associated cytokine storm, the transcription factor ΔNp63α and ACE2 are stabilized, and IL-8 production is increased. In such conditions, we found p63 to bind to and regulate the expression of the ACE2 gene. We previously showed that ΔNp63α is degraded upon thalidomide treatment and now found that treatment with this drug—or with its analogue lenalidomide—downregulates ACE2 in a p63-dependent manner. Finally, we found that thalidomide treatment reduces in vitro infection by pseudo-SARS-CoV-2, a baculovirus pseudotyped with the SARS-CoV-2 spike protein. Overall, we propose the dual effect of thalidomide in reducing SARS-CoV-2 viral re-entry and inflammation through p63 degradation to weaken SARS-CoV-2 entry into host cells and mitigate lung inflammation, making it a valuable option in clinical management of COVID-19. Key messages: Thalidomide treatment results in p63-dependent ACE2 downregulation. ACE2 is a p63 transcriptional target. Thalidomide reduces the "cytokine storm" associated to COVID-19. Thalidomide prevents viral re-entry of SARS-CoV-2 by p63-dependent ACE2 downregulation. Thalidomide is a modulator of SARS-CoV-2 or other ACE2-dependent infections. ACE2 is modulated by a pharmacological substance. [ABSTRACT FROM AUTHOR]

Background: Diabetic Kidney Disease (DKD) is a complex disease associated with circadian rhythm and biological clock regulation disorders. Melatonin (MT) is considered a hormone with renal protective effects, but its mechanism of action in DKD is unclear. Methods: We used the GSE151325 dataset from the GEO database for differential gene analysis and further explored related genes and pathways through GO and KEGG analysis and PPI network analysis. Additionally, this study used a type 2 diabetes db/db mouse model and investigated the role of melatonin in DKD and its relationship with clock genes through immunohistochemistry, Western blot, real-time PCR, ELISA, chromatin immunoprecipitation (ChIP), dual-luciferase reporter technology, and liposome transfection technology to study DEC1 siRNA. Results: Bioinformatics analysis revealed the central position of clock genes such as CLOCK, DEC1, Bhlhe41, CRY1, and RORB in DKD. Their interaction with key inflammatory regulators may reveal melatonin's potential mechanism in treating diabetic kidney disease. Further experimental results showed that melatonin significantly improved the renal pathological changes in db/db mice, reduced body weight and blood sugar, regulated clock genes in renal tissue, and downregulated the TLR2/MyD88/NF-κB signaling pathway. We found that the transcription factor DEC1 can bind to the TLR2 promoter and activate its transcription, while CLOCK's effect is unclear. Liposome transfection experiments further confirmed the effect of DEC1 on the TLR2/MyD88/NF-κB signaling pathway. Conclusion: Melatonin shows significant renal protective effects by regulating clock genes and downregulating the TLR2/MyD88/NF-κB signaling pathway. The transcription factor DEC1 may become a key regulatory factor for renal inflammation and fibrosis by activating TLR2 promoter transcription. These findings provide new perspectives and directions for the potential application of melatonin in DKD treatment. [ABSTRACT FROM AUTHOR]

Background Vancomycin-resistant enterococci (VRE) represent a public health threat due to the few available treatments. Such alarm has triggered worldwide initiatives to develop effective antimicrobial compounds and novel delivery and therapeutic strategies. vanA operon is responsible for most cases of acquired vancomycin resistance in enterococci. Objectives Development of a transcription factor decoy (TFD) system as a vanA gene transcription-inhibitor. Methods Vancomycin MIC was determined in the presence of TFD-lipoplexes. Additionally, the effect of TFD-lipoplexes on the expression level of the vanA gene and the growth pattern of E. faecalis was evaluated. The haemolytic activity of the developed TFD-lipoplexes and their cytotoxicity were examined. TFD-lipoplexes efficiency in treating vancomycin-resistant E. faecalis (VREF) infection was tested in vivo using a systemic mice infection model. Results A reduction in vancomycin MIC against VRE from 256 mg/L (resistant) to 16 mg/L (intermediate susceptible), in the presence of TFD-lipoplexes, was recorded. The developed TFD-lipoplexes lacked any effect on E. faecalis growth and significantly reduced the transcription level of the vanA gene by about 3-fold. In an initial evaluation of the safety of TFD-lipoplexes, they were found not to be overtly haemolytic to human blood or cytotoxic to human skin fibroblast cells. The co-administration of TFD-lipoplexes and vancomycin efficiently eradicated VREF infection in vivo. Conclusions The developed TFD-lipoplexes successfully restored vancomycin activity against VREF. They offer a safe effective unconventional therapy against this stubborn organism and present a revolution in gene therapy that can be applied to other resistance-encoding genes in various organisms. [ABSTRACT FROM AUTHOR]

Background: Diabetic cardiomyopathy (DCM) is a serious complication in patients with type 2 diabetes mellitus, and its mechanisms are complex and poorly understood. Despite growing evidence suggesting that ferroptosis plays a significant role in cardiovascular disease, it has been less extensively studied in DCM. Fibroblast growth factor 21 (FGF21), whose mechanism of action is closely related to ferroptosis, is widely utilized in studies focused on the prevention and treatment of glucolipid metabolism-related diseases and cardiovascular diseases. Objective: To confirm the significant role of ferroptosis in DCM and to investigate whether FGF21 improves DCM by inhibiting ferroptosis and elucidating its specific molecular mechanisms. Methods: The animal DCM models were established through high-fat feeding combined with streptozotocin injection in C57BL/6J mice or by db/db mice, and the diabetic cardiomyocyte injury model was created using high glucose and high fat (HG/HF) culture of primary cardiomyocytes. Intervention modeling of FGF21 were performed by injecting adeno-associated virus 9-FGF21 in mice and transfecting FGF21 siRNA or overexpression plasmid in primary cardiomyocytes. Results: The findings indicated that ferroptosis was exacerbated and played a significant role in DCM. The overexpression of FGF21 inhibited ferroptosis and improved cardiac injury and function, whereas the knockdown of FGF21 aggravated ferroptosis and cardiac injury and function in DCM. Furthermore, we discovered that FGF21 inhibited ferroptosis in DCM by directly acting on ferritin and prolonging its half-life. Specifically, FGF21 binded to the heavy and light chains of ferritin, thereby reducing its excessive degradation in the proteasome and lysosomal-autophagy pathways in DCM. Additionally, activating transcription factor 4 (ATF4) served as the upstream regulator of FGF21 in DCM. Conclusions: The ATF4-FGF21-ferritin axis mediates the protective effects in DCM through the ferroptosis pathway and represents a potential therapeutic target for DCM. [ABSTRACT FROM AUTHOR]

Heat shock factor 2 (HSF2) is a versatile transcription factor that regulates gene expression under stress conditions, during development, and in disease. Despite recent advances in characterizing HSF2‐dependent target genes, little is known about the protein networks associated with this transcription factor. In this study, we performed co‐immunoprecipitation coupled with mass spectrometry analysis to identify the HSF2 interactome in mouse testes, where HSF2 is required for normal sperm development. Endogenous HSF2 was discovered to form a complex with several adhesion‐associated proteins, a finding substantiated by mass spectrometry analysis conducted in human prostate carcinoma PC‐3 cells. Notably, this group of proteins included the focal adhesion adapter protein talin‐1 (TLN1). Through co‐immunoprecipitation and proximity ligation assays, we demonstrate the conservation of the HSF2‐TLN1 interaction from mouse to human. Additionally, employing sequence alignment analyses, we uncovered a TLN1‐binding motif in the HSF2 C terminus that binds directly to multiple regions of TLN1 in vitro. We provide evidence that the 25 C‐terminal amino acids of HSF2, fused to EGFP, are sufficient to establish a protein complex with TLN1 and modify cell–cell adhesion in human cells. Importantly, this TLN1‐binding motif is absent in the C‐terminus of a closely related HSF family member, HSF1, which does not form a complex with TLN1. These results highlight the unique molecular characteristics of HSF2 in comparison to HSF1. Taken together, our data unveil the protein partners associated with HSF2 in a physiologically relevant context and identifies TLN1 as the first adhesion‐related HSF2‐interacting partner. [ABSTRACT FROM AUTHOR]

Parkinson's disease (PD) is an age-related progressive neurodegenerative disease. Previously, we identified midnolin (MIDN) as a genetic risk factor for PD. Although MIDN copy number loss increases the risk of PD, the molecular function of MIDN remains unclear. To investigate the role of MIDN in PD, we established monoclonal Midn knockout (KO) PC12 cell models. Midn KO inhibited neurite outgrowth and neurofilament light chain (Nefl) gene expression. Although MIDN is mainly localized in the nucleus, it does not encode DNA-binding domains. We therefore hypothesized that MIDN might bind to certain transcription factors and regulate gene expression. Of the candidate transcription factors, we focused on early growth response 1 (EGR1) because it is required for neurite outgrowth and its target genes are downregulated by Midn KO. An interaction between MIDN and EGR1 was confirmed by immunoprecipitation. Surprisingly, although EGR1 protein levels were significantly increased in Midn KO cells, the binding of EGR1 to the Nefl promoter and resulting transcriptional activity were downregulated as measured by luciferase assay and chromatin immunoprecipitation quantitative real-time polymerase chain reaction. Overall, we identified the MIDN-dependent regulation of EGR1 function. This mechanism may be an underlying reason for the neurite outgrowth defects of Midn KO PC12 cells. [ABSTRACT FROM AUTHOR]

T cell dysfunction is a major barrier to more effective and long-lasting treatment responses in cancer. Transcription factors (TFs), including nuclear factor of activated T cells (NFAT)/activating protein-1 (AP-1), interferon regulatory factor 4 (IRF4)/basic leucine zipper ATF-like TF (BATF), T cell factor 1 (TCF-1), NR4A, TOX, and T-bet/Eomes, play critical context-specific roles in T cell development, function, and dysfunction. Targeting TFs with existing and future small molecule modulators is an untapped therapeutic opportunity to overcome T cell dysfunction. Small molecule modulators may be able to fine-tune TF protein–protein interactions and activity to prevent exhaustion while preserving critical T cell differentiation, effector, and memory programs. Immune checkpoint blockade (ICB) therapies, which block inhibitory receptors on T cells, can be efficacious in reinvigorating dysfunctional T cell responses. However, most cancers do not respond to these therapies and even in those that respond, tumors can acquire resistance. New strategies are needed to rescue and recruit T cell responses across patient populations and disease states. In this review, we define mechanisms of T cell dysfunction, focusing on key transcription factor (TF) networks. We discuss the complex and sometimes contradictory roles of core TFs in both T cell function and dysfunction. Finally, we review strategies to target TFs using small molecule modulators, which represent a challenging but highly promising opportunity to tune the T cell response toward sustained immunity. [ABSTRACT FROM AUTHOR]

Cementum is the least studied of all mineralized tissues and little is known about mechanisms regulating its formation. Therefore, the goal of this study was to provide new insights into the transcriptional regulation of cementum formation by determining the consequences of the deficiency of the Trps1 transcription factor in cementoblasts. We used Trps1Col1a1 cKO (2.3Co1a1-CreERT2;Trps1fl/fl) mice, in which Trps1 is deleted in cementoblasts. Micro-computed tomography analyses of molars of 4-week-old males and females demonstrated significantly shorter roots with thinner mineralized tissues (root dentin and cementum) in Trps1Col1a1 cKO compared to WT mice. Semi-quantitative histological analyses revealed a significantly reduced area of cellular cementum and localized deficiencies of acellular cementum in Trps1Col1a1 cKO mice. Immunohistochemical analyses revealed clustering of cementoblasts at the apex of roots, and intermittent absence of cementoblasts on Trps1Col1a1 cKO cementum surfaces. Fewer Osterix-positive cells adjacent to cellular cementum were also detected in Trps1Col1a1 cKO compared to WT mice. Decreased levels of tissue-nonspecific alkaline phosphatase (TNAP), an enzyme required for proper cementogenesis, were apparent in cementum, periodontal ligament, and alveolar bone of Trps1Col1a1 cKO. There were no apparent differences in levels of bone sialoprotein (Bsp) in cementum. Quantitative analyses of picrosirius red-stained periodontal ligament revealed shorter and disorganized collagen fibers in Trps1Col1a1 cKO mice demonstrating impaired periodontal structure. In conclusion, this study has identified Trps1 transcription factor as one of the important regulators of cellular and acellular cementum formation. Furthermore, this study suggests that Trps1 supports the function of cementoblasts by upregulating expression of the major proteins required for cementogenesis, such as Osterix and TNAP. [ABSTRACT FROM AUTHOR]

Forkhead box O4 (FOXO4), a human transcription factor, recognizes target DNA through its forkhead domain (FHD) while maintaining comparable binding affinity to non-target DNA. The conserved region 3 (CR3), a transactivation domain, modulates DNA binding kinetics to FHD and contributes to target DNA selection, but the underlying mechanism of this selection remains elusive. Using paramagnetic relaxation enhancement analysis, we observed a minor state of CR3 close to FHD in the presence of non-target DNA, a state absent when FHD interacts with target DNA. This minor state suggests that CR3 effectively masks the non-target DNA-binding interface on FHD. The interaction weakens significantly under high salt concentration, implying that CR3 or high salt concentrations can modulate electrostatic interactions with non-target DNA. Our 15N relaxation measurements revealed FHD's flexibility with non-target DNA and increased rigidity with target DNA binding. Our findings offer insights into the role of FOXO4 as a transcription initiator. FOXO4 CR3 masks the non-target DNA binding interface of FHD. FHD increases flexibility with non-target DNA and rigidity with target DNA, releasing CR3. Salt modulates the rate of FHD-DNA binding, discriminating between target and non-target DNA. [ABSTRACT FROM AUTHOR]

APETALA 2 (ApiAP2) proteins are found in large, multisubunit regulatory complexes associated with Pf SAGA or Pf MORC. Heterochromatin-associated ApiAP2 proteins play special roles during parasite development in the blood stages. Commitment to sexual differentiation and gametocyte development and maturation are regulated by a series of ApiAP2 proteins. The regulation of gene expression in Plasmodium spp. , the causative agents of malaria, relies on precise transcriptional control. Malaria parasites encode a limited repertoire of sequence-specific transcriptional regulators dominated by the apicomplexan APETALA 2 (ApiAP2) protein family. ApiAP2 DNA-binding proteins play critical roles at all stages of the parasite life cycle. Recent studies have provided mechanistic insight into the functional roles of many ApiAP2 proteins. Two major areas that have advanced significantly are the identification of ApiAP2-containing protein complexes and the role of ApiAP2 proteins in malaria parasite sexual development. In this review, we present recent advances on the functional biology of ApiAP2 proteins and their role in regulating gene expression across the blood stages of the parasite life cycle. [ABSTRACT FROM AUTHOR]

RNA silencing is both a gene regulatory system and a defense mechanism in plants. Most plant pathogens produce RNA silencing suppressors as part of their infection strategy. The extracellular and intracellular presence of pathogen-derived molecules disrupts the normal functioning of the host RNA silencing. miRNAs regulate multiple genes involved in the RNA silencing machinery, defense, and transcription factor genes. Pathogen-activated silencing suppression results in activation of genes that are under miRNA regulation. miRNAs work as intracellular sensors of pathogen threats that, upon dysfunction, enable a new layer of defense. Within the continuous tug-of-war between plants and microbes, RNA silencing stands out as a key battleground. Pathogens, in their quest to colonize host plants, have evolved a diverse arsenal of silencing suppressors as a common strategy to undermine the host's RNA silencing-based defenses. When RNA silencing malfunctions in the host, genes that are usually targeted and silenced by microRNAs (miRNAs) become active and can contribute to the reprogramming of host cells, providing an additional defense mechanism. A growing body of evidence suggests that miRNAs may act as intracellular sensors to enable a rapid response to pathogen threats. Herein we review how plant miRNA targets play a crucial role in immune responses against different pathogens. [ABSTRACT FROM AUTHOR]

Many studies challenge the view that gene expression is primarily controlled by rapidly evolving, highly specific, and independently acting enhancers. Functional conservation of cis -regulatory elements, and the frequency of their co-option, may be underestimated because cis -regulatory elements can diverge considerably in sequence while binding the same transcription factors and performing the same developmental roles across species. cis -Regulatory elements are often involved in regulating gene expression in the development of multiple traits and can be highly interdependent upon each other. Some cis -regulatory elements are more robust to mutation compared with others, and the fragility of the cis -regulatory architecture of a trait could predict its rate of evolution. New molecular insights prompt us to propose new questions for evolutionary developmental biology. Our understanding of how cis -regulatory elements work has advanced rapidly, outpacing our evolutionary models. In this review, we consider the implications of new mechanistic findings for evolutionary developmental biology. We focus on three different debates: whether evolutionary innovation occurs more often via the modification of old cis -regulatory elements or the emergence of new ones; the extent to which individual elements are specific and autonomous or multifunctional and interdependent; and how the robustness of cis -regulatory architectures influences the rate of trait evolution. These discussions lead us to propose new questions for the evo-devo of cis -regulation. Our understanding of how cis -regulatory elements work has advanced rapidly, outpacing our evolutionary models. In this review, we consider the implications of new mechanistic understandings for evolutionary developmental biology. We focus on three different debates: whether evolutionary innovation occurs more often via the modification of old cis -regulatory elements or the emergence of new ones; the extent to which individual elements are specific and autonomous or multifunctional and interdependent; and how the robustness of cis -regulatory architectures influences the rate of trait evolution. These discussions lead us to propose new questions for the evo-devo of cis -regulation. [ABSTRACT FROM AUTHOR]

The precise spatiotemporal expression of the hematopoietic ETS transcription factor PU.1, a key determinant of hematopoietic cell fates, is tightly regulated at the chromatin level. However, how chromatin signatures are linked to this dynamic expression pattern across different blood cell lineages remains uncharacterized. Here, we performed an in-depth analysis of the relationships between gene expression, chromatin structure, 3D architecture, and trans-acting factors at PU.1 cis-regulatory elements (PCREs). By identifying phylogenetically conserved DNA elements within chromatin-accessible regions in primary human blood lineages, we discovered multiple novel candidate PCREs within the upstream region of the human PU.1 locus. A subset of these elements localizes within an 8-kb-wide cluster exhibiting enhancer features, including open chromatin, demethylated DNA, enriched enhancer histone marks, present enhancer RNAs, and PU.1 occupation, presumably mediating PU.1 autoregulation. Importantly, we revealed the presence of a common 35-kb-wide CTCF-flanked insulated neighborhood that contains the PCRE cluster (PCREC), forming a chromatin territory for lineage-specific and PCRE-mediated chromatin interactions. These include functional PCRE-promoter interactions in myeloid and B cells that are absent in erythroid and T cells. By correlating chromatin structure and 3D architecture with PU.1 expression in various lineages, we were able to attribute enhancer versus silencer functions to individual elements. Our findings provide mechanistic insights into the interplay between dynamic chromatin structure and 3D architecture in the chromatin regulation of PU.1 expression. This study lays crucial groundwork for additional experimental studies that validate and dissect the role of PCREs in epigenetic regulation of normal and malignant hematopoiesis. Main points: An unbiased, multiomics comparison between multiple blood cell types identified novel PU.1 cis regulatory elements with specific chromatin signatures. A 35-kb insulated neighborhood forms a territory for lineage-specific interactions involving an 8-kb PU.1 cis regulatory element cluster in 3D chromatin space. [ABSTRACT FROM AUTHOR]

Among blood cancers, multiple myeloma (MM) represents the second most common neoplasm and is characterized by the accumulation and proliferation of monoclonal plasma cells within the bone marrow. Despite the last few decades being characterized by the development of different therapeutic strategies against MM, at present such disease is still considered incurable. Although MM is highly heterogeneous in terms of genetic and molecular subtypes, about 67% of MM cases are associated with abnormal activity of the transcription factor c-Myc, which has so far revealed a protein extremely difficult to target. We have recently demonstrated that activation of fibroblast growth factor (FGF) signaling protects MM cells from oxidative stress-induced apoptosis by stabilizing the oncoprotein c-Myc. Accordingly, secretion of FGF ligands and autocrine activation of FGF receptors (FGFR) is observed in MM cells and FGFR3 genomic alterations represent some 15–20% MM cases and are associated with poor outcome. Thus, FGF/FGFR blockade may represent a promising strategy to indirectly target c-Myc in MM. On this basis, the present review aims at providing an overview of recently explored connections between the FGF/FGFR system and c-Myc oncoprotein, sustaining the therapeutic potential of targeting the FGF/FGFR/c-Myc axis in MM by using inhibitors targeting FGF ligands or FGF receptors. Importantly, the provided findings may represent the rationale for using FDA approved FGFR TK inhibitors (i.e. Pemigatinib, Futibatinib, Erdafitinib) for the treatment of MM patients presenting with an aberrant activation of this axis. [ABSTRACT FROM AUTHOR]

Retinoic acid-related orphan receptors (RORs) serve as transcription factors that play a pivotal role in a myriad of physiological processes within the body. Their involvement extends to critical biological processes that confer protective effects in the heart, immune system, and nervous system, as well as contributing to the mitigation of several aggressive cancer types. These protective functions are attributed to ROR's regulation of key proteins and the management of various cellular processes, including autophagy, mitophagy, inflammation, oxidative stress, and glucose metabolism, highlighting the emerging need for pharmacological approaches to modulate ROR expression. Thus, the modulation of RORs is a rapidly growing area of research aimed not only at comprehending these receptors, but also at manipulating them to attain the desired physiological response. Despite the presence of natural ROR ligands, the development of synthetic agonists with high selectivity for these receptors holds substantial therapeutic potential. The exploration and advancement of such compounds can effectively target diseases associated with ROR dysregulation, thereby providing avenues for therapeutic interventions. Herein, we provide a comprehensive examination of the multifaceted role of ROR in diverse physiological and pathophysiological conditions, accompanied by an in-depth exploration of a spectrum of ROR agonists, inverse agonists, and antagonists. [ABSTRACT FROM AUTHOR]

Background: Interferon regulatory factor-1 (IRF1) is a transcription factor that plays a significant role in various biological processes, including inflammatory injury, viral infection, cell death, and immune responses, and it has been extensively studied in the context of different lung diseases. However, the mechanism underlying its involvement in lung fibrosis remains largely unknown. Methods: Wild type (WT) mice, IRF1 global-null mice (Irf1−/−) were subjected to a bleomycin-induced lung fibrosis model to enable examination of the role of IRF1 in lung fibrosis. Proteomic analysis of lung tissue from WT and Irf1−/− mice treated with saline or bleomycin was performed to explore the mechanism of IRF1 in regulating lung fibrosis. Results: In the bleomycin-induced fibrosis mouse model, increased expression of IRF1 was observed. Irf1 knockout mice displayed decreased lung fibrosis relative to WT mice following treatment with bleomycin. The protein expression of fibronectin, as assessed by the Western blot analysis of lung tissues, was downregulated in Irf1−/− mice. We observed a similar reduction in collagen content using hydroxyproline detection. Histologically, there was less collagen deposition in the lungs of Irf1−/− mice compared with WT mice. Proteomics data revealed that IRF1 may be involved in lung fibrosis via the regulation of ferroptosis. We determined that paraoxonase 1(PON1), a poorly characterized protein in lung fibrosis, was upregulated in Irf1−/− mice following exposure to bleomycin. In vitro experiments revealed that IRF1 could regulate the level of GSH and MDA through PON1. We also determined that PON1 levels were lower in the plasma of IPF patients compared with healthy controls. Conclusion: Our data highlight the importance of IRF1 in the fibrotic process, and PON1 may be a potential mediator of IRF1 in the progression of lung fibrosis. [ABSTRACT FROM AUTHOR]

SUMMARY: Cold stress restricts the metabolic and physiological activities of plants, thereby affecting their growth and development. Although broad‐complex, tramtrack, and bric‐à‐brac (BTB) proteins are essential for diverse biological processes and stress responses, the mechanisms underlying BTB‐mediated cold responses remain not fully understood. Here, we characterize the function of the cold‐induced SlBTB19 protein in tomato (Solanum lycopersicum). Overexpression of SlBTB19 resulted in increased plant sensitivity to cold stress, whereas SlBTB19 knockout mutants exhibited a cold‐tolerance phenotype. Further analyses, including protein–protein interaction studies and cell‐free degradation assays, revealed that SlBTB19 interacts with and destabilizes the transcription factor SlWRKY2. Using virus‐induced gene silencing (VIGS) to silence SlWRKY2 in both wild‐type and slbtb19 mutants, we provided genetic evidence that SlWRKY2 acts downstream of SlBTB19 in regulating cold tolerance. Importantly, we demonstrated that SlWRKY2 positively regulates cold tolerance in a CRT/DRE binding factor (CBF)‐dependent manner. Under cold stress, SlWRKY2 binds to the W‐box in the CBF1 and CBF3 promoters, directly activating their expression. In summary, our findings identify a SlBTB19‐SlWRKY2 module that negatively regulates the CBF‐dependent cold tolerance pathway in tomato. Significance Statement: Our findings not only contribute to the broader understanding of the molecular basis of plant responses to cold stress but also highlight the importance of post‐transcriptional mechanisms in regulating these responses. In summary, we proposed an updated model: A cold‐induced BTB family protein SlBTB19 negatively regulates cold tolerance. SlBTB19 interacts with and facilitates the proteolysis of the SlWRKY2 protein. SlWRKY2 is a positive regulator of cold tolerance, which activates cold‐responsive genes SlCBFs. [ABSTRACT FROM AUTHOR]

SUMMARY: In plants, RNA silencing constitutes a strong defense against viral infection, which viruses counteract with RNA‐silencing suppressors (RSSs). Understanding the interactions between viral RSSs and host factors is crucial for elucidating the molecular arms race between viruses and host plants. We report that the helicase motif (Hel) of the replicase encoded by apple stem grooving virus (ASGV)—the main virus affecting pear trees in China—is an RSS that can inhibit both local and systemic RNA silencing, possibly by binding double‐stranded (ds) siRNA. The transcription factor related to ABSCISIC ACID INSENSITIVE3/VIVIPAROUS1 from pear (PbRAV1) enters the cytoplasm and binds Hel through its C terminus, thereby attenuating its RSS activity by reducing its binding affinity to 21‐ and 24‐nt ds siRNA, and suppressing ASGV infection. PbRAV1 can also target p24, an RSS encoded by grapevine leafroll‐associated virus 2 (GLRaV‐2), with similar negative effects on p24's suppressive function and inhibition of GLRaV‐2 infection. Moreover, like the positive role of the PbRAV1 homolog from grapevine (VvRAV1) in p24's previously reported RSS activity, ASGV Hel can also hijack VvRAV1 and employ the protein to sequester 21‐nt ds siRNA, thereby enhancing its own RSS activity and promoting ASGV infection. Furthermore, PbRAV1 neither interacts with CP, an RSS encoded by grapevine inner necrosis virus, nor has any obvious effect on CP's RSS activity. Our results identify an RSS encoded by ASGV and demonstrate that PbRAV1, representing a novel type of RAV transcription factor, plays a defensive role against viral infection by targeting viral RSSs. Significance Statement: Our results demonstrate that the helicase motif (Hel) of the replicase encoded by apple stem grooving virus (ASGV) can suppress RNA silencing, and reveal that PbRAV1, a novel type of RAV transcription factor, targets two unrelated viral RSSs—ASGV Hel and GLRaV‐2 p24—to attenuate their RSS activity, thereby suppressing viral infection. [ABSTRACT FROM AUTHOR]

Sorghum is a crop that is susceptible to low temperatures. However, due to the extreme global temperatures, new genotypes have been bred to adapt better to cold climates. Therefore, to better understand the metabolic and molecular differences that may contribute to the improved cold tolerance of these genotypes, it is essential to investigate whether specific molecules play a key role in determining the degree of sorghum tolerance. Furthermore, identifying genes associated with cold tolerance may assist in the development of more robust and productive sorghum cultivars. Here, we analysed the changes in selected elements of the antioxidant metabolism, genes, and miRNAs in two sorghum varieties with different degrees of tolerance to cold stress at different times of exposure to cold stress. The high expression of SbCBF6 in response to cold treatment in early time in the tolerant variety suggests its involvement in the cold response, thereby facilitating a better adaptation of the plant to cold conditions. MiR398 and miR394 showed contrasting behaviour in both varieties in low temperatures, resulting in interesting miRNAs in the degree of sorghum tolerance. MiR319, a marker for the selection of cold‐tolerant cultivars, presents a decrease, suggesting that the better capacity to repress the expression of several members of TCP family of transcription factor genes might be involved in better tolerance to cold stress. This study shows the changes of molecules of interest in response to cold stress in sorghum, marking the difference between cold‐susceptible and cold‐tolerant sorghum plants, which can contribute to selecting tolerant genotypes, allowing new strategies to enhance crop productivity and food security, in regions where low temperatures significantly constrain crop growth and yield. [ABSTRACT FROM AUTHOR]

WRKY transcription factor (TF) family is well known to govern essential physiological functioning as well as regulate plant response to biotic and abiotic stress. In this study, we have identified 108 OsWRKY genes in the genome of Oryza sativa subsp. japonica, using the updated genomic data from the Rice Annotation Project Database and Oryzabase, which were further used to conduct the phylogenetic study, motif analysis, gene structure analysis, chromosomal mapping, and prediction of sub‐cellular localization. The multiple sequence alignment OsWRKY proteins revealed the presence of nine different types of alterations in the conserved heptapeptide sequence WRKYGQK associated with 19 OsWRKY genes. Physiochemical analysis discloses the hydrophobic amino acid‐rich, thermally stable, and polar nature of OsWRKY proteins. These genes were noted as highly conserved between the two cultivated sub‐species of Oryza sativa, that is Indica and japonica type. Additionally, from motif analysis, we have found a new motif, which was categorized as hAT family C‐terminal dimerization region associated with four members of group IIc. We have identified 21 stress‐responsive OsWRKY genes, and their significance to the different biotic and abiotic stress‐mediated cascades was further evaluated by analysing 1500 kb upstream sequences and this disclosed the presence of important phytohormone‐responsive cis‐elements in the OsWRKY gene, suggesting its direct involvement in defence against a wide range of external stressors and these 21 OsWRKY genes are tentatively listed as possible candidates for more study. [ABSTRACT FROM AUTHOR]

Suppression of Tumorigenicity 2 (ST2) is a member of the interleukin-1 receptor/ Toll-like receptor superfamily, and its specific ligand is Interleukin-33 (IL-33). IL-33/ ST2 signaling has been implicated in numerous inflammatory and allergic diseases, as well as in promoting malignant behavior of tumor cells and angiogenesis. However, the precise role of ST2 in gastric cancer angiogenesis remains incompletely elucidated. We observed a significant correlation between high expression of ST2 in gastric cancer tissues and poor prognosis, along with various clinicopathological features. In vitro experiments demonstrated that the IL-33/ ST2 axis activates the PI3K/AKT/NF-κB signaling pathway through TRAF6, thereby promoting VEGFA-mediated tumor angiogenesis; meanwhile sST2 acts as a decoy receptor to regulate the IL-33/ST2L axis. Consistent findings were also observed in subcutaneous xenograft tumor models in nude mice. Furthermore, we investigated the molecular mechanism by which IL-33 promotes ST2L expression in GC cells via upregulation of transcription factors YY1 and GATA2 through intracellular signaling pathways. [ABSTRACT FROM AUTHOR]

Gene expression emerges from DNA sequences through the interaction of transcription factors (TFs) with DNA cis-regulatory sequences. In eukaryotes, TFs bind to transcription factor binding sites (TFBSs) with differential affinities, enabling cell-specific gene expression. In this view, DNA enables TF binding along a continuum ranging from low to high affinity depending on its sequence composition; however, it is not known whether evolution has entailed a further level of entanglement between DNA-protein interaction. Here we found that the composition and length (22 bp) of the DNA sequence interposed between the CRX and NRL retinal TFs in the proximal promoter of RHODOPSIN (RHO) largely controls the expression levels of RHO. Mutagenesis of CRX-NRL DNA linking sequences (here termed "DNA-linker") results in uncorrelated gene expression variation. In contrast, mutual exchange of naturally occurring divergent human and mouse Rho cis-regulatory elements conferred similar yet species-specific Rho expression levels. Two orthogonal DNA-binding proteins targeted to the DNA-linker either activate or repress the expression of Rho depending on the DNA-linker orientation relative to the CRX and NRL binding sites. These results argue that, in this instance, DNA itself contributes to CRX and NRL activities through a code based on specific base sequences of a defined length, ultimately determining optimal RHO expression levels. [ABSTRACT FROM AUTHOR]

Melanoma is the most dangerous form of skin cancer. Hence, a better understanding of molecular mechanisms in melanoma pathogenesis is urgently needed, which provides a new insight into the therapy of melanoma. DTL gene is screened out in melanoma pathogenesis by integrated bioinformatics analysis, and its expression is validated in the tissue and cell samples of melanoma. Forced DTL expression facilitates the proliferation, invasion, migration and EMT of melanoma cells, while DTL knockdown suppresses the biological behavior of melanoma cells. In addition, DTL promotes the malignancy of melanoma in vivo. Mechanistically, BUB1 is the crucial downstream target of DTL. Reduced DTL expression suppresses BUB1 expression, while enhanced DTL expression induces BUB1 upregulation. Rescue experiments showed that growing and migrating of melanoma cells induced by DTL are partially impaired by BUB1 inhibition. In addition, the expression of phosphorylated ERK (p-ERK) and the downstream transcription factor E2F1 are reduced when DTL expression is blocked. Meanwhile, BUB1 levels are decreased when the expression of p-ERK or E2F1 is repressed. Notably, the growth and migration of melanoma cells by inhibition of ERK and knockdown of E2F1 was rescued by overexpressing BUB1. DTL gene may be a prognosis marker and represent a unique potential target for melanoma patients. DTL supports the biologically malignant activity of melanoma cells via the ERK/E2F1/BUB1 axis. [ABSTRACT FROM AUTHOR]

ABSTRACT Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP‐type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid‐maturity stage. Co‐analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL‐like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular‐assisted breeding efforts aimed at establishing high‐protein soybean varieties. [ABSTRACT FROM AUTHOR]

ABSTRACT The increasing contamination of agricultural soils with cadmium (Cd) poses a significant threat to human health and global food security. Plants initiate a series of mechanisms to reduce Cd toxicity. However, the response of maize to Cd toxicity remains poorly understood. In this study, we identified that ZmHMT3, which encodes a homocysteine S‐methyltransferases family protein, acted as a regulator of Cd tolerance in maize. Subcellular localization and in situ PCR exhibited that ZmHMT3 was localized in the cytoplasm and predominantly expressed in the phloem. Overexpression of ZmHMT3 enhanced Cd tolerance and reduced Cd concentration in both shoots and roots. In contrast, ZmHMT3 mutants attenuated Cd tolerance but did not change shoot Cd concentration. Heterologous overexpression of ZmHMT3 in rice enhanced Cd tolerance and reduced grain Cd concentration. Transcriptome analysis revealed that ZmHMT3 upregulated the expression of stress‐responsive genes, especially glutathione S‐transferases (GSTs) and transcription factors, including MYBs, NACs and WRKYs, and modulates the expression of different ATP‐binding cassette (ABC) transporters, thereby enhancing Cd tolerance. Collectively, these findings highlight the pivotal role of ZmHMT3 in Cd tolerance and as a candidate gene for improving Cd tolerance in elite maize varieties. [ABSTRACT FROM AUTHOR]

SUMMARY Manipulating plant height is an essential component of crop improvement. Plant height was generally reduced through breeding in wheat, rice, and sorghum to resist lodging and increase grain yield but kept high for bioenergy crops. Here, we positionally cloned a plant height quantitative trait locus (QTL) qHT7.1 as a MYB transcription factor controlling internode elongation, cell proliferation, and cell morphology in sorghum. A 740 bp transposable element insertion in the intronic region caused a partial mis‐splicing event, generating a novel transcript that included an additional exon and a premature stop codon, leading to short plant height. The dominant allele had an overall higher expression than the recessive allele across development and internode position, while both alleles' expressions peaked at 46 days after planting and progressively decreased from the top to lower internodes. The orthologue of qHT7.1 was identified to underlie the brachytic1 (br1) locus in maize. A large insertion in exon 3 and a 160 bp insertion at the promoter region were identified in the br1 mutant, while an 18 bp promoter insertion was found to be associated with reduced plant height in a natural recessive allele. CRISPR/Cas9–induced gene knockout of br1 in two maize inbred lines showed significant plant height reduction. These findings revealed functional connections across natural, mutant, and edited alleles of this MYB transcription factor in sorghum and maize. This enriched our understanding of plant height regulation and enhanced our toolbox for fine‐tuning plant height for crop improvement. [ABSTRACT FROM AUTHOR]

Basic helixeloopehelix (bHLH) transcription factor gene family in plants controls various growth and development aspects; however, the actual roles of these genes in flowering plants are not well known. In this study, a novel bHLH protein CmbHLH110 was found to interact with CmERF110 by in vitro and in vivo experiments, a chrysanthemum ERF110 homolog that acts as a positive flowering regulator. In addition, CmbHLH110 was also found to regulate the flowering of chrysanthemums, overexpression of CmbHLH110 causes chrysanthemums to flower earlier, and suppressed CmbHLH110 leads to delayed flowering. Furthermore, the loss-of-function Arabidopsis mutant of its homologue PERICYCLE FACTOR TYPE-A 5 (PFA5) had a noticeable late flowering phenotype, and CmbHLH110 completely complemented the late flowering phenotype of the pfa5 mutant, whereas heterologous overexpression of CmbHLH110 in Arabidopsis Col-0 caused early flowering. Transcriptome sequencing revealed significant differential expression of flowering-related and circadian clock-related genes in transgenic chrysanthemum. Therefore, we concluded that CmbHLH110, as a novel flowering regulator, could interact with CmERF110 to regulate flowering in chrysanthemum. [ABSTRACT FROM AUTHOR]

Alzheimer's disease (AD) is the most common aetiology of dementia. The transcription factor NF-E2-related factor 2 (NRF2) induces the expression of genes encoding phase II detoxification and antioxidant genes. NRF2 is regulated by Kelch-like ECH-associated protein 1 (KEAP1), and the KEAP1-NRF2 system is the key regulatory system involved in cytoprotection. To examine whether pharmacological induction of NRF2 expression alleviates AD phenotypes in vivo , we employed two AD mouse models, i.e. App   NL-G-F/NL-G-F (App NLGF ) and APP V717I ::TAU P301L (APP/TAU) mice. As the synthetic oleanane triterpenoid 1-[2-cyano-3,12-dioxooleana-1,9(11-dien-28-oyl)] (CDDO)-4(−pyridin-2-yl)-imidazole (CDDO-2P-Im) exhibits strong NRF2-inducing activity, we treated AD model mice with CDDO-2P-Im. We found that Aβ42 levels were markedly greater in the brains of App NLGF mice than in those of APP/TAU mice. CDDO-2P-Im treatment significantly decreased Aβ42 levels, but not Aβ40 levels, in APP/TAU mice. Consequently, CDDO-2P-Im also decreased the ratio of Aβ42/Aβ40, a vital marker of amyloid plaque formation. LC–MS/MS analyses revealed that CDDO-2P-Im was delivered to the brains of the APP/TAU mice. CDDO-2P-Im induced the expression of detoxification and antioxidant gene targets of NRF2 and elevated reduced glutathione (GSH) levels in the mouse brain. These results support the notion that CDDO-2P-Im ameliorates AD-related pathologic changes. [ABSTRACT FROM AUTHOR]

Huanglongbing (HLB) is the most devastating disease of citrus. Although no citrus species are known to be immune to HLB, some (e.g., Persian lime [Citrus latifolia]) have a high level of tolerance. Differentially expressed genes in the WRKY transcription factor (TF) family have been identified in another tolerant citrus, suggesting an association with such tolerance. Therefore, here we searched for the conserved WRKY domain of WRKY family members in the transcriptome of C. latifolia infected with HLB, characterized the identified ClWRKY genes, and determined which were differentially expressed in leaves with HLB symptoms; 177 transcripts with the WRKY domain were identified, and 32 ClWRKY genes were characterized for conserved motifs, gene ontology, and coexpression networks among the 32 ClWRKY genes. These genes were thus shown to be involved in response to external stimuli and biotic and abiotic stresses. Four differentially expressed ClWRKY genes (ClWRKY20, 23, 47, and 65) were identified in the transcriptome and validated by qRT-PCR. The possible roles of these genes in the tolerance of C. latifolia to HLB are discussed based on the function of homologs of these genes in other plant species. These WRKY genes could contribute to the genetic improvement of susceptible citrus to manage HLB. [ABSTRACT FROM AUTHOR]