Search

The 5' untranslated region of the fragile X mental retardation gene, FMR1, contains a polymorphic CGG repeat. Expansions of this repeat are associated with a spectrum of disorders. Full mutation alleles, repeats >or= 200, are associated with fragile X syndrome. Premutation alleles, repeats of approximately 55-199, are associated with a tremor-ataxia syndrome most commonly in older males and primary ovarian insufficiency in females. However, the neuropsychological impact of carrying a premutation allele is presently unclear in younger adults. In this study, we analyzed neuropsychological scores for 138 males and 506 females ascertained from the general population and from families with a history of fragile X syndrome. Subjects were age 18-50 years and had varying repeat lengths. Neuropsychological scores were obtained from measures of general intelligence, memory, and executive functioning, including attention. Principal component analysis followed by varimax rotation was used to create independent factors for analysis. These factors were modeled for males and females separately via a general linear model that accounted for correlation among related subjects. All models were adjusted for potential confounders, including age at testing, ethnicity, and household income. Among males, no repeat length associations were detected for any factor. Among females, only a significant association with repeat length and self-report attention (p < 0.01) was detected, with premutation carriers self-reporting significantly more attention-related problems compared to noncarriers. No significant interactions between repeat length and age were detected. Overall, these results indicate the lack of a global neuropsychological impact of carrying a premutation allele among adults under the age of 50.

The fragile X disorder spectrum, due to a CGG expansion in FMR1, includes fragile X syndrome (>200 repeats) and the premutation-associated disorders of ovarian insufficiency and tremor/ataxia syndrome (approximately 55-199 repeats). Altered neurobehavioral profiles including variation of phenotypes associated with mood and anxiety may be expected among younger premutation carriers given this spectrum of disorders. However, previous studies have produced conflicting findings, providing the motivation to examine these phenotypes further. We investigated measures of mood and anxiety in 119 males and 446 females age 18-50 ascertained from families with a history of fragile X syndrome and from the general population. Scores were analyzed using a linear model with repeat length as the main predictor, adjusting for potential confounders. Repeat length was not associated with anxiety, but was marginally associated with depression and negative affect in males and negative affect only in females. These results suggest that premutation carriers may be at risk for emotional morbidity; however, phenotypic differences were subtle and of small effect size.

Mutations in genes for WRN and BLM RecQ family helicases cause cancer prone syndromes. Werner syndrome, resulting from WRN mutation, is a segmental progeria. Endogenous WRN and BLM proteins localize in nucleoli and in nuclear PML bodies defined by isoforms of the PML protein, which is a key regulator of cellular senescence. We further characterized WRN and BLM localization using labeling with monomeric red fluorescence protein (mRFP). When ectopically expressed, mRFP-WRN (or untagged WRN) forms nuclear bodies, which are donut-shaped in some cells. We identified PML isoforms associating with the nuclear bodies. Interestingly, mRFP-WRN relocalizes from nucleoli to the nucleoplasm, frequently showing conspicuous nucleolar exclusion as well as a decrease in frequency of mRFP-WRN nuclear bodies in response to overexpression of wild-type and deacetylase mutant (H363Y) SIRT1 proteins. Similar nucleolar relocalization in response to wild-type SIRT1 was detected for mRFP-labeled BLM. Moreover, increased SIRT1 expression was associated with the downregulation of endogenous WRN and a decreased frequency of cells with BRCA1 foci. Our data indicate for the first time that SIRT1 protein may be functionally associated with WRN and BLM helicases and that some major SIRT1 functions may not require its deacetylase activity.

The 5' region of BRCA1 contains multiple regulatory sequences flanking the two alternative promoters alpha and beta and two alternative, non-coding exons, 1a and 1b. Aberrations within the 5' region BRCA1 (encompassing two alternative promoters alpha and beta and exons 1a and 1b) may be associated with an increased risk of breast and ovarian cancer. In this study we screened 150 patients for polymorphism and mutations in this region of BRCA1. All probands came from familial breast and/or ovarian cancer that had been found to be mutation-negative in a previous search for founder mutations in BRCA1 (185delAG, C61G, 4153delA, 5382insC) or BRCA2 (6174delT, 9631delC). In our study we found several sequence alterations within the non-coding region of BRCA1 by using direct DNA sequencing and allele-specific PCR amplification. Three families with a polymorphic deletion in BRCA1 exon 1b (2223delAAAAA, Acc. U37574) were found. Moreover, two linked nucleotide substitutions (2642A>T, 2743T>C, Acc. U37574) in BRCA1 intron 1 were detected in 16 patients. In order to assess the functional significance of these two sequence variants, we constructed a reporter vector encoding firefly luciferase under the transcriptional and translational control of wild type and altered BRCA1 promoter region. The reporter assay was performed using a lung cancer cell line (NCI-H1299) and a breast cancer cell line (MCF7). We have demonstrated that the analysed sequence variants have no functional significance in our experimental system. However, we have found that the BRCA1 promoter has lower relative activity in the breast cancer cell line compared with the lung cancer cell line. Based on the results of our functional experiments we conclude that the polymorphic deletion 2223delAAAAA and two linked substitutions 2642A>T and 2743T>C do not significantly alter BRCA1 expression and are probably not disease-causing mutations.

A CGG repeat sequence located in the 5' untranslated region of the FMR1 gene is polymorphic with respect to size and stability of the repeat during parent-offspring transmission. When expanded to over 200 repeats, the gene is hypermethylated and silenced, leading to fragile X syndrome (FXS). Recently, alleles with large unmethylated repeat tracts (premutations) have been associated with ovarian failure and a late-onset tremor/ataxia syndrome, symptoms unrelated to FXS. To further investigate the phenotype consequence of high repeat alleles, we have analyzed Wechsler adult intelligence scales-III (WAIS-III) measures on 66 males and 217 females with a wide range of repeat sizes. Among females only, we found that FMR1 repeat size and transcript level significantly explained approximately 4% of the variance in the Verbal IQ summary measure, suggesting that this polymorphism is one of many factors that influence variation in cognitive performance. Because of the well established association of increasing repeat size with decreasing age at menopause, we also investigated the reproductive stage and use of hormone replacement therapy (HRT) as a covariate to model verbal intelligence quotient (VIQ). We found that it explained an additional 5% of the variance in VIQ, but did not interact with FMR1 repeat and transcript level.

RECQ4 is a member of the RecQ helicase family, which has been implicated in the regulation of DNA replication, recombination and repair. p53 modulates the functions of RecQ helicases including BLM and WRN. In this study, we demonstrate that p53 can regulate the transcription of RECQ4. Using nontransformed, immortalized normal human fibroblasts, we show that p53-dependent downregulation of RECQ4 expression occurred in G1-arrested cells, both in the absence or presence of exogenous DNA damage. Wild-type p53 (but not the tumor-derived mutant forms) repressed RECQ4 promoter activity. The camptothecin or etoposide-dependent p53-mediated repression was attenuated by trichostatin A (TSA), an inhibitor of histone deacetylases (HDACs). Repression of the RECQ4 promoter was accompanied with an increased accumulation of HDAC1, and the loss of SP1 and p53 binding to the promoter. The simultaneous formation of a camptothecin-dependent p53-SP1 complex indicated its occurrence outside of the RECQ4 promoter. These data suggest that p53-mediated repression of RECQ4 transcription during DNA damage results from the modulation of the promoter occupancy of transcription activators and repressors.

P1 is a bacteriophage of Escherichia coli and other enteric bacteria. It lysogenizes its hosts as a circular, low-copy-number plasmid. We have determined the complete nucleotide sequences of two strains of a P1 thermoinducible mutant, P1 c1-100. The P1 genome (93,601 bp) contains at least 117 genes, of which almost two-thirds had not been sequenced previously and 49 have no homologs in other organisms. Protein-coding genes occupy 92% of the genome and are organized in 45 operons, of which four are decisive for the choice between lysis and lysogeny. Four others ensure plasmid maintenance. The majority of the remaining 37 operons are involved in lytic development. Seventeen operons are transcribed from sigma(70) promoters directly controlled by the master phage repressor C1. Late operons are transcribed from promoters recognized by the E. coli RNA polymerase holoenzyme in the presence of the Lpa protein, the product of a C1-controlled P1 gene. Three species of P1-encoded tRNAs provide differential controls of translation, and a P1-encoded DNA methyltransferase with putative bifunctionality influences transcription, replication, and DNA packaging. The genome is particularly rich in Chi recombinogenic sites. The base content and distribution in P1 DNA indicate that replication of P1 from its plasmid origin had more impact on the base compositional asymmetries of the P1 genome than replication from the lytic origin of replication.

Somatic mutations of 11q23.3-linked constitutive heat shock protein 70 gene (HSPA8 alias HSC70) are detected by others in breast carcinomas. To examine whether intragenic, somatic mutations of HSPA8 occur in lung carcinomas, we sequenced its exons 2-8, with adjacent intronic sequences, in a series of DNA samples from non-small-cell lung cancers (NSCLC). Twenty-one polymorphisms were detected, but no somatic mutation. However, we observed an association between the HSC70 1541-1542delGT genotype and the immunohistochemical staining pattern of HSC70 protein. Tumors with weak (+) HSC70 protein staining were more frequent in the carriers of the polymorphic 1541-1542delGT allele than in the homozygotes of the major allele (20% vs. 6%, P=0.05 by Fisher's exact test). This statistically significant association prompted us to test the polymorphism functionally. The method we developed for the functional evaluation of intronic sequence alterations showed that the HSPA8 intron 2 with the deleted GT dinucleotide was associated with noticeable (approximately 20%) and statistically significant (P=0.005) reduction of the reporter gene activity. Our case-control analysis showed that the 1541-1542delGT heterozygous genotype was associated with significantly decreased risk for lung cancer (crude odds ratio (OR)=0.44; 95% confidence interval (CI): 0.23-0.84). To the best of our knowledge, this is the first report on the association between a polymorphism of a gene coding for the chaperone protein and lung cancer risk. Moreover, the simple method reported here, based on the dual-luciferase reporter assay system, can be useful for testing functional significance of polymorphisms located in introns of other genes., (Copyright 2004 Wiley-Liss, Inc.)

Coexpression of epidermal growth factor receptor (EGFR) and c-erbB-2 in 47-68% of ovarian cancer cells indicate their strong association with tumor formation. We examined the effects of simultaneous antisense- or immunosuppression of EGFR and c-erbB-2 expression on the invasive phenotype, aneuploidy, and genotype of cultured human ovarian carcinoma cells (NIH:OVCAR-8). We report here that suppression of both EGFR and c-erbB-2 results in regression of aneuploidy and genomic imbalances in NIH:OVCAR-8 cells, restores a more normal phenotype, and results in a more normal gene expression profile. Combined with cytogenetic analysis, our data demonstrate that the regression of aneuploidy is due to the selective apoptosis of double antisense transfected cells with highly abnormal karyotype.

The X-linked mosaic mutation in mice belongs to the mottled group of mutations. This group represents animal models of human copper deficiency disease, such as Menkes disease. It has been demonstrated that the disruption of copper metabolism is caused by a mutation in the Atp7a gene and leads to a lethal phenotype. Many similarities between mosaic and other mottled mutants give a strong indication that this mutation could occur in the cDNA of the Atp7a gene. In this paper, the cDNA of this gene was sequenced from 9 unrelated mutants and 7 unrelated control mice. It was found that a CAG insertion at the end of the 4th exon exists in the mutants but not in control cDNA. The same CAG insertion was previously described as a polymorphism in alternative splicing between BALB/c and C57BL/6 mice, therefore it is suggested that this changed sequence is a polymorphism strongly related to the phenotype rather than it is the cause of mutation. However, such a strong linkage between this polymorphism and the mosaic phenotype (lasting for 96 outbred generations), suggests that the mutation is in the Atp7a gene.

DNA damage repair, responsible for maintaining the genome integrity, plays a central role in cancer biology. Individual DNA repair capacity is genetically determined. Inherited defect in nucleotide excision repair (NER) genes leads to three distinct and extremely rare disorders: xeroderma pigmentosum, associated with high risk of skin cancer, Cockayne syndrome, and trichothiodystrophy. The recently identified common polymorphism in several NER genes may also influence a risk of cancer in general population. The review presents current knowledge about a role of genetic variation of NER genes in cancer predisposition.

Recent molecular epidemiological studies have identified polymorphisms in the XPD gene that are associated with increased risk of brain gliomas and head, neck, lung, and skin cancers. However, the functional significance of these polymorphic variants in altering cell processes such as cell cycle checkpoints, DNA repair, and apoptosis is uncertain. We have cloned the XPD variants Lys751Gln, Asp312Asn, and Lys751Gln-Asp312Asn into a pcDNA-3.1-expression vector. Using these constructs, we did not find any detectable difference in either in vitro binding with wild-type p53 or in DNA repair proficiency as measured by host cell reactivation assay. We then genotyped 34 different lymphoblastoid cell lines from six Centre d'Etude du Polymorphisme Humaine (CEPH)/Utah pedigree families and a CEPH/French pedigree family for polymorphisms at codons 751 and 312 and assessed their apoptotic response after either UV or ionized radiation exposure. The lymphoblastoid cell lines with homozygous or heterozygous Asp at codon 312 have similar apoptotic rates, whereas cell lines with homozygous Asn at codon 312 showed a 2.5-fold increased response to UV (P = 0.005; Student's t test). This is the first report known to us of a functional polymorphism in a gene involved in DNA damage-induced apoptosis. However, the presence of Lys or Gln at codon 751 did not influence the apoptotic response to UV. The diminished apoptotic response of cells containing the 312 Asp allele could both allow the survival and selective clonal expansion of carcinogen-damaged cells and be a mechanistic explanation for the increased risk of cancer at diverse tissue sites.

Li-Fraumeni syndrome is a rare autosomal, dominant trait of diverse types of cancers in children and young adults, with a predominance of soft tissue sarcomas, osteosarcomas, brain tumours, adrenocortical and breast carcinomas, as well as leukaemias. We present a family with an unusual cancer history fulfilling the criteria of Li-Fraumeni syndrome. Mutational analysis of the p53 gene in constitutional DNA of several affected members of the family did not show any germline p53 defect. Cytogenetic studies did not reveal any structural aberrations.

The authors first revealed reliable decrease in general capacity and amplitude of electromagnetic waves in staffers subjected to occupational electromagnetic fields of 50 Hz--that proves increased risk of cardiovascular diseases dependent on vegetative matters. Present norms on electric and magnetic fields of 50 Hz should be justified and intensified.

Germ-line mutations in BRCA1 and BRCA2 genes result in a significantly increased risk of breast and ovarian cancer. Other genes involved in an increased predisposition to breast cancer include the TP53 gene, mutated in Li-Fraumeni syndrome. To estimate the frequency of germ-line mutations in these three genes in Upper Silesia, we have analyzed 47 breast/ovarian cancer families from that region. We found five different disease predisposing mutations in 17 (36%) families. Twelve families (25.5%) carried known BRCA1 mutations (5382insC and C61G), four families (8.5%) carried novel BRCA2 mutations (9631delC and 6886delGAAAA), and one family (2%) harbored novel mutation 1095del8 in the TP53 gene, which is the largest germline deletion in coding sequence of this gene identified thus far. The 5382insC mutation in BRCA1 was found in 11 families and the 9631delC mutation in BRCA2 occurred in three families. These two mutations taken together contribute to 82% of all mutations found in this study, and 30% of the families investigated harbor one of these mutations. The very high frequency of common mutations observed in these families can only be compared to that reported for Ashkenazi Jewish, Icelandic, and Russian high-risk families. This frequency, however, may not be representative for the entire Polish population. The observed distribution of mutations will favor routine pre-screening of predisposed families using a simple and cost-effective test., (Copyright 2000 Wiley-Liss, Inc.)

A deficiency in DNA repair is associated with increased cancer risk. Inter-individual variations in DNA repair capacity observed in humans may result from genetic polymorphisms in DNA repair genes. In order to provide a basis for future functional and molecular epidemiology studies on cancer susceptibility, we screened 35 individuals for polymorphisms in coding regions of XPA and XPB genes involved in nucleotide excision repair (NER). Relevant cDNA sequences were amplified by PCR, sequenced with fluorescently labeled terminators and analyzed with automated sequencer. Two polymorphisms in XPB were found: AAA-->AGA (445A>G; GenBank M31899) causing K117R substitution and GGC-->TGC (1299G>T; GenBank M31899) causing G402C exchange. Also, two polymorphisms in XPB were detected: CGA-->CAA (709G>A; GenBank D14533) causing R228Q exchange, and A-->G (23A>G; GenBank D14533) substitution in the 5' non-coding region of the gene. The three aforementioned amino acid substitutions were uncommon in this population (1.4%). In contrast, the substitution located 4 nucleotides upstream of the ATG start codon of XPB was frequent (57%). To our best knowledge this is the first report of these sequence variants. The location of these polymorphisms in evolutionary conserved regions suggest that they may be of functional significance., (Copyright 2000 Wiley-Liss, Inc.)

We investigated the association of p53 abnormalities (gene mutations by DNA sequencing and protein over-expression by immunostaining) with clinical data and prognosis in 74 patients with resected non-small cell lung cancer (NSCLC). DNA analysis of exons 5-8 of the p53 gene showed 34 mutations in 74 resected primary NSCLC (45.9%). Immunohistochemical study of the p53 protein revealed that 41 of 74 (55.4%) samples had positive staining. We found strong agreement between the results of the p53 protein expression test (p53-PE) and the p53 gene mutation test (p53-M) (Cohen's kappa = 0.65, 95% CI 0.48-0.82). Joint distribution of the results (analysed using the bivariate Dale model) was mainly influenced by, histological type of tumour. A positive result for the p53-PE test significantly increased (estimated odds ratio 84.5; 95% CI 8.89-803.03) the odds of observing a positive result in the p53-M test. In the univariate analysis (log rank test), positive results in the p53-M test and the p53-PE test were significantly associated with overall survival (P < 0.001 and P = 0.005, respectively). In the multivariate analysis (Cox's proportional hazard model), a positive result for the p53-M test significantly increased relative risk for overall survival (RR 9.56; 95% CI 2.62-34.87; P < 0.001). When the result of the p53-M test was accounted for, a positive result for the p53-PE test did not offer any additional prognostic information due to the strong dependence of results of the tests. However, when the result of the p53-M test was removed from the model, a positive result for the p53-PE test became a significant unfavourable prognostic factor (P = 0.009). We conclude that p53 gene mutation and protein expression analyses are in a strong agreement. Joint distribution of the results depends mainly on histological type of tumour. When considered separately, both tests are unfavourable prognostic factors in NSCLC. When the result of the p53-M test is taken into account, the p53-PE test does not offer any additional prognostic information.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance., (Copyright 1999 Wiley-Liss, Inc.)

The fragile histidine triad (FHIT) gene at chromosome 3p14.2 is a candidate tumor suppressor gene linked to cancers of the lung, breast, colon, pancreas, and head and neck. Reports of frequent allelic deletion and abnormal transcripts in primary lung tumors plus recent evidence that it is targeted by tobacco smoke carcinogens suggest that it plays an important role in lung carcinogenesis. Non-small cell lung carcinoma still maintains a poor 5-year survival rate with the stage of disease at presentation as a major determinant of prognosis. We examined for allelic deletion at the FHIT locus in a series of 106 non-small cell lung carcinomas for which a full clinical, epidemiological, and 5-year survival profile was available. We found an allelic deletion frequency of 38% at one or two intragenic microsatellites. Allelic deletion of FHIT was related to tumor histology with 4 of 20 adenocarcinomas (20%) displaying loss of heterozygosity (LOH) compared with 12 of 22 (55%) nonadenocarcinomas (P = 0.03). We found that 63% of tumors with LOH of FHIT also had p53 missense mutations whereas only 26% with LOH had wild type p53 negative sequence (P = 0.02). We also found a significant trend toward poorer survival in patients with LOH of at least one locus of the FHIT gene (log rank, P = 0.01). This survival correlation is independent of tumor stage, size, histological subtype, degree of differentiation, and p53 mutation status. Our data support the hypothesis that the loss of the FHIT contributes to the molecular pathogenesis of human lung cancer and is an indicator of poor prognosis.

The hst70 gene which belongs to rat HSP70 multigene family is highly expressed in pachytene spermatocytes. Using a transgenic mice model it was found that the promoter of the rat hst70 gene directs the expression of the chloramphenicol acetyl transferase (CAT) reporter gene not only to testis but also to multiple somatic tissues. In wild-type rats the expression of the hst70 gene in tissues other than testis was confirmed by non-quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis. Beside the testis, the CAT expression in transgenic mice and the hst70 gene transcripts in wild-type rats were found in brain, pituitary, epididymis, vas deferens, adrenals, spleen, lung, ovary, oviduct and uterus. The only tissue in which both the CAT expression and the hst70 gene activity has not been found was the liver. These observations suggest possibly more universal, not confined to spermatogenesis, function of the hst70 gene.

Purpose: To report a quantitative and objective method for assessing pathologic alterations in retinal structures to improve the evaluation of macular diseases., Methods: We used a system based on the scanning retinal thickness analyzer to generate serial optical section images of the retina and provide mapping of the retinal topography and thickness in a normal subject and in patients with representative maculopathies including traumatic macular hole, central serous chorioretinopathy, branch retinal vein occlusion, diabetic macular edema, and retinal pigment epithelial detachment., Results: The effectiveness of the system in imaging both the vitreoretinal and chorioretinal interfaces was confirmed in the normal subject and in patients with various maculopathies. Mapping of retinal topography and thickness in a normal eye correlated well with normal anatomy, delineating the foveal depression clearly. The retinal thickness map in a patient with diabetic macular edema showed thickening of the retina and absence of a foveal depression. The patients with central serous chorioretinopathy and branch retinal vein occlusion had an elevated vitreoretinal surface. Conversely, the patient with retinal pigment epithelial detachments had a relatively flat vitreoretinal interface but an irregularly elevated chorioretinal surface., Conclusion: Quantitative mapping of retinal topography and thickness is a promising tool that may improve evaluation of macular diseases.

The p15(INK4B), p16(INK4) and p18 genes are members of the gene family coding for inhibitors of cyclin-dependent kinases 4 and 6. p15(INK4B) and p16(INK4) are located at 9p21, a chromosomal region frequently deleted in many human neoplasms. To examine the role of these 3 genes in lung carcinogenesis, somatic mutations within the genes were analyzed by single-strand conformation polymorphism and DNA sequencing in 71 non-small-cell lung cancer (NSCLC) samples. Six somatic mutations in the p16(INK4) gene and 3 cases with a polymorphic allele were observed. Loss of heterozygosity in the p18 gene was found in 1 sample. We did not find any intragenic mutations in the p15(INK4B) or p18 genes. We conclude that p16(INK4) mutations play a role in the formation of some NSCLCs, whereas the involvement of p15(INK4B) and p18 is uncommon.

We examined the genomic status of cyclin-dependent kinase-4 and -6 inhibitors, p16INK4,p15INK4B, and p18, in 40 primary lung cancers and 31 metastatic lung cancers. Alterations of the p16INK4 gene were detected in 6 (2 insertions and 4 homozygous deletions) of 22 metastatic non-small cell lung cancers (NSCLCs; 27%), but none were detected in 25 primary NSCLCs, 15 primary small cell lung cancers (SCLCs), or 9 metastatic SCLCs, indicating that mutation in the p16INK4 gene is a late event in NSCLC carcinogenesis. Although three intragenic mutations of the p15INK4B gene were detected in 25 primary NSCLCs (12%) and five homozygous deletions of the p15INK4B gene were detected in 22 NSCLCs (23%), no genetic alterations of the p15INK4B gene were found in primary and metastatic SCLCs. The p18 gene was wild type in these 71 lung cancers, except 1 metastatic NSCLC which showed loss of heterozygosity. We also examined alterations of these three genes and expression of p16INK4 in 21 human lung cancer cell lines. Alterations of the p16INK4 and p15INK4B genes were detected in 71% of the NSCLC cell lines (n = 14) and 50% of the NSCLC cell lines (n = 14), respectively, but there were none in the 7 SCLC cell lines studied. No p18 mutations were detected in these 21 cell lines. These results indicate that both p16INK4 and p15INK4B gene mutations are associated with tumor progression of a subset of NSCLC, but not of SCLC, and that p15INK4B mutations might also be an early event in the molecular pathogenesis of a subset of NSCLC.

A new free radical scavenger, U74006F (Upjohn Company, Kalamazoo, MI, USA) was studied to determine if it would have a beneficial effect on preventing intraocular pressure (IOP) spikes and reducing blood-aqueous barrier (BAB) breakdown in rabbits after argon laser trabeculoplasty (ALT). The post-ALT IOP averaged 24.7 mm Hg (+/- 3.8 mm Hg; N = 6) and 30.3 mm Hg (+/- 6.9 mm Hg; N = 7) at 1 hour (p = 0.097) and 22.7 mm Hg (+/- 1.9) and 27.3 mm Hg (+/- 7.0 mm Hg) at 3 hours in the U74006F and vehicle groups (p = 0.137), respectively. By 48 hours, the IOP averaged 12.8 +/- 2.2 mm Hg in the U74006F group and 12.4 +/- 2.4 mm Hg in the vehicle group (P = 0.757). The aqueous fluorescein permeability (AFP) between lasered and unlasered eyes was determined for the U74006F and vehicle-treated groups by aqueous fluorophotometry. Prelaser or baseline AFP was determined for the U74006F (-0.236 +/- 0.236) and vehicle (-0.145 +/- 0.237) groups (p = 0.505). At day 2 posttreatment, the U74006F group and the placebo group both reported similar AFP of 5.109 +/- 4.831 and 5.680 +/- 4.280 (p = 0.827), respectively. At one week post-ALT, AFP for the U74006F group (0.109 +/- 0.367) had returned close to baseline, while that of the vehicle group (0.426 +/- 0.511) was still quite elevated (p = 0.220). U74006F appears to be beneficial in the prevention of acute elevation of IOP following ALT but not in the prevention of Blood-Aqueous Barrier (BAB) breakdown.(ABSTRACT TRUNCATED AT 250 WORDS)

A student-centered curriculum is possible to design which does not compromise quality. However, the mechanics of creating and operationalizing such a program are a complex matter and require the ongoing support, assistance, and involved commitment of everyone involved under the broad umbrella of curriculum. Given the highly specific learning needs of RRNs, a student-centered curriculum is most easily implemented in an RN only program, where each element of the curriculum can be tailored expressly to match learning style. RRNs describing the attributes of RN only designed programs cite the support of independence that is the hallmark of such programs. For these reasons, RN only programs best address the needs of adult learners.

Resuscitation discussions can elicit potent emotional reactions from both health care providers and consumers. In rehabilitation settings, decision making grows more difficult if decisions must be sought from family members or proxies of incompetent patients. There is ample room for emotions and lack of clarity to lead to dissatisfaction and heightened distress. This paper outlines legal, ethical, and psychological factors that must be managed if clear communication between health care providers and families is to occur. Issues are discussed that can clarify thinking at each stage of the communication process.

Diabetic macular edema is a major cause of vision loss and is evaluated with qualitative or semiquantitative techniques. A new quantitative method for assessment of macular edema using retinal thickness analysis was applied to 19 patients with diabetic macular edema. Foveal thickening was frequently coupled with poor visual acuity. Slit-lamp biomicroscopy and stereophotography detected 80% and 78% of local areas of thickening, respectively, but failed to detect locations with average thicknesses of 1.5 and 1.6 times normal, respectively. Fluorescein leakage on angiography was generally associated with retinal thickening, but locations with similar degrees of leakage had widely varying retinal thickening. Fluorescein leakage in the posterior vitreous correlated poorly with the degree of foveal thickening. These results indicate that quantitative measurement of retinal thickness may become useful in the management of diabetic patients with macular edema.

We tested whether vitreoperfusion, a new method of perfusing the vitreous cavity with solutions containing nutrients, can limit retinal injury if initiated after the onset of ischemia. Severe bilateral ocular ischemia was induced in cats with healed lensectomy-vitrectomy wounds; 30, 60, 90, or 120 minutes later, one eye from each of 18 cats underwent vitreoperfusion while the ischemia continued for 120 minutes. The other eye simultaneously underwent either continued untreated ischemia or reinstated circulation. The histopathologic abnormalities evident after 8 days depended on the duration of ischemia. Reinstated circulation yielded less retinal damage than continued ischemia. Nine additional cats underwent bilateral ischemia for at least 210 minutes. Vitreoperfusion was initiated in one eye after 30 minutes. In each cat, the vitreoperfused eye fared significantly better as observed histopathologically and electroretinographically. We believe that no other treatment has similarly limited retinal injury in vivo when initiated so long after total ocular ischemia has developed.

Rehabilitation medicine and geriatric medicine are similar in their concern for functional improvement in the face of chronic medical conditions. Although many patients served by rehabilitation medicine fall within the geriatric age range, a knowledge of normal aging does not necessarily inform clinical decision making or research practices in rehabilitation. Using stroke as an example of a disorder affecting primarily geriatric patients and requiring the technology of rehabilitation, ways in which age might affect assessment of outcome are examined. Three areas dealing with conceptual and methodologic issues--depression, neurochemical interventions, and family--are highlighted. The final section outlines recommendations for research on rehabilitation outcome of geriatric stroke patients.

Ten patients with Best's macular dystrophy were examined with vitreous fluorophotometry and results were compared with a normal population. Seventeen of the 20 affected eyes demonstrated an intact blood-retinal barrier with normal inward permeability of fluorescein dye. Despite diffuse functional impairment of the retinal pigment epithelium (RPE), determined by electro-oculography, as well as accumulation of a lipofuscin or lipofuscin-like substance within virtually all RPE cells, the blood-retinal barrier function of these cells remained intact as determined by clinical fluorophotometry. Similar findings have previously been noted in another hereditary retinal disorder (fundus flavimaculatus) in which a lipofuscin-like substance also accumulates diffusely within RPE cells.

The blood-retinal barrier (BRB) might be governed by the same permeability principles as the blood-brain barrier (BBB). For a weak acid like fluorescein, BRB permeability would be proportional to its pH-dependent lipid solubility, according to the pH partition hypothesis. A range of metabolic acidosis was produced in 20 rats by the oral administration of NH4Cl; six additional rats received normal saline. Four hours later, vitreous fluorophotometry, venous fluorescein values, and arterial pH were measured. Significant linear relationships were found between vitreous fluorophotometry readings and blood hydrogen ion concentrations (p less than 0.025) and plasma fluorescein concentrations (p less than 0.05). According to the linear relationship, changing the pH from 7.4 to 7.3 or 6.9 would result in an increase in vitreous fluorophotometry reading of 8.5 or 72%, respectively. Since the pH partition hypothesis predicts values of 52 or 640% our results suggest that the BRB conforms less to the hypothesis than does the BBB. Furthermore, although pH changes of a magnitude able to influence vitreous fluorophotometry readings substantially may occur under experimental conditions in animals, they are unlikely to occur in ambulatory human patients.

Carboxyfluorescein resembles fluorescein in size and spectral characteristics but is much less lipid soluble. Both dyes were used to differentiate between two groups of factors that influence penetration across the blood-retinal barrier: (1) factors that depend on lipid solubility, such as the area of the barrier, and (2) factors independent of lipid solubility, such as opened intercellular junctions or necrotic cells. Vitreous fluorophotometry was performed on normal and diabetic rats after injection of either dye. After the results were adjusted for sources of error, midvitreous-plasma dye ratios for carboxyfluorescein and fluorescein were of the same order of magnitude in normal rats. Ratios for both dyes increased in diabetic rats, and the increases were similar in magnitude. Our results suggest that lipid solubility contributes little to inward transport of these dyes in both the normal and diabetic states.

The status of the blood-retinal barrier (BRB) in carriers of choroideremia and X-linked retinitis pigmentosa (XLRP) was determined by vitreous fluorophotometry (VF) and compared with that in female control subjects. Electroretinographic (ERG) amplitudes were measured to determine the overall functional integrity of retinal rods and cones. Comparison of the VF results showed an abnormal BRB in at least some carriers of XLRP, particularly those with peripheral fundus pigmentary changes, but not in carriers of choroideremia with even moderately extensive pigmentary changes. The abnormal BRB in XLRP carriers, with or without peripheral fundus pigmentary changes, was associated with at least moderate to moderately extensive reduction in scotopic ERG amplitudes, while the normal VF results in choroideremia carriers were associated with normal scotopic ERG amplitudes. However, in XLRP carriers, mild to modest reductions in ERG scotopic responses were seen in the presence of normal VF findings.

Lipid solubility is a major determinant of permeability across the blood-brain barrier, to which the blood-retinal barrier (BRB) has many similarities. Carboxyfluorescein is a dye with about 1/1000 the lipid solubility of fluorescein, but their molecular sizes and spectral characteristics are similar. We studied the importance of lipid solubility in BRB permeability by comparing the BRB permeabilities to these two dyes. Dye in the vitreous and plasma of four monkeys was measured by fluorophotometry. The estimated inward permeability coefficients (Pin) were 11 +/- 7.4 X 10(-6) cm/min (mean and SD) for carboxyfluorescein and 21 +/- 5.9 X 10(-6) cm/min for fluorescein. The ratio of the means was 1/1.9, far from the expected 1/1000. This finding suggests that the BRB does not function as a continuous lipid membrane and that other factors are more important determinants of permeability for these dyes than lipid solubility.

Cystoid macular edema (CME) is a major cause of visual impairment and is thought to be due to abnormal perifoveal capillary permeability. Posterior sub-Tenon's corticosteroid injections are used to improve the visual acuity in CME, although their mechanism of action is uncertain. In this study, visual acuity, blood retinal barrier (BRB) permeability, and fluorescein angiograms were recorded immediately before and one and four weeks after the administration of steroid injections. Ten patients (12 treated eyes) with CME secondary to uveitis were studied. Visual improvement, defined as an increase in at least two lines of Snellen visual acuity, was seen in half of the treated eyes. In some patients, these improvements were not directly related to changes in the BRB permeability or the amount of macular fluid. Posterior sub-Tenon's corticosteroid injections do not consistently affect blood retinal barrier permeability.

Normal- and diabetic rhesus monkeys without retinopathy demonstrable by ophthalmoscopy or fluorescein angiography were examined with ocular fluorophotometry to detect alterations in their blood-ocular barriers. All vitreous fluorophotometry values were corrected for fluorescence attributable to background levels and then normalized to a blood fluorescein level of 10 micrograms ml-1. Reproducibility studies demonstrated an average coefficient of variation of 0.17 for all animals combined. Insulin-dependent monkeys, both pancreatectomized and streptozotocin-treated, demonstrated significantly higher posterior vitreous fluorescence levels than either control animals or monkeys treated with streptozotocin that were not insulin-dependent. These results cannot be attributed to differences in fluorescein binding or to vitreous abnormalities. However, 14 out of 24 (58%) of the insulin-dependent animals exhibited posterior vitreous fluorescence values within two standard deviations of the control mean. No correlation was apparent between the vitreous values and age or duration of treatment. No difference in anterior chamber concentrations was found between groups after correction. Our results indicate that alterations in blood-retinal barrier can occur in insulin-dependent diabetic monkeys before development of retinopathy.