Search

Background & Aims: VEGF is a key stimulator of angiogenesis and promotes the growth colon tumors via increased nutrient and oxygen supply. A recent study demonstrated that colorectal cancer (CRC) cells have increased expression of VEGF and its receptors VEGFR1 & VEGF-R2, which indicates a possibility of direct stimulation of CRC cell growth by VEGF. However, the role of VEGF in CRC cell proliferation by an autocrine mechanism has not been fully explored in depth. We hypothesized that VEGF secreted by CRC cells binds to VEGF-R1 & VEGF-R2 on CRC cells and: 1) promotes proliferation of these cells through an autocrine pathway, 2) inhibits CRC apoptosis. Methods: We used: (1) human CRC cell lines HCT116 & HT29 and (2) normal colonic epithelial cells NCM356 & NCM460 cultured in nutrient media. Studies: 1) VEGF, VEGF-R1 & VEGF-R2 mRNA and protein expression of by Real-Time RT-PCR and immunoblotting; 2) VEGF165 secretion into the culture media by ELISA; 3) cell proliferation by BrdU assay; 4) apoptosis by TUNEL staining and assessment of activated caspases 3 and 9; 5) Inhibition of VEGF receptor function using AAL993 inhibitor, which blocks function of VEGF-R1 and VEGF-R2; 6) assessment of phosphorylation of EGF receptor (EGF-R) to test its transactivation by VEGF. Results: 1) Normal colonic cells do not secrete VEGF (< 35 pg/ml culture media) while CRC cells express and secrete high levels of VEGF (840 1500 pg/ml culture media); 2) Normal colonic epithelial cell lines expressed no or minimal VEGF-R1 & VEGF-R2 mRNA and protein while CRC cell lines exhibit strong expression of VEGF-R1 & VEGF-R2 vs. normal colonic epithelial cells by 14and 24-fold, respectively (all p < 0.001); 3) CRC cell lines have significantly increased cell proliferation by 31% (p < 0.01) and decreased apoptosis vs. normal colonic epithelial cells; 3) Inhibition of both VEGF-R1 & VEGF-R2 receptors using AAL-993 significantly decreased CRC cell proliferation by (2.2-fold) ; 4) Treatment of CRC cells with AAL-993 decreased phosphorylation of EGF-R by 1.9-fold (p < 0.01). Conclusions: 1) VEGF and its VEGF-R1 & VEGF-R2 receptors are increased in CRC cell lines; 2) CRC cells secrete VEGF, which stimulates CRC cell proliferation via an autocrine mechanism by its VEGF-R1 & VEGF-R2 receptors and also inhibits apoptosis; 3) VEGF receptor signaling pathway is critical for activating EGF-R in CRC cells; 4) These studies suggest a cross-talk between VEGF receptor and EGF-R signaling in CRC cells, which promotes these cells' proliferation.

Background/Aims: Studies of gastric mucosal injury and healing rely on macroscopic and histological assessment of fixed stomach specimens, which may not fully reflect in vivo events. As a result, the cellular targets and real time sequence of gastric mucosal injury are not fully defined. Confocal laser endomicroscopy (CLE), a novel cutting edge technology, has enabled in vivo real-time visualization of mucosal structures at a subcellular resolution. This study was aimed to: 1) assess acute gastric injury in real time using CLE with a focus on mucosal microvessels and progenitor cells; 2) determine whether hydrotalcite (HTL), the newest generation antacid, can protect gastric mucosa against ethanol injury; and, 3) identify the mechanisms involved. Methods: Fischer F344 rats received 1 ml 0.5% fluorescein i.v. followed by intragastric (i.g.) ethanol (1 ml, 50%) or saline. In some rats, either 1 ml of vehicle or HTL (20mg/kg) was given i.g. 30 min prior to ethanol. CLE was performed using the CellvizioLAB LSU F400 with Z ProFlex probe inserted i.g. and CLE images were monitored for 30 min before and after ethanol administration. Studies: 1) CLE imaging of gastric mucosa including epithelium and microvasculature; 2) vascular permeability; 3) mucosal blood flow dynamics; 4) progenitor cell integrity; 5) molecular imaging of VEGFR2 using labeled antibody; 6) detection of i.v. injected bone marrow-derived stem cells (BMDSC) in gastric mucosa. For comparison we performed quantitative histology, and transmission and scanning electron microscopy (EM). Results: At baseline, CLE of rat gastric mucosa demonstrated a normal gastric gland pattern, vasculature, continuous microvascular blood flow and low vascular permeability. Ethanol induced the exfoliation of surface epithelium within 2-3 min, followed by a 550% increase in vascular permeability (p

The root-knot nematodeMeloidogyne javanica was identified in papaya roots in Western Australia. Species identification was based on esterase isoenzyme patterns and PCR diagnostics.

Contig Reference accession (GenBank accession No.) Forward primer Reverse primer Product size (bp) 1 AW684083 CTAAGTAATTCGCTTTCACACCCC TTGGATGACACGGATGAAGA 150 2 BE124337 TGTTTCCACTTGAATCGCAG GATTTACCAACGGCGGAGT 152 3 BF641851 GAAGACACAATGAGTAGCAGAGC GGTGACACAGCAGGTGCAAT 151 4 BE325067 CACTCACACTCAACACACAACA CAAGCTTGAACCAAGCACCT 110 5 BE325413 CGCTTAACATCGCTGTCGT GGTTGTCCATGATTAGCCTCA 165 6 BF648637 TCTATTCCTTTCCGTTTCGC TTGTTCTTCCGTTCTTCGCT 154 7 BG581823 ATTCAAACAAACCCTCGCTG GAAACGCAAACCTTGGAGTC 125 Singlet AJ498090 GGGGAACACTCACTCGTTCA GAAGACATGGATCGAATGGA 184 Singlet AJ501268 CGGGGATATCCACTTGTTGT AAGGTTGCTGCTGTTGTTGA 120 Singlet AJ503505 GTGTTCGTTCGTTCAATCCC TGGCGAGTGACTTTGTAAACC 157 Singlet AW683106 GGGAAAGCAAGCACAGTAGC TGGAGTTAGTGGTAGGAAAAGG 162 Singlet AW685905 GCGAAATCTCGTAGAAAGCG TAGCAACGGACTCCCGATAC 122 Singlet AW690069 TGCTTCAAGACTACATTCCGAG TGATCTCGAACAGGTGAATCAG 142 Singlet BF648270 CCTCCAACAAAAACCACTTCC AGGATCAGCTTCTGGGTCAA 161 Singlet BQ137028 GTCGTCCGGAGATTATTTGG TGCAGAGGTGAGAGGGAGAT 186 Singlet BQ144083 TTTTTACCTCTTTGCCCGTC AAGGGGAAAGGAACAAGGAA 154

A subtractive hybridization method is described that allows the generation of a subtractive gene library from small amounts of plant or other eukaryotic tissues. The method uses paramagnetic oligo-dT beads to capture poly-adenylated mRNA and to synthesize the complementary cDNA on a solid support. The use of magnetic beads facilitates the change of reaction buffers and the removal of primers and minimizes yield losses. Subtracted material obtained from this method can either be cloned directly or used to screen a specific library.

Complete and partial genome sequences of two isolates of an unusual new plant virus, designated Donkey orchid symptomless virus (DOSV) were identified using a high-throughput sequencing approach. The virus was identified from asymptomatic plants of Australian terrestrial orchid Diuris longifolia (Common donkey orchid) growing in a remnant forest patch near Perth, western Australia. DOSV was identified from two D. longifolia plants of 264 tested, and from at least one plant of 129 Caladenia latifolia (pink fairy orchid) plants tested. Phylogenetic analysis of the genome revealed open reading frames (ORF) encoding seven putative proteins of apparently disparate origins. A 69-kDa protein (ORF1) that overlapped the replicase shared low identity with MPs of plant tymoviruses (Tymoviridae). A 157-kDa replicase (ORF2) and 22-kDa coat protein (ORF4) shared 32% and 40% amino acid identity, respectively, with homologous proteins encoded by members of the plant virus family Alphaflexiviridae. A 44-kDa protein (ORF3) shared low identity with myosin and an autophagy protein from Squirrelpox virus. A 27-kDa protein (ORF5) shared no identity with described proteins. A 14-kDa protein (ORF6) shared limited sequence identity (26%) over a limited region of the envelope glycoprotein precursor of mammal-infecting Crimea-Congo hemorrhagic fever virus (Bunyaviridae). The putative 25-kDa movement protein (MP) (ORF7) shared limited (27%) identity with 3A-like MPs of members of the plant-infecting Tombusviridae and Virgaviridae. Transmissibility was shown when DOSV systemically infected Nicotiana benthamiana plants. Structure and organization of the domains within the putative replicase of DOSV suggests a common evolutionary origin with ‘potexvirus-like’ replicases of viruses within the Alphaflexiviridae and Tymoviridae, and the CP appears to be ancestral to CPs of allexiviruses (Alphaflexiviridae). The MP shares an evolutionary history with MPs of dianthoviruses, but the other putative proteins are distant from plant viruses. DOSV is not readily classified in current lower order virus taxa.

croscopy (CLE) is a novel tool that enables in-vivo histologic imaging by detection of fluorescence. An ultrathin CLE catheter probe that inserts into a 19G FNA needle now allows for Needle-based confocal laser endomicroscopy (nCLE). This study was aimed to determine feasibility of in vivo visualization of the innervation of porcine pancreas using endoscopic ultrasound guided nCLE and a fluorescent neuronal marker; and to determine pancreatic nerve cell expression of: nerve growth factor (NGF neurotrophic factor that promotes survival of neuronal cells), its high affinity receptor Trk A and melatonin receptor 1 (MR1). Methods. Studies were performed in anesthetized pigs. NeuroTrace (fluorescent neuronal marker) was injected into pancreas tail and body using endoscopic ultrasound guided 19G FNA needle, followed by nCLE in vivo imaging (Cellvizio AQ-Flex-19, Mauna Kea Technologies, Paris, France). Pigs were then euthanized and pancreatic specimens obtained for histology, ex-vivo immunostaining and molecular imaging. Studies: 1) nCLE image analysis, 2) quantitative histology and visualization of neuronal labeling under fluorescence, 3) immunostaining and quantification for NGF, its TrkA receptor and MR1 using specific antibodies. Results: nCLE imaging visualized an extensive network of intrapancreatic ganglia and nerves labeled with NeuroTrace. There was a higher density of neural elements in the body than the tail. On histologic sections examined under fluorescence microscope, in-vivo injected NeuroTrace was localized to the neural structures and nerves in pancreatic stromal tissue with features similar to those seen on nCLE. NGF was strongly expressed in intrapancreatic neuronal cells and nerves and was also expressed in epithelial cells of pancreatic acini and endothelial cells of blood vessels. TrkA was expressed in some neuronal cells and nerves distributed throughout the acini. MR1 was expressed in about 60% of ganglion cells and nerves and also in pancreatic acini. Quantitatively its expression was 2.5fold lower (p,0.01) compared to NGF. Conclusions: 1)This study showed feasibility of in vivo visualization of neuronal network in porcine pancreas nCLE. 2)The pancreatic neural network is extensive; numerous neuronal cells express NGF, Trk A and MTR1. 3)NGF and MR1 expression in epithelial acinar cells and endothelium of blood vessels, in addition to neural structures, indicates local interactions between neural, epithelial and vascular components of pancreas.

G A A b st ra ct s clarithromycin (1μg/ml). All these 7 clarithromycin-resistant strains had the BsaI site (Figure 1). We have found mutations site at A1825G, T1834C and A2147G mutation (Figure 2). None had the new BbsI cleavage site which is characteristic of the other relatively common mutation (A2143G). The sequence of the 23S rRNA gene of the ClaR strain no 34A has been submitted and the accession No is JX827460. We introduced the PCR fragments containing the relevant mutations amplified with primer pair as listed above from the chromosomal DNA of strain 3B (ClaS strain) into H. pylori 34 and 39 (ClaR strain). The relevant mutations in both transformants were confirmed by DNA sequencing to be the same as those in the donor strain. By examining their effects in an isogenic background, it was found that the MIC of clarithromycin was the same for both transformants (4 μg/ml). Conclusion: Our results show an increasing trend of h.pylori towards dual resistance with metronidazole and clarithromycin, but maintained sensitivity towards tetracycline and amoxicillin. Clarithromycin resistance was due to mutations at site A1825G, T1834C and A2147G of 23 S rRNA gene.

We have cloned and sequenced cDNA transcribed from the 3' 1,239 nucleotides of the genomic RNA of a Western Australian isolate (MI) of bean yellow mosaic potyvirus (BYMV). This sequence contains 246 nucleotides of the NIb (replicase) gene and 819 nucleotides representing the entire coding region of the viral coat protein gene, followed by a 3' non-coding region of 174 nucleotides. The coding region of the coat protein gene is identical in length (273 amino acids) to that already reported for other isolates of this virus. The sequence identities obtained for BYMV-MI and published sequences of BYMV isolates range between 85% and 92% for the coding region of the coat protein and 90% to 98% for the 3' non-coding region. Likewise, the region of the NIb gene sequenced shows 99% and 97% sequence identity in the deduced amino acid and the nucleotide sequences, respectively.

Background: The Rome consensus guidelines are formed by an expert panel that carefully considers the available evidence. Such criteria are however necessarily based on disparate pieces of research and designed to apply to the majority of patients. The extent to which the criteria represent groupings of symptoms as they occur within individuals has not been well described. Aims: To determine whether the Rome III expert consensus guidelines compare closely to groupings of individuals that would be obtained through a natural classification system Method: Outpatients attending gastroenterology outpatient clinics (n= 1,015) completed validated symptom questionnaires that allowed assessment of Rome III criteria for functional gastrointestinal disorders (FGIDs). Latent symptom dimensions were identified using non-orthogonal factor analysis. Clusters of individuals were formed using non-hierarchical cluster analysis. Results: Cluster analysis yielded six distinct clusters of individuals. The distinguishing symptoms of each cluster and their representation of Rome III criteria were: cluster 1: fewer and harder stools when pain begins and 72% IBS including 32% IBS-C and only 2% IBS-D, cluster 2 : early satiety, postprandial fullness and loss of appetite with 73% functional dyspepsia and 49% GERD compared with overall rates of 40% and 26% respectively, cluster 3 : frequent stool, loose/watery stool, accidental leakage along with frequent and severe pain and 34% IBS-D compared with 14% overall and 26% diarrhea compared with 12% overall, cluster 4: no unusually high symptom features and lower than average on pain features and lower than average on all Rome III criteria considered, including 0% IBS. The 5th and 6th clusters did not have symptom profiles that matched the pattern of Rome III prevalence observed. Conclusions: The Rome III criteria and symptom patterns occurring naturally in groups of patients show some overlap in four clusters of individuals that represent approximately 65% of individuals. In three of these clusters there was a meaningful coincidence of IBS-C and constipation, IBS-D and diarrhea, functional dyspepsia and PDS. The fourth cluster was represented by GERD and constipation. Whether the remaining 35% of patients represent a discordance between Rome III criteria and natural symptom patterns requires further investigation.

Plants of 212 accessions from the core collection of model legume species Medicago truncatula were inoculated with infective sap containing Alfalfa mosaic virus (AMV, isolate EW), Bean yellow mosaic virus (BYMV, isolate MI) or Cucumber mosaic virus (CMV, isolate SN-1). A diverse range of systemic symptoms were obtained that varied widely in severity depending on the combination of virus isolate and accession, or, especially with AMV, some accessions became infected but did not display symptoms. The delay between virus inoculation and symptom appearance normally varied from 1 to 4 weeks, but with CMV it took up to 8 weeks in two accessions. Five (AMV), 59 (BYMV) and 22 (CMV) core accessions remained uninfected systemically. Plants of most of these accessions, and some that died or gave susceptible phenotypes, were then inoculated with two additional isolates of AMV (eight accessions), or two distinct strains of BYMV (58 accessions) and CMV (21 accessions). Plants of accession 11715 remained uninfected by CMV isolates CP (CMV subgroup 1) and LW (CMV subgroup 2), but those of all other previously uninfected accessions became infected systemically by all three viruses. All accessions inoculated with AMV isolates Aq and Hu, and most inoculated with BYMV isolate LKoj1-NN (generalist strain), BYMV isolate LP-1 (lupin strain), and CMV isolates CP and LW developed typical susceptible phenotypes. However, systemic hypersensitive phenotypes developed with BYMV LKoj1-NN and LP-1 in plants of 4456, or with LKoj1-NN only in 774, 1526, 4327, 14829, 15268, 22922 and 25654; 15268 and 25654 had developed this phenotype previously with MI (generalist strain). Similarly, plants of 21362 developed this phenotype with CMV CP and LW, while plants of 1526, 2748 and 31443 developed it with CP; 2748, 21632 and 31443 had developed it previously with SN-1 (mixture of subgroups 1 and 2). Once the genetic bases of the BYMV and CMV resistances found in M. truncatula are understood, they may prove useful in future virus resistance breeding among crop and pasture legumes.

A genetic map of barley (Hordeum vulgare L.) with 163 amplified fragment length polymorphism and 69 simple sequence repeat (SSR) markers was constructed using a population of 178 doubled haploid lines from a cross between the varieties ‘Baudin’ and ‘AC Metcalfe’. Linkage groups were assigned to barley chromosomes using published map locations of SSR markers as reference points. The total length of the map was 1307.2 cM with an average interval length of 5.6 cM between markers. The genetic map was used to locate quantitative trait loci (QTLs) for several disease resistance traits. The population was tested for spot type net blotch, caused by Pyrenophora teres f. maculata, and net type net blotch, caused by Pyrenophora teres f. teres, in greenhouse experiments and in a range of field environments in Western Australia and Queensland. The response of the lines to leaf rust (caused by Puccinia hordei L.) at adult plant growth stages was evaluated in Western Australia. Significant marker–trait associations were found for seedling resistance and symptom severity in adult plants to these diseases. A new locus conferring resistance to P. teres f. maculata at both seedling and adult plant stages was detected on the short arm of chromosome 6H. From the seedling testing against P. teres f. teres, five highly repeatable QTLs were detected, on chromosomes 2HS, 2HL, 3HS, 4HL, and 6HS. For leaf rust, one highly significant QTL was detected on chromosome 2HL. The markers within these QTL regions present an opportunity for marker-assisted selection for these traits in barley-breeding programs.

Sugar beet, Beta vulgaris L. (family Chenopodiaceae) is the major sucrose-producing crop grown in temperate zones, and contributes approximately 35% of the world’s supply, with the rest derived from sugarcane (Saccharum officinarum). The sucrose accumulates in the underground storage organ, or beet, and is extracted and purified after pulping. There are a number of targets for the genetic improvement of sugar beet (see Table 1), including improved harvesting and processing characteristics; the introduction of resistance to diseases, notably rhizomania and other viral diseases such as those caused by the beet yellows; and resistance to herbicides. However, in view of the fact that sugar beet is a biennial and highly heterozygous, being naturally cross-pollinated, conventional breeding is slow and difficult (Atanassov 1986).

BACKGROUND: FGIDs are extremely common, costly disorders yet the causal mechanisms remain unclear limiting treatment options. The role of psychological distress is controversial although brain-gut axis disturbances could explain the multi-system manifestations. Previous studies of psychological factors in FGIDs are all plagued by methodological limitations including retrospective designs, short follow-up times, potentially biased samples and usually a focus on only one type of FGID. AIM: In a 12-year longitudinal, prospective, populationbased follow-up cohort study, to determine if psychological factors are causally associated with FGIDs. We hypothesized that participants who did not report a FGID but who had high levels of psychological distress in 1997 will have an increased risk of meeting diagnostic criteria for an FGID in 2009. METHODS: Participants (n=1775) were randomly selected people from Penrith, Australia who responded to a validated survey in 1997 and agreed to be contacted for future research. Of these, n=1004 completed the 12-year follow-up survey (response rate = 64%). Healthy subjects were those people who did not meet criteria for any Rome II FGID diagnosis at baseline (n=591). The original and follow-up surveys included standardised questions allowing a Rome II diagnosis to be made for 18 FGIDs. Psychological distress (anxiety and depression) was measured with the valid Delusions Symptom States Inventory (DSSI). We also measured medication use for stomach and bowel symptoms over the past 12 years. RESULTS: Thirty five percent of controls (n=207) developed a FGID at follow-up. The most common FGIDs that controls developed at follow-up were: Functional Abdominal Bloating (FB 11%), Functional Heartburn (FH 11%), Irritable Bowel Syndrome (IBS 6%) and Functional Dyspepsia (FD 4%). Higher levels of baseline anxiety (OR (per 5 point change in scores on the DSSI scale =1.59, 95%CI 1.11-2.26, P=0.01) was a significant predictor of developing a FGID 12 years later, even after controlling for age, gender and medication use for GI symptoms. This was also true for anxiety for the development of FB (OR=1.62, 95%CI 1.04-2.52, P=0.03) and FD (OR =2.86, 95%CI 1.62-5.08, P=

Background: Ano-rectal biofeedback therapy (BFT) is a safe and effective treatment in patients with constipation. Given the high prevalence of constipation, there is a need to prioritise patients. Therefore, the aim of this study was to further explore factors which predict success or failure of BFT. Several previous studies have examined this in part, with the only consistent finding being that the patient's willingness to participate predicts success of therapy. Methods: 102 consecutive patients (mean age 48±2 yrs, 88 females) with constipation referred for anorectal BFT were evaluated. All patients completed the Rome questionnaire, a validated constipation questionnaire, and 10 cm visual analogue scales for willingness to participate in BFT, satisfaction with bowel habit and impact on quality of life. All patients underwent comprehensive anorectal manometry and balloon expulsion test. Patients were enrolled in a 6 weekly-visit BFT program. Independent predictors were identified using a bootstrapped backward elimination procedure based on linear regression with change in bowel satisfaction as the outcome. Only predictors selected in ≥50% of bootstrap samples were considered. Results: 96 patients completed the full course of BFT. Stool consistency (p=0.009), willingness to participate (p

In the Ord River irrigation area near Kununurra in the Kimberley region of Western Australia, symptoms suggestive of Bean common mosaic virus (BCMV) were found in a common leguminous weed, Macroptilium atropurpureum (siratro). Virus from one M. atropurpureum plant and an isolate from Phaseolus vulgaris (common bean) identified previously as BCMV based on genome fragment sequencing and host range, were both transmitted to Nicotiana benthamiana, Chenopodium amaranticolor and C. quinoa by sap inoculation, giving symptoms typical of BCMV.Reciprocal inoculations with infective N. benthamiana sap indicated that both source plants contained the same virus species and reproduced field symptoms consistent with BCMV in both original hosts. Complete (10 054 nucleotide) and partial (∼8400 nucleotide) sequences were determined for two sub-isolates MS1 and NWA-1, respectively, using reverse transcription—polymerase chain reaction assays. Both sub-isolates were from a N. benthamiana plant containing a BCMV isolate originally from a single M. atropurpureum plant. Their nucleotide sequences were aligned with those of four complete and three partial BCMVgenome sequences, and their coat protein amino acid sequences were aligned with those of 17 other BCMV isolates. The results from the genomic and coat protein analyses show that the two M. atropurpureum sub-isolates were closely related to BCMV isolates reported previously from North and South America.

Cross sections have been measured for proton emission following ${\mathrm{\ensuremath{\pi}}}^{+}$ absorption on $^{6}\mathrm{Li}$, $^{7}\mathrm{Li}$, $^{9}\mathrm{Be}$, $^{10}\mathrm{B}$, $^{11}\mathrm{B}$, $^{12}\mathrm{C}$, and $^{13}\mathrm{C}$, for pion kinetic energies of 50, 100, 140, and 180 MeV using a large-solid-angle bismuth germanate detector array.

Mitochondrial (mt) DNAs of somatic hybrids obtained by electrical and chemical fusion of mesophyll protoplasts of S. brevidens and a dihaploid line of S. tuberosum PDH 40 were analysed by Southern hybridization using the digoxigenin-labelled mtDNA sequences nad5 or orf25. In the Southern analysis of the hybrid mtDNA probed with nad5, most of the 19 hybrids analyzed had an RFLP pattern similar, but not identical, to one of the parents, S. tuberosum, PDH40. Nineteen percent of the hybrids had most of the S. brevidens fragments. Five of the hybrids had an identical RFLP pattern to either one of the parents while another two hybrids had novel RFLP patterns. Similar results were obtained by Southern analysis with orf25. These results clearly show that mtDNA rearrangements had occurred at a high frequency in the somatic hybrids. There were no differences in the frequencies of rearrangements observed between the hybrids regenerated from chemical and electrical fusions.

Asymmetric somatic hybrids were obtained by fusion of Solanum tuberosum (PDH40) protoplasts with 300- or 500-Gy irradiated protoplasts of S. brevidens. These radiation doses were sufficient to prevent the growth of the S. brevidens protoplasts. Putative hybrids were selected on the basis of phenotype from regenerated shoots and identified with a S. brevidens-specific probe. From these, 31 asymmetric hybrids were confirmed by morphological characteristics, isoenzyme patterns and RFLP analysis. The morphology of the asymmetric hybrids was intermediate between that of S. tuberosum and symmetric hybrids of both species (obtained without irradiation treatment). Chromosome counts from 17 asymmetric hybrids showed that the chromosome number of the hybrids ranged from 31 to 64. The asymmetric hybrids probably had one or two genome complements (i.e. either 24 or 48 chromosomes) from S. tuberosum and 7-22 chromosomes from S. brevidens. There was no clear correlation between the radiation dose and the degree of elimination of the S. brevidens genome.

Subterranean clover mottle virus (SCMoV), which causes an important disease of annual clover pastures, was inoculated to the annual pasture legume Medicago truncatula, a model legume species used to help understand legume genome structure and function. Two hundred and nine accessions representing the core collection of M. truncatula were inoculated with infective sap containing SCMoV to determine their disease phenotypes. Forty-two of these accessions remained uninfected systemically and so were potentially resistant to the virus. Accession DZA315.16 developed a localised hypersensitive resistance reaction. In an F8 mapping population from a cross between the susceptible parent Jemalong 6/A17 and resistant accession DZA315.16, a total of 166 F8 recombinant inbred lines (RILs) were phenotyped for resistance and susceptibility to SCMoV. Resistant and susceptible lines showed parental phenotypic responses: 84 were susceptible and 82 were resistant, suggesting presence of a single resistance (R) gene. The phenotypic data were combined with genotypic data (76 polymorphic molecular markers) for this RIL population to provide a framework map. Genetic analysis located a single resistance locus termed RSCMoV1 on the long arm of chromosome 6. These results provide a basis for fine mapping the RSCMoV1 gene.

A series of experiments was carried out to investigate the nature of the resistance of the wild potato species, Solanum brevidens, to potato virus X (PVX) and potato virus Y (PVY). In vitro inoculation of leaf protoplasts of S. brevidens and the virus-susceptible dihaploid S. tuberosum genotype PDH40 with PVX or PVY using polyethylene glycol showed that protoplasts of both species were similar in susceptibility. However, examination of protoplasts prepared from the leaves of S. tuberosum and S. brevidens inoculated 2 to 5 weeks earlier showed that the percentage of PVX- and PVY-infected leaf cells of S. tuberosum were, respectively, 45- to 100-fold and about 1000-fold greater than the percentage of infected leaf cells of S. brevidens. These results suggest that resistance in S. brevidens to both PVX and PVY could be associated with slow cell-to-cell spread rather than with slow virus replication.

There are many potentially useful applications of protoplast fusion, in both somatic cell genetics and in biotechnology [eg 1,2]. The two main approaches to fusing plant protoplasts are based either on chemical or electrical procedures. Chemical fusion of protoplasts will be described elsewhere in this volume [3]. Given the availability of suitable equipment, the advantage of electrofusion, a physical approach, over chemical fusion is that it is rapid, simple, synchronous and more easily controlled, and the use of high concentrations of potentially cytotoxic chemical fusogens are avoided [4]. In this chapter electrical approaches to fusion are described.

Protoplasts have been isolated from three tuber-bearing Solanum species, S. hjertingii, S. polyadenium and S. capsicibaccatum, that are sexually incompatible with S. tuberosum, but possess potentially useful characters. For isolating protoplasts from leaves of in vitro shoot cultures of S. hjertingii and S. capsicibaccatum growth was improved by including silver thiosulfate in the medium. However, for S. polyadenium, leaves of pot-grown plants were the best source for protoplasts. Following protoplast division and culture, plants were regenerated from protoplasts of each of the species. The pattern of chromosome variation in regenerants was similar to that observed for other diploid and tetraploid Solanum species. The results indicate that it should be possible to introduce the potentially useful germplasm from these wild species into somatic hybrids with S. tuberosum by protoplast fusion.

To understand and apply the technology of protoplast fusion, it is useful to study populations of somatic hybrid plants produced rather than just those hybrids which have the desired properties. This enables a more complete picture of the processes involved to be built up, and any limitations to the approach to be assessed realistically.

Vigna unguiculata var. sesquipedalis (snakebean) and Lycopersicon esculentum (tomato) plants with phytoplasma-like symptoms were found in the horticultural region in Broome, Western Australia. The symptoms on snakebean included ‘witches’ broom’ and proliferation of small leaves, and on tomato they varied from phyllody and ‘big bud’ to ‘witches’ broom’ and proliferation of small leaves. Using universal primers for phytoplasmas, the complete 16S rRNA gene and intergenic spacer region, and part of the 23S rRNA gene were amplified by PCR. Sequence analysis identified that the agent associated with the symptoms was a strain of sweet potato little leaf strain V4 (SPLL-V4) phytoplasma (16SrII group, strain of ‘Candidatus Phytoplasma australiense’). SPLL phytoplasma has not been reported before in snakebean or tomato in this isolated agricultural region.

Plants of red clover (Trifolium pratense), several other pasture legumes and paddy melon (Cucumis myriocarpus) with symptoms of diminished leaf size, pallor, rugosity, leaf deformation, shoot proliferation and stunting were observed amongst pasture plots growing at a site in south-west Australia. When tested using PCR, diseased samples from all species with these symptomswere positive for a phytoplasma resembling ‘Candidatus Phytoplasma australiense’. This association was confirmed for red clover and paddy melon by subsequent nested PCR and sequence analysis. This is the first time that ‘Ca. Phytoplasma australiense’ has been reported infecting these hosts.

2002). The disease it causes decreasescrop production. In Australia, BCMV has been reportedin New South Wales, Queensland, Tasmania and Victoria,based on serology and amino acid composition (Moghal& Francki, 1976, 1981). However , there is no informationabout isolates or their origin, and no further confirmation,or any sequence data for BCMV from Australia. It has notbeen reported in the Northern Territory, South Australiaor Western Australia.In July 2004, at Kununurra in the east Kimberly regionof Western Australia

Meloidogyne javanica and two undescribed phenotypes/species of root-knot nematodes are recorded for the first time in Paulownia plantations in Western Australia.

Chickpeas growing in the agricultural region of Kununurra, Western Australia, were found with symptoms of leaf stunting, little leaf and proliferating branches. Deoxyribonucleic acid was extracted from symptomatic and asymptomatic plants and tested for phytoplasma by PCR. The PCR product from symptomatic leaves was sequenced and confirmed the presence of a phytoplasma with high similarity to the 16SrII group ‘Candidatus Phytoplasma aurantifolia’. This is the first molecular evidence for a phytoplasma-associated disease in chickpea.