Search

Objective: To investigate the long-term prognosis of Second generation drug-eluting stents(G2-DES) in diabetic mellitus(DM) and non-DM patients. Methods: Patients with coronary heart disease(CHD) in Fuwai Hospital from January 2013 to December 2013 who had exclusively G2-DES implantation, were consecutively included the follow-up period was 2 years. Results: A total of 6 094 patients with CHD were implanted with G2-DES, of which 1 862 patients with DM, and 4 232 patients without DM.The proportion of DM patients receiving G2-DES implantation with the following characteristics: advanced age, female, hypertension, hyperlipidemia, history of previous stroke, history of peripheral artery disease, previous history of PCI, and with triple vessel, high preoperative Syntax score, high number of target lesions, B2 or C type lesions, severe calcification lesions, and chronic occlusive disease were significantly higher than those of non-DM patients( P <0.05). The incidence of major adverse cardiac and cerebral vascular events(MACCE), target vascular revascularization(TVR) and target lesion revascularization(TLR) were higher in DM patients than in non-DM patients during 2 year's follow-up( P <0.05). The univariate COX regression analysis showed that diabetes was risk factor for MACCE in patients with CHD implanting G2-DES( HR =1.241, 95% CI : 1.053-1.463, P =0.010). However, multivariable COX analysis showed that DM was not an independent risk factor for MACCE in CHD patients with G2-DES( HR =1.125, 95% CI : 0.952-1.330, P =0.167). While age, female, preoperative Syntex score, triple vessel, B2 or C lesion were independent risk factors for poor clinical prognosis in CHD patients with G2-DES. Conclusions: (1) CHD patients with DM often accompany more clinical risk factors and complicated coronary lesions; (2) the incidence of MACCE, TVR and TLR in DM patients is significantly higher than non-DM patients with G2-DES during the 2 year's follow-up; (3) after multivariate adjustment, DM is not an independent risk factor for poor clinical prognosis in CHD patients with G2-DES, while traditional risk factors and complex coronary lesions are independent risk factors for poor clinical prognosis.

Objective: To reveal the genetic characteristics of erythrocyte membrane protein in hereditary spherocytosis (HS) in China. Methods: Next-generation sequencing technology was used to detect mutations in genes of erythrocyte membrane proteins in 51 clinically diagnosed HS patients. The relationship between gene mutations and clinical phenotypes was analyzed. Results: Mutations in erythrocyte membrane protein genes were detected in 37 patients, including 17 with ANK1 mutations (17/37, 45.9%), 14 with SPTB mutations (14/37, 37.8%), and 5 with SLC4A1 mutations (5/37, 13.5%). One patient carried both heterozygous ANK1 mutation and SPTB mutation (1/37, 2.7%). SPTA1 and EPB42 mutation was not fou nd in any patient. Nonsense mutations (36.8%) and missense mutations (31.6%) were most common. Of the 38 mutations detected, 34 were novel mutations and have not been reported elsewhere (89.5%). Sixteen HS patients underwent parental genetic validation, 6 patients (37.5%) inherited gene mutation from parents and 10 (62.5%) were de novo . The peripheral blood cell parameters of HS patients were not related to the mutant genes and gene mutation types. However, it seems that HS patients with mild clinical status are prone to carry SPTB mutations while more patients with severe clinical status have ANK1 mutations. Conclusions: ANK1 and SPTB are the most common mutant genes in Chinese HS patients, mainly with missense mutations and nonsense mutations. There was no significant correlation between the mutation of HS related genes and the severity of HS.

Objective: To investigate the clinical features and change trend of patients with acute coronary syndrome(ACS) undergoing emergent percutaneous coronary intervention(PCI). Methods: In this retrospective study, we retrieved all medical records of 4 907 ACS patients who underwent emergent PCI in Fuwai hospital from January 1,2010 to December 31,2016. We analyzed the clinical features and change trend in these patients. According to clinical diagnosis, patients were grouped as ST-elevated myocardial infarction(STEMI) group (3 719 cases) and NSTE-ACS group (patients with non-STEMI and unstable angina, 1 188 cases). Results: The ACS patients were aged (59.5±11.8) years old. There were 3 772 males and 1 135 females. The annual number of ACS patients underwent emergent PCI increased from 412 patients in 2010 to 1 067 patients in 2016. The number of NSTE-ACS patients increased from 11.4% (47/412) in 2010 to 26.5% (283/1 067) in 2016. Compared with STEMI group, patients in NSTE-ACS group were significantly older ((61.2±10.9) years old vs. (58.9±12.1) years old, P< 0.01).The percent of female patients (30.1% (358/1 188) vs. 20.9% (777/3 719), P < 0.01), history of hypertension (69.1% (821/1 188) vs. 60.4% (2 248/3 719, P <0.01), previous PCI (25.8% (307/1 188) vs. 12.4% (461/3 719), P <0.01), and previous coronary artery bypass grafting (3.0% (36/1 188) vs. 1.0% (37/3 719), P <0.01) were all significantly higher in NSTE-ACS group than in STEMI group. On the other hand, NSTE-ACS patients presented less chronic renal failure (2.9% (35/1 188) vs. 4.3% (173/3 719), P <0.05) and hepatic dysfunction (8.5% (101/1 188) vs. 13.3% (495/3 719), P <0.01) as compared to ACS patients. In coronary angiography, NSTE-ACS patients had a higher prevalence of left-main disease (14.0% (166/1 188) vs. 7.8% (291/3 719), P <0.012 5) and triple vessel disease (47.8% (568/1 188) vs. 43.5% (1 619/3 719), P <0.012 5). There were no differences in prevalence of diabetes mellitus (31.9% (1 187/3 719) vs. 34.8% (414/1 188), P> 0.05) and acute renal failure (0.1% (38/3 719) vs. 0.6% (7/1 188), P> 0.05) between STEMI group and NSTE-ACS group. Conclusions: This single center retrospective analysis reveals that there is an increasing trend of NSTE-ACS patients from 2010 to 2016. Furthermore, there are more high-risk clinical characteristics in NSTE-ACS patients than in STEMI patients.

Background: Thrombocytopenia is a frequently encountered phenomenon during intra-aortic balloon pumping (IABP), which may limit its prolonged utilization. The aim of the study was to explore the risk factors and clinical implications of IABP-associated thrombocytopenia in patients with acute coronary syndrome (ACS)., Methods: We retrospectively analyzed the data of 222 patients with ACS undergoing invasive treatment strategy supported by IABP. The incidence and risk factors of IABP-associated thrombocytopenia, and the association between thrombocytopenia and relevant clinical endpoints (in-hospital death, bleeding according to the TIMI scale, and thromboembolic events), were analyzed., Results: IABP-associated thrombocytopenia was observed in 54.5% (121/222) of the patients. The incidence of thrombocytopenia was higher and the magnitude of reduction in platelet count was greater in the Arrow balloon group (n = 89) compared with the Datascope balloon group (n = 133; 68.5% vs. 45.1%, p = 0.001; 48.7% vs. 33.2%, p < 0.001; respectively). Independent predictors of thrombocytopenia included older age and Arrow balloon utilization (odds ratio [OR]: 1.054; 95% confidence interval [CI]: 1.028-1.080; p<0.001; OR: 2.468; 95%CI: 1.375-4.431; p = 0.002; respectively). The incidence of in-hospital death was higher in patients who developed thrombocytopenia than those who did not (9.1% vs. 2.0%, p = 0.041), and thrombocytopenia was correlated with in-hospital death (OR: 5.932; 95%CI: 1.221-28.822; p = 0.027). However, the rates of TIMI bleeding and thromboembolic events were similar between the two groups (5.8% vs. 5.0%, p = 1.000; 3.2% vs. 6.0%, p = 0.518; respectively), and thrombocytopenia was not associated with TIMI bleeding or thromboembolic events (OR: 0.940; 95%CI: 0.267-3.307; p = 0.923; OR: 0.541, 95%CI: 0.148-1.974, p = 0.352; respectively)., Conclusion: IABP-associated thrombocytopenia occurred in 54.5% of patients with ACS undergoing an invasive strategy and it was correlated with increased in-hospital mortality. Older age and use of the Arrow balloon may predict IABP-associated thrombocytopenia.

Objective: This study sought to evaluate the safety and efficacy of FIREHAWK, a novel abluminal groove-filled biodegradable polymer sirolimus-eluting stent (SES) in patients with moderate-complex coronary lesions (including patients with small vessel disease, long lesion and multi vessel disease), and to validate the ability of the SYNTAX score (SS) to predict clinical outcomes in patients treated with FIREHAWK stent. Methods: TARGETⅡ was a prospective, multicenter, single-arm clinical trial, a total of 730 patients who underwent percutaneous coronary intervention (PCI) of de novo lesions in native coronary arteries in 24 medical centers in China from August 2011 to February 2012 were enrolled in this study. All patients were exclusively treated with the FIREHAWK stent. Clinical data including patients with diabetes, small vessel disease, long lesion and multi vessel disease were analyzed. The primary composite endpoint was the target lesion failure (TLF) of cardiac death, target vessel-related myocardial infarction (TV-MI), or target lesion revascularization (TLR). The secondary composite endpoint was patient-oriented endpoint (PoCE), a composite of all death, all myocardial in farction (MI), or any repeat revascularization; definite/probable stent thrombosis (ST) (including acute, late, and very late thrombosis) . SS was calculated in lesions with stenosis more than 50% with coronary artery diameter greater than 1.5 mm. Patients were grouped by tertiles of SS (≤7, >7 to ≤12, >12). Follow-up was performed up to 5 years. Results: A total of 730 patients were enrolled in the TARGET Ⅱ trial. The average SS was 10.9±6.9. 683 (93.6%) patients completed 5-year clinical follow-up. The 5-year incidence of TLF was 8.5%(58/683). The incidence of TLF components was as follows: cardiac death 2.0%(14/683), TV-MI 4.4%(30/683), TLR 3.4%(23/683). The incidence of PoCE was 16.4%(112/683). The incidence of definite/probable stent thrombosis was 0.7%(5/683).Multivariable Cox regression analysis showed that the diabetes subgroup ( HR =1.123, 95% CI 0.623-2.026, P= 0.699), the small vessel disease subgroup ( HR =0.909, 95% CI 0.526-1.570, P= 0.732), the long lesion subgroup ( HR =1.561, 95% CI 0.922-2.640, P= 0.097), and the multi vessel disease subgroup ( HR =1.062, 95% CI 0.611-1.846, P= 0.830) did not increase the HR of TLF compared with the counterpart subgroups. Multivariable Cox regression analysis showed that the hazard of TLF was not increased in the middle and high SS groups as compared with the low SS group ( HR =1.203,95% CI 0.607-2.385, P= 0.597; HR =1.548,95% CI 0.829-2.892, P= 0.171). Conclusions: The 5 years follow-up results of TARGET Ⅱ trial shows that the biodegradable polymer of FIREHAWK stents have long-lasting safety and efficacy for patients with moderate-complex coronary lesions. SS is not the predicting factor for the occurrence of TLF in FIREHAWK treated patients with moderate-complex coronary lesions. Trial Registration Clinical Trials.gov, NCT0141264.

We report measurements of the nuclear modification factor R&#95;{CP} for charged hadrons as well as identified π^{+(-)}, K^{+(-)}, and p(p[over ¯]) for Au+Au collision energies of sqrt[s&#95;{NN}]=7.7, 11.5, 14.5, 19.6, 27, 39, and 62.4 GeV. We observe a clear high-p&#95;{T} net suppression in central collisions at 62.4 GeV for charged hadrons which evolves smoothly to a large net enhancement at lower energies. This trend is driven by the evolution of the pion spectra but is also very similar for the kaon spectra. While the magnitude of the proton R&#95;{CP} at high p&#95;{T} does depend on the collision energy, neither the proton nor the antiproton R&#95;{CP} at high p&#95;{T} exhibit net suppression at any energy. A study of how the binary collision-scaled high-p&#95;{T} yield evolves with centrality reveals a nonmonotonic shape that is consistent with the idea that jet quenching is increasing faster than the combined phenomena that lead to enhancement.

Objective: To investigate the association between high-sensitivity C-reactive protein (hs-CRP) and long-term outcomes in Chinese patients with non-ST-segment elevation acute coronary syndrome (NSTE-ACS) after drug-eluting stent (DES) implantation. Methods: A total of 4 815 consecutive NSTE-ACS patients who treated with DESs were included.Patients were divided into three groups: <1.00 mg/L, 1.00 to 2.99 mg/L and ≥3.00 mg/L, based on the level of hs-CRP on admission.Major adverse cardiovascular and cerebrovascular events (MACCE, including all-cause death, myocardial infarction, revascularization, in-stent thrombosis and stroke) were compared among groups during 2-year follow-up. Results: Patients with higher hs-CRP had more risk factors of cardiovascular events such as concomitant morbidities and multi-vessel lesions(68.5% vs 73.6% vs 76.2%, P <0.001). Higher hs-CRP value was associated with increased rates of MACCE (8.8% vs 11.2% vs 12.6%, P =0.003) and revascularization (6.5% vs 8.5% vs 9.8%, P =0.003). However, the rates of all-cause death, myocardial infarction, stroke, and stent thrombosis were comparable among groups(all P >0.05). Ongoing divergences in MACCE and revascularization among three groups were significant on Kaplan-Meier curves (both Log-rank P =0.003). Multivariable Cox regression analysis indicated that compared to hs-CRP<1.00 mg/L group, MACCE in the >3.00 mg/L group was increased by 42% [ HR 1.42 (1.13-1.78), P =0.002]. Meanwhile, multivessel leisions, ejection fraction<50%, elevated white blood cell counts were also independent risk factors.CRP≥3.00 mg/L( HR 1.56, 95% CI 1.16-2.08, P =0.003, compared to <1.00 mg/L) and multivessel leisions were independent predictors of revascularization. Conclusions: (1)Patients with higher hs-CRP on admission have more risk factors of cardiovascular events.(2)Higher hs-CRP value is associated with increased rates of MACCE and revascularization.(3)Pre-procedural hs-CRP is an independent predictor of 2-year outcomes for Chinese NSTE-ACS patients treated with DESs.

Clinical data of 19 patients with congenital pyruvate kinase deficiency were analyzed. Insufficient pyruvate kinase confirmed the diagnosis. Laboratory parameters of hemolysis were summarized. In cases of neonatal hyperbilirubinemia and unexplained hemolytic anemia, pyruvate kinase activity and next generation sequencing test may help the early diagnosis.

The accelerator driven subcritical system (ADS) is regarded as a safe and clean nuclear power system, which can be used for the transmutation of nuclear waste and the breeding of nuclear fuel. In this study, in order to validate nuclear data and the neutron transportation performance of the materials related to ADS, we measured the leakage neutron spectra from multiple-slab sample assemblies using 14.8 MeV D-T neutrons. Two types of assemblies comprising A-1 (W+U+C+CH 2 ) and A-2 (U+C+CH 2 ) were both built up gradually starting with the first wall. The measured spectra were compared with those calculated using the Monte Carlo code neutron transport coed (MCNP)-4C. A comparison of the results showed that the experimental leakage neutron spectra for both A-1 or A-2 were reproduced well by the three evaluated nuclear data libraries with discrepancies of less than 15% (A-1) and 12% (A-2), except when below 3 MeV. For 2-cm and 5-cm uranium samples, the CENDL-3.1 calculations exhibited large discrepancies in the energy range of 2-8 MeV and above 13 MeV. Thus, the CENDL-3.1 library for uranium should be reevaluated, especially around this energy range. It was significant that the leakage neuron spectra changed clearly when the latest material layer was added during the building of assemblies A-1 and A-2., (Copyright © 2018 Elsevier Ltd. All rights reserved.)

Objectives: To introduce real-time polymerase chain reaction （real-time PCR） into the initial sample screening, to improve the effectiveness of traditional trace sample extraction method., Methods: Serial diluted 9947A was quantified using a Rotor-Gene Q real-time RT-PCR, and the genotype was determined with AmpFℓSTR TM Identifiler TM Plus PCR kit. Thus a quantitative threshold model was built to obtain complete STR typing from the trace samples. In addition, 903 trace samples were used to verify the reliability., Results: When the samples quality concentration was >0.03 ng/μL, the effective STR typing could be directly obtained; when the concentration was >0.01 and ≤0.03 ng/μL, the effective STR typing could be directly obtained by optimizing the PCR thermal cycle parameters （30 cycles）; and when the concentration was ≤0.01 ng/μL, no effective map could be obtained even if PCR was optimized., Conclusions: The real-time PCR quantitative threshold model is effective for the screening of trace samples., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Editorial Department of Journal of Forensic Medicine.)

Background: Fas-associated protein with death domain (FADD) is a classic adaptor protein in apoptosis. Increasing evidence has shown that FADD is also implicated in T-cell development, activation and proliferation. The role of FADD in inflammatory disorders remains largely unexplored., Aim: To assess the role of FADD in inflammatory disorders., Methods: We established an experimental model of contact hypersensitivity (CHS) by using 2,4,6-trinitrochlorobenzene (TNCB) on transgenic mice expressing a dominant negative mutant of FADD (FADD-DN), RESULTS: CHS responses were clearly attenuated in FADD-DN mice compared with control mice. In the retroauricular lymph nodes, the ratio of CD8+ T cells was also decreased., Conclusion: FADD-DN appears to play a protective role in TNCB-induced CHS reactions., (© 2017 British Association of Dermatologists.)

Objective: To investigate the impact of direct bilirubin on long-term prognosis of acute coronary syndrome (ACS) patients post percutaneous coronary intervention(PCI). Methods: As a prospective and observational cohort study, a total of 6 431 consecutive ACS patients underwent PCI from January to December 2013 in Fuwai hospital were included. Patients were divided into 3 groups according to tertiles values of direct bilirubin as follows: low direct bilirubin group(<2.2 μmol/L, n= 2 219), moderate direct bilirubin group(2.2-3.0 μmol/L, n= 2 016), and high direct bilirubin group(>3 μmol/L, n= 2 196). The clinical characteristics were compared among the 3 groups, and the impact of direct bilirubin on clinical adverse events (main adverse cardiovascular and cerebrovascular events included cardiogenic death, myocardial infarction, revascularization, stroke, and stent thrombosis) were analyzed at 2 years after PCI. Results: (1) Percent of male patients was 66.5%(1 475/2 219), 78.0%(1 572/2 016), and 86.2%(1 892/2 196), body mass index was(25.7±3.1), (26.0±3.3),and (26.0±3.2) kg/m(2), the ratio of the history of old myocardial infarction was 11.9%(264/2 219), 13.0%(263/2 016),and 14.9%(328/2 196), the ratio of the current smoker was 56.3%(1 249/2 219), 59.1%(1 192/2 016),and 60.0%(1 317/2 196) in low, moderate and high direct bilirubin groups respectively, and the differences were statistically significant ( P <0.01 or 0.05). (2) Two years after PCI, the all-cause mortality was 0.8%(17/2 219), 1.8%(36/2 016), and 1.5%(33/2 196) ( P= 0.011),the cardiogenic mortality was 0.5%(12/2 219), 1.3%(26/2 016), and 0.6%(13/2 196) ( P= 0.010),the ratio of myocardial infarction was 2.2%(49/2 219), 2.4%(49/2 016), and 1.4%(31/2 196)( P= 0.044),the ratio of revascularization was 8.8%(195/2 219), 8.3%(168/2 016),and 8.9%(196/2 196)( P= 0.783),the ratio of stroke was 1.4%(30/2 219),1.1%(22/2 016), and 1.9%(42/2 196)( P= 0.076),the ratio of stent thrombosis was 0.9%(19/2 219), 1.2%(24/2 016),and 0.7%(15/2 196)( P= 0.210) in low, moderate and high direct bilirubin groups, respectively. (3) Multivariable Cox regression analysis showed that, patients in moderate direct bilirubin group faced increased the risk of all-cause mortality compared with patients in the low direct bilirubin group ( HR =2.23, 95% CI 1.23-4.05, P= 0.009), and the risk of all-cause mortality was similar between high direct bilirubin group and low direct bilirubin group ( HR =1.84, 95% CI 0.99-3.38, P= 0.051). There were no statistically significant difference in the risks of main adverse cardiovascular and cerebrovascular events,cardiogenic death, myocardial infarction, revascularization, stroke, and stent thrombosis in moderate and high direct bilirubin groups compared with low direct bilirubin group (all P >0.05). Conclusion: Moderate direct bilirubin level is associated with increased risk of all-cause death at 2 years after PCI compared with low level of direct bilirubin group.

Objective: To evaluate the impact of the targeted next-generation sequencing (NGS) assay for difficult congenital anemias. Methods: Blood Disease Hospital Anemia Panel 2014 (BDHAP-2014) including 217 known genes of congenital anemias was developed. NGS and parental verification were performed for patients who were suspected diagnosed with congenital anaemia from August 2014 to July 2017. Results: A total of 46 patients were enrolled in this study, the clinical suspection were 11 cases Fanconi anemia (FA), 8 cases congenital dyserythropoietic anemia (CDA), 6 cases congenital sideroblast anemia (CSA), 12 cases congenital hemolytic anemia (CHA), 1 case dyskeratosis congenital (DC), 4 cases iron-refractory iron deficiency anemia and 4 cases unexplained cytopenia (Uc), respectively. 28 (60.9%) of 46 patients became confirmed cases after targeted NGS, corresponding to 44 mutations of which 33 were new. 26(56.5%) patients with results of the assay matching to clinical suspection, including FA (5/11, 45.5%), CSA (6/6, 100.0%), CDA (3/8, 37.5%) and CHA (12/12, 100.0%). 2 (4.3%) cases not matching to clinical suspection, including dyskeratosis congenital (DC) was made in 1(2.2%) patients with suspected FA and familial hemophagocytic lymphohistiocytosis (FHL) was made in 1(2.2%) patients with suspected unexplained cytopenia (Uc). In 12 CHA patients, the hemolytic type was further clarified by the NGS. The remaining 18 cases were not clearly diagnosed. Conclusion: Targeted NGS assay is of major impact on congenital anemias. The assay should be used routinely in congenital anemias.

Airborne pathogens commonly trigger severe respiratory failure or death in smokers with lung disease. Cigarette smoking compromises the effectiveness of innate immunity against infections but the underlying mechanisms responsible for defective acquired immune responses in smokers remains less clear. We found that mice exposed to chronic cigarette smoke recovered poorly from primary Influenza A pneumonia with reduced type I and II interferons (IFNs) and viral-specific immunoglobulins, but recruited γδ T cells to the lungs that predominantly expressed interleukin 17A (IL-17A). Il-17a -/- mice exposed to smoke and infected with Influenza A also recruited γδ T cells to the lungs, but in contrast to wild-type mice, expressed increased IFNs, made protective influenza-specific antibodies, and recovered from infection. Depletion of IL-17A with blocking antibodies significantly increased T-bet expression in γδ T cells and improved recovery from acute Influenza A infection in air, but not smoke-exposed mice. In contrast, when exposed to smoke, γδ T cell deficient mice failed to mount an effective immune response to Influenza A and showed increased mortality. Our findings demonstrate a protective role for γδ T cells in smokers and suggest that smoke-induced increase in IL-17A inhibits the transcriptional programs required for their optimal anti-viral responses. Cigarette smoke induces IL-17A expression in the lungs and inhibits γδ T-cell-mediated protective anti-viral immune responses.

Objective: To evaluate the predictive value of GRACE discharge score on the long-term out-of-hospital coronary thrombotic events (CTE) after percutaneous coronary intervention (PCI) with drug-eluting stents. Methods: Present study was a prospective, observational, single center study. 10 724 consecutive patients underwent PCI in Fuwai Hospital between January and December 2013 were included, stents were implanted with conventional method. After PCI, patients were prescribed aspirin 100 mg once daily indefinitely, and either clopidogrel 75 mg once daily or ticagrelor 90 mg twice daily for at least 1 year. A total of 9 782 patients were included in the final analysis after excluding patients who did not undergo successful stent implantation, who were not discharged on dual anti-platelet therapy (DAPT), who only underwent bare-metal stents, who experienced in-hospital major bleeding, stent thrombosis, myocardial infarction (MI) or death,and who lost follow up. Clinical data were collected from all patients. 9 543 patients with complete baseline data were further analyzed for risk stratification and predictive value of GRACE discharge score. CTE was defined as stent thrombosis or spontaneous myocardial infarction. All patients were followed through Fuwai Hospital Follow-up Center, and evaluated either by phone, letter, or clinic visits or at 1, 6, 12 and 24 months after PCI. Risk stratification was performed according to the GRACE discharge score, and the predictive value of the GRACE discharge score was assessed using the receiver operating characteristic (ROC) curve. Results: After 2 years follow-up, there were 95 CTE among the 9 782 patients. The patients were divided into 2 groups according to the presence or absence of CTE: CTE group (95 cases) and no CTE group (9 687 cases). GRACE discharge score was significantly higher in CTE group than no CTE group (82.98±27.58 vs. 75.51±22.46, t =-2.57, P= 0.012). According to risk stratification of GRACE discharge score, the patients were divided into low-risk (≤88) group ( n= 6 902), moderate-risk (89-118) ( n= 2 988) and high-risk (>118) ( n= 343) groups. As compared to the low-risk group, CTE risk in moderate- and high-risk groups was 1.59 times ( HR 1.59, 95% CI 1.01-2.52, P= 0.046) and 3.89 times higher ( HR 3.89, 95% CI 1.98-7.65, P< 0.001), respectively. Further analysis showed that the GRACE score had predictive value in the total cohort for CTE (area under the receiver operating characteristic (AUROC) 0.576, 95% CI 0.512-0.640, P= 0.012) and in the acute coronary syndromes(ACS) subgroup for CTE: (AUROC 0.594, 95% CI 0.509-0.680, P= 0.019), but not in the non-ACS subgroup: (AUROC 0.561, 95% CI 0.466-0.657, P= 0.187). Conclusion: GRACE discharge score can predict the long-term out-of-hospital CTE in patients undergoing PCI with drug-eluting stents and treated with DAPT, and patients can be stratified into the low-, moderate- and high-risk groups of CTE by the GRACE discharge score.

Objective: To investigate the long-term prognosis of coronary artery disease with atrial fibrillation (AF) after percutaneous coronary intervention (PCI). Methods: A total of 10 724 patients with PCI were enrolled in 2013, and 2-year clinical outcomes in patients with AF (AF group) and without AF (non-AF group) were compared. Results: A total of 113 patients were with AF (1.1%), and 8 out of them were on triple antithrombotic therapy (9.5%), and AF group patients were with more complications. The 2-year follow-up results showed that the all-cause mortality in AF group was significantly higher than that in non-AF group (9.7% vs 1.1%; P <0.001). The incidence of cardiac death, stent thrombosis and stroke was also significantly higher in patients with AF. The incidence of major adverse cardiac and cerebrovascular events (MACCE) was also significantly higher in AF group compared with non-AF group (17.7% vs 8.8%; P <0.001), whereas the incidence of revascularization was significantly lower in the AF group than in the non-AF group (2.7% vs 8.7%; P =0.023). The incidence of myocardial infarction and bleeding had no significant difference between the two groups, and the adverse events between the two groups had no significant difference after propensity score (PS) either. Conclusions: The 2-year clinical follow-up of single-center, large-sample PCI patients shows poor prognosis in patients with AF compared with the non-AF patients. But there is no difference in the prognosis between the two groups after PS, however, this conclusion still needs to be confirmed by randomized controlled studies.

SRY (sex determining region Y)-box 9 (SOX9) is required for oncogenic Kras-mediated acinar-to-ductal metaplasia (ADM), pancreatic intraepithelial neoplasias (PanINs) and ultimately pancreatic ductal adenocarcinoma (PDAC). However, how oncogenic Kras affects SOX9 activity is not yet understood, and SOX9-associated genes in PDAC are also unknown at all. Here, we investigated the mechanistic link between SOX9 and oncogenic Kras, studied biological function of SOX9, and identified SOX9-related genes and their clinical significance in patients with PDAC. Our studies reveal that oncogenic Kras induces SOX9 mRNA and protein expression as well as phosphorylated SOX9 expression in human pancreatic ductal progenitor cells (HPNE) and pancreatic ductal cells (HPDE). Moreover, oncogenic Kras promoted nuclear translocation and transcriptional activity of SOX9 in these cells. TAK1/IκBα/NF-κB pathway contributed to induction of SOX9 by oncogenic Kras, and SOX9 in turn enhanced NF-κB activation. SOX9 promoted the proliferation of HPNE and PDAC cells, and correlated with minichromosome maintenance complex components (MCMs) and mediator of DNA damage checkpoint 1 (MDC1) expression. The overexpressive MDC1 was associated with less perineural and lymph node invasion of tumors and early TNM-stage of patients. Our results indicate that oncogenic Kras induces constitutive activation of SOX9 in HPNE and HPDE cells, and Kras/TAK1/IκBα/NF-κB pathway and a positive feedback between SOX9 and NF-κB are involved in this inducing process. SOX9 accelerates proliferation of cells and affects MCMs and MDC1 expression. MDC1 is associated negatively with invasion and metastasis of PDAC.

Objective: To explore the life span of red blood cells (RBC) in patients with severe/very severe aplastic anemia (SAA/VSAA). Methods: Clinical data of 128 SAA/VSAA patients from November 2016 to April 2017 were retrospectively analyzed, and 13 healthy volunteers in the same period was used as normal control. The endogenous Breath Carbon Monoxide (CO) test was used to detect the life span of RBC in SAA/VSAA patients, and the effect of immunosuppressive therapy (IST) on the life span of RBC in these patients was explored. Results: The mean life span of RBC in 51 untreated SAA/VSAA patients was (50.69±21.43) d, which was significantly shorter than that in normal controls[(111.85±31.55) d]( t =-6.611, P <0.001). The mean life span of RBC in 77 patients treated with IST was (87.14±39.28) d. The mean life span of RBC in complete responses (CR), hematologic response (HR) and non-response (NR) patients were (106.15±32.12) d, (92.00±38.60) d and (50.44±21.56) d, respectively. The life span of RBC in patients with HR was significantly longer than that in newly diagnosed and NR patients ( t =7.430, P <0.001; t =4.846, P =0.002), which was similar to that in the normal controls ( t =-1.743, P =0.085). There was no statistical significance between CR patients and the normal controls in the mean life span of RBC ( t =-0.558, P =0.579). No factor affecting the RBC life span was found in univariate logistical regression analyses in the newly diagnosed SAA/VSAA patients. The serum levels of IL-2R and IL-6 were much lower in HR patients than NR patients[IL-2R: 4.3×10 5 U/L vs 6.5×10 5 U/L, z =-2.733, P =0.006; IL-6: 2.6 (2.0-17.7) ng/L vs 6.1 (2.0-14.4) ng/L, z =-2.968, P =0.003]. Of the 51 newly diagnosed patients, 38 received IST and their 3-month curative effect was evaluated. Receiver operator characteristics (ROC) curve was used to analyze the predictive effect of RBC life span of untreated patients on the efficacy of IST before treatment. The cut-off point was 60 days with sensitivity of 37.5% and specificity of 86.4%. In 9 cases with life span of RBC>60 d before IST, 6 cases acquired HR, while in 29 cases with life span of RBC ≤ 60 d before IST, 10 cases acquired HR, the difference was not statistically significant ( P =0.128). Conclusion: The life span of RBC in SAA/VSAA patients was shortened, which can be improved even recovered to the normal after IST. Elevated cytokines might play a role in the pathophysiology of the shortened RBC life span in SAA/VSAA.

Objective: To evaluate the prognostic value of Global Registry of Acute Coronary Events(GRACE) discharge score for long-term out-of-hospital death in acute coronary syndrome (ACS) after drug-eluting stents (DES) and with Dual-antiplatelet Therapy (DAPT). Methods: Our study was a prospective, observational, single center (Fuwai Hospital of China) study.A total of 6 431consecutive ACS patients underwent percutaneous coronary intervention(PCI)between January 2013 and December 2013 were involved.The primary endpoint was all-cause death and second endpoint was major adverse cardiovascular and cerebrovascular events (MACCE) as a composite of all-cause death, myocardial infarction, revascularization, stent thrombosis or stroke. Results: Finally, 5 867 ACS patients who were received DES with DAPT and had no in-hospital event included in this study, and 59 (1.01%) death and 608 (10.36%) MACCE were reported during 2-year follow-up after discharge.GRACE score was significantly higher among death patients than those survivalpatients (94± 28 vs 78± 24, P <0.001). According to risk stratification of GRACE discharge score, as compared to the low-risk group, death risk in high-risk group was 6.73 times ( HR =6.73, 95% CI 3.53-12.84; P <0.001) higher, but could not distinguish between the moderate and low risk group ( HR =1.61, 95% CI 0.88-2.95; P =0.124). The GRACE score showed predictive value in ACS patients after DESand with DAPT (area under the receiver operating characteristic curve (AUROC)=0.661; 95% CI 0.586-0.736, P <0.001). In subgroup analysis, GRACE score also showed predictive value both in unstable angina pectoris (UAP)(AUROC=0.660, 95% CI 0.576-0.744; P <0.001) and acute myocardial infarction(AMI)subgroup (AUROC=0.748, 95% CI 0.631-0.864; P =0.001). Conclusion: GRACE discharge score shows prognostic value for long-term out-of-hospital death in ACS patients undergoing PCI with DES and DAPT, and demonstrates good risk stratification of high and low-risk of death.

Rapidity-odd directed-flow measurements at midrapidity are presented for Λ, Λ[over ¯], K^{±}, K&#95;{s}^{0}, and ϕ at sqrt[s&#95;{NN}]=7.7, 11.5, 14.5, 19.6, 27, 39, 62.4, and 200 GeV in Au+Au collisions recorded by the Solenoidal Tracker detector at the Relativistic Heavy Ion Collider. These measurements greatly expand the scope of data available to constrain models with differing prescriptions for the equation of state of quantum chromodynamics. Results show good sensitivity for testing a picture where flow is assumed to be imposed before hadron formation and the observed particles are assumed to form via coalescence of constituent quarks. The pattern of departure from a coalescence-inspired sum rule can be a valuable new tool for probing the collision dynamics.

Dendritic cells (DCs) are antigen-presenting cells that capture, process, and present antigens to lymphocytes to initiate and regulate the adaptive immune response. DCs detect bacteria in skin and mucosa and migrate into regional lymph nodes, where they stimulate antigen-specific T and B lymphocyte activation and proliferation. DCs direct CD4 T cells to differentiate to T-cell subsets such as T helper cells types 1, 2, and 17, and regulatory T cells. The periodontium is chronically exposed to oral bacteria that stimulate an inflammatory response to induce gingivitis or periodontitis. DCs play both protective and destructive roles through activation of the acquired immune response and are also reported to be a source of osteoclast precursors that promote bone resorption. FOXO1, a member of the forkhead box O family of transcription factors, plays a significant role in the activation of DCs. The function of DCs in periodontal inflammation has been investigated in a mouse model by lineage-specific deletion of FOXO1 in these cells. Deletion of FOXO1 reduces DC protective function and enhances susceptibility to periodontitis. The kinase Akt, phosphorylates FOXO1 to inhibit FOXO activity. Hence the Akt-FOXO1 axis may play a key role in regulating DCs to have a significant impact on periodontal disease., (© 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

Objective: To determine the distribution characteristics of inhaled allergens and its influencing factors among allergic rhinitis (AR) patients in Chongqing. Method: Intracutaneous test was carried out in 2 474 AR patients. All the cases were divided into six groups according to age, 6-13 years old, >13-18 years old, >18-29 years old, >29-39 years old, >39-49 years old, >49 years old and four groups on the basis of season (spring, summer, autumn, winter). The correlations between the positive rates and gender, age, season were analyzed. Result: The most common allergens were dermatophagoides farin (71.26%), dermatophagoides pteronyssinus (73.61%) and polyvalent insect (60.79%). There was no significant correlation between most allergens and gender( P >0.05). Statistical analysis was conducted among different age groups, it showed that the positive rates of overwhelming majority allergens were highest in the group of 13-18 years old and higher in 6-13 years old group, and then gradually declined with age with a striking difference in each groups ( P <0.05). Similar analysis was carried out among the groups in four seasons. It revealed that the prevalence rates of most allergens were higher in summer and autumn than that in spring and winter ( P <0.05). Conclusion: Dermatophagoides and polyvalent insect are the most prevalent inhalant allergens in AR disease in Chongqing. Most AR patients had multiple allergens. The prevalence rates of most allergens were significantly different with age and season., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.)

In Table 2:Family 6 should be c.643-13&#95;662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13&#95;662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271&#95;279dupGCCCTCTCG instead of c.271&#95;279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Objective: To compare the effectiveness of percutaneous coronary intervention (PCI), coronary artery bypass grafting (CABG) or medical therapy (MT) alone for real-world stable coronary artery disease (SCAD) patients with three-vessel disease (TVD) in mainland China. Methods: A total of 8 943 consecutive cases with TVD hospitalized in our center from April 2004 to February 2011 were screened for this study. In this cohort, 3 435 cases diagnosed as SCAD were analyzed. PCI, CABG, MT alone were performed in 1 313 (38.2%), 1 259 (36.7%) and 863 (25.1%) patients, respectively. Propensity score matching (PSM) analysis using nearest neighbor matching with a 1∶1 ratio was applied, and 758 pairs of CABG and PCI groups, 552 pairs of PCI and MT groups, 639 pairs of CABG and MT groups were selected, respectively. 1- and 2-year clinical outcomes were evaluated among PCI, CABG and MT group. Kaplan-Meier curves and multivariable Cox regression method were used for survival analysis. Results: Significant differences were found at baseline between PCI, CABG and MT group, including age, gender, body mass index, family history of coronary artery disease, hyperlipidemia, diabetes mellitus, previous myocardial infarction, stroke, previous revascularization, peripheral vascular disease, SNYTAX score, left ventricular ejection fraction, hemoglobin, serum creatinine, high-sensitivity C-reactive protein, triglyceride and medication (all P< 0.05) . All-cause death rates of 1- and 2-year follow-up of PCI, CABG and MT group were 0.6% (8/1 313), 1.1% (14/1 259), 3.4% (29/863) ( P< 0.001) and 1.1%(14/1 313), 1.5%(19/1 259), 7.3%(63/863) ( P< 0.001), respectively. Multivariate Cox regression analysis showed that 1-year MACCE rate ( HR =0.51, 95% CI 0.33-0.77, P= 0.001) was significantly reduced, due to the significant decrease of myocardial infarction (MI) rate ( HR =0.09, 95% CI 0.01-0.76, P= 0.027) and repeat revascularization rate ( HR =0.21, 95% CI 0.10-0.41, P< 0.001) in CABG group compared to PCI group, while all-cause death ( HR =1.21, 95% CI 0.48-3.00, P= 0.69) and stroke rate ( HR =2.31, 95% CI 0.82-6.47, P= 0.112) were similar between 2 groups. 2-year outcome showed CABG was associated with higher stroke rate ( HR =2.20, 95% CI 1.06-4.55, P= 0.034) and lower MI ( HR =0.19, 95% CI 0.06-0.59, P= 0.004) and repeat revascularization rate ( HR =0.22, 95% CI 0.13-0.37, P< 0.001), and lower MACCE rate ( HR =0.49, 95% CI 0.36-0.68, P< 0.001). Compared to MT group, 2-year all-cause death ( HR =0.22, 95% CI 0.12-0.42, P< 0.001) and MACCE rate ( HR =0.63, 95% CI 0.47-0.83, P= 0.001) were lower in PCI group, while 2-year all-cause death ( HR =0.21, 95% CI 0.13-0.37, P< 0.001), MACCE ( HR =0.31, 95% CI 0.23-0.42, P< 0.001), MI ( HR =0.19, 95% CI 0.06-0.60, P= 0.004) and repeat revascularization rate ( HR =0.24, 95% CI 0.13-0.41, P< 0.001) were lower in CABG group. Results of multivariate Cox regression analysis after PSM were consistent with above results. Conclusion: For SCAD patients with TVD, CABG shows better effectiveness by reducing MI and revascularization risk as compared to PCI, even though stroke risk is somehow higher in CABG patients. Patients received MT alone are associated with worse outcomes than those undergoing revascularization strategies.

Objective: To observe the association of carotid artery plaque with all-cause mortality and cardiovascular events. Methods: A total of 7 017 participants who completed the carotid sonography examination between 2010 and 2011 were selected from the stroke and the elderly prospective cohort Kailuan study. The participants of stroke cohort received health examination between 2006 and 2007, and participants of elderly cohort received health examination between 2010 and 2011. All participants were divided into plaque group (3 285 cases) and without plaque group (3 732 cases) according to with or without carotid artery plaque.The all-cause mortality and cardiovascular events were compared between the 2 groups. Multivariate Cox regression analysis was used to identify the association of carotid artery plaque with all-cause mortality and cardiovascular events. Results: (1) There were 4 297 male (61.2%) and 2 720 female (38.8%) in this cohort and participants were (58.1±11.8) years old. Age, systolic blood pressure, diastolic blood pressure, fasting plasma glucose, total cholesterol, low-density lipoprotein cholesterol, rates of male, smoking, drinking, history of hypertension and diabetes mellitus were higher in the plaque group than in the without plaque group, and high density lipoprotein cholesterol was lower in the plaque group than in the without plaque group (all P< 0.01) at baseline. (2) During a follow-up period of (4.92±0.59) years, the incidence rates of all-cause mortality in the plaque group and without plaque group were 5.5% (180/3 285) and 1.5% (57/3 732) ,respectively ( P< 0.01) .The incidence rates of cardiovascular events in the plaque group and without plaque group were 3.8% (124/3 285) and 1.4% (52/3 732) , respectively ( P< 0.01) . (3) Multivariate Cox regression analysis showed that carotid plaque was an independent risk factor of all-cause mortality ( HR =1.667, 95% CI 1.160-2.395, P< 0.01) and cardiovascular events ( HR =1.942, 95% CI 1.312-2.876, P< 0.01) after adjusting for age, sex, systolic blood pressure, diastolic blood pressure, fasting plasma glucose, body mass index, total cholesterol,low density lipoprotein cholesterol, high density lipoprotein cholesterol, smoking, drinking, history of hypertension and diabetes mellitus, and use of lipid-regulating drugs. Conclusion: Carotid plaque is an independent risk factor of all-cause mortality and cardiovascular events. Clinical Trial Registration Chinese Clinical Trials Registry, ChiCTR-TNC-11001489.

Objective: To investigate the in-hospital and long-term outcomes of patients with left ventricular ejection fraction (LVEF) <50% undergoing percutaneous coronary intervention (PCI) . Methods: From January to December 2013, 10 445 consecutive patients who underwent PCI in Fuwai Hospital and the LVEF value was available were prospectively included. The patients were divided into LVEF≥50% group (9 896 cases) and LVEF < 50% group (549 cases) . The in-hospital and 2-year clinical outcomes were compared between the 2 groups. The association between LVEF < 50% and clinical outcomes was assessed using multivariable Cox regression analysis. Results: (1) Compared with LVEF ≥50% group, LVEF < 50% group had higher rates of in-hospital all-cause death (1.1% (6/549) vs. 0.2% (17/9 896) , P< 0.01) , cardiac death (1.1% (6/549) vs. 0.1% (12/9 896) , P< 0.01) , in-stent thrombosis (0.7% (4/549) vs. 0.2% (18/9 896) , P< 0.01) , myocardial infarction (2.4% (13/549) vs. 1.2% (121/9 896) , P< 0.05) ,and major adverse cardiovascular and cerebrovascular events (MACCE) which including death, myocardial infarction, revascularization, in-stent thrombosis, and stroke (3.6% (20/549) vs. 1.4% (137/9 896) , P< 0.01) . (2) A total of 10 388 (99.5%) patients completed 2-year follow-up. Compared with LVEF ≥50% group, LVEF < 50% group had higher rates of 2-year all-cause death (4.7% (26/549) vs. 1.0% (101/9 896) , P< 0.01) , cardiac death (4.0% (22/549) vs. 0.5% (50/9 896) , P< 0.01) , in-stent thrombosis (3.1% (17/549) vs. 0.7% (71/9 896) , P< 0.001) , myocardial infarction (4.2% (23/549) vs. 1.9% (186/9 896) , P< 0.01) ,and MACCE (17.9% (98/549) vs. 11.8% (1 172/9 896) , P< 0.01) . There were no significant differences on the rates of 2-year target-vessel revascularization, bleeding and stroke between the two groups. (3) The multivariable Cox regression analysis demonstrated that LVEF < 50% was the independent risk factor of 2-year all-cause death ( HR =2.47, 95% CI 1.49-4.08, P< 0.01) , cardiac death ( HR =3.25, 95% CI 1.79-5.90, P< 0.01) , in-stent thrombosis ( HR =4.19, 95% CI 2.39-7.34, P< 0.01) , myocardial infarction ( HR =2.00, 95% CI 1.26-3.16, P< 0.01) , and MACCE ( HR =1.40, 95% CI 1.13-1.74, P <0.01) . (4) After propensity score matching, all in-hospital outcomes were similar between the two groups, including all-cause death, cardiac death, in-stent thrombosis, myocardial infarction, revascularization, bleeding, stroke, and MACCE (all P> 0.05) . After propensity score matching,the multivariable Cox regression analysis demonstrated that LVEF < 50% was still an independent risk factor of 2-year all-cause death ( HR =3.08, 95% CI 1.37-6.89, P< 0.01) , cardiac death ( HR = 4.12, 95% CI 1.53-11.07, P< 0.01) ,and in-stent thrombosis ( HR =3.82, 95% CI 1.27-11.5, P< 0.05) . Conclusion: LVEF < 50% is an independent risk factor of 2-year all-cause death, cardiac death, and in-stent thrombosis in patients undergoing PCI, but it does not increase the risk of target-vessel revascularization, bleeding or stroke.

Objective: To explore the value of ultrasound in the diagnosis of anterosuperior acetabular labral tear., Methods: A total of 102 patients [(42 males and 60 females, age from 13 to 60 years, average age was (35.14±9.16) years] with suspected anterosuperior acetabular labral tear were included in this study, including 44 left hip joints and 58 right hip joints. All the patients received hip joint ultrasound and magnetic resonance imaging (MRI) evaluation before arthroscopy surgery. Using arthroscopy as golden standard, the sensitivity, specificity, positive predictive value, negative predictive value and accuracy between ultrasound and MRI were calculated and compared., Results: There were 91 antero-superior acetabular labral tears of 102 patients which were confirmed during arthroscopy surgery. Sixty-nine patients were diagnosed correctly by ultrasound, including 60 anterosuperior acetabular labral tears and 9 with no acetabular labral tears, whereas 2 were false-positive and 31 were found to be false-negative. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy by ultrasound were respectively 65.93%, 81.82%, 96.77%, 22.50% and 67.65%. In contrast, seventy-seven patients were diagnosed correctly by MRI, including 70 anterosuperior acetabular labral tears and 7 with no acetabular labral tears, whereas 4 were false-positive and 21 were found to be false-negative. For MRI, the sensitivity, specificity, positive predictive value, negative predictive value and accuracy were respectively 76.92%, 63.64%, 94.59%, 25.00% and 75.49%. The results of ultrasound and MRI were in accordance in 68 of the 102 patients. There were 51 anterosuperior acetabular labral tears of the 68 patients who were diagnosed by both ultrasound and MRI, whereas there were 17 with no acetabular labral tears of the 68 patients who were diagnosed by both ultrasound and MRI. The results of ultrasound and MRI were inconsistent in 34 of the 102 patients. In 11 of the 34 patients, in which case ultrasound diagnosed anterosuperior acetabular labral tear, MRI found no acetabular labral tear. Whereas, in 23 of the 34 patients, in which case MRI diagnosed anterosuperior acetabular labral tear, ultrasound found no acetabular labral tear. As compared with MRI findings, ultrasound had a lower accuracy for anterosuperior acetabular labral tear than MRI, there was statistical difference on the accuracy for anterosuperior acetabular labral tear (P<0.01)., Conclusion: Although ultrasound had a slightly lower sensitivity for anterosuperior acetabular labral tear, it had a higher specificity than MRI. Dynamic evaluation of antero-superior acetabular labral tear is an advantage of ultrasound. Ultrasound could be used as a feasible method to evaluate anterosuperior acetabular labral tear.

Objective: To analyze the clinical manifestations, diagnosis, treatment and prognosis of intestinal lymphangiectasia (IL) in children in order to improve the skills of diagnosis and treatment of IL. Method: Clinical manifestations, laboratory findings, gastroscopic findings, histopathological examinations and lymphatic radionuclide imaging assessments were analyzed retrospectively among 47 IL patients who were hospitalized in the Gastroenterology Department of Beijing Children's Hospital Affiliated to Capital Medical University from June 2007 to December 2015. All patients were followed up by telephone. According to the various causes, the patients were divided into the primary intestinal lymphangiectasia (PIL) group and secondary IL group, and their clinical manifestations were compared by t test, Rank sum test or Chi-square test. Result: In 47 IL patients, there were 38 children (81%) younger than 3 years old. There were 43 PIL patients (91%) and 4 secondary IL patients (9%). Between PIL and secondary IL, there were statistical differences in serum albumin ( t=- 3.950, P< 0.005) , globulin( t=- 2.850, P= 0.007), age of onset( U =27.000, P= 0.024), age at diagnosis( U =29.000, P= 0.030) and course of disease( U =26.500, P= 0.023), whereas there were no statistical differences in lymphocyte count, IgG, lymphatic radionuclide imaging, histopathology and gender(all P> 0.05). Edema (44 cases, 94%), diarrhea (42 cases, 89%), accompanied with infection (35 cases, 74%) and ascites (30 cases, 64%) were the main clinical manifestations. In 47 IL patients, 45 patients were done gastroscopy and histopathological examinations, and there were 31 patients' histopathological examinations(69%) were positive. Forty patients were done lymphatic radionuclide imaging, and there was evidence of protein losing from gut via lymphatic radionuclide imaging in 39 patients(98%). Among 47 patients, 35 patients (74%) were followed up, 32 patients had good prognosis, 2 patient failed to show evidence of improvement, 1 patient died and no patient experienced a relapse till the end of the follow-up. In 35 patients, 28 patients were treated with medium chain triglycerides (MCT) dietary therapy, 26 patients showed improvement in symptoms, and 2 patients had no improvement. Among 35 patients with follow-up, there were 6 patients received surgical treatment, and their symptoms were improved. Conclusion: PIL are the majority of IL in children younger than 3 years old. The main clinical manifestations are edema, diarrhea, accompanied with infection and ascites. For the patients without the evidence of lymphangiectasia from duodenum histopathological examination, further consideration of lymphatic radionuclide imaging, clinical manifestations, and laboratory studies are needed to make a final diagnosis. MCT dietary therapy is the cornerstone of IL medical management.

Increased DNA damage in testis is considered as a major factor for ageing-related dysfunction. Total flavonoids of Epimedium (TFE), the main active compositions of Epimedium, have been used to treat sexual dysfunction and delay ageing. However, whether TFE could improve ageing-related testicular dysfunction remains unknown. Therefore, we investigated the protection effects of TFE and its mechanisms of action in a naturally ageing rat model. Eighteen-month-old SD rats were randomised to receive either vehicle or TFE (10 and 20 mg/kg). Nine-month-old SD rats were used as adult controls. Morphology, protein expression and immunohistochemistry were determined. Compared with adult control group, intragastric administration of TFE for 6 months significantly improved testicular morphology, increased the activities of SOD and decreased the levels of MDA of testis. In addition, TFE decreased γH2AX expression levels and γH2AX focal formation in spermatogonia and primary spermatocyte with concomitant downregulation of 8-OHdG levels. Furthermore, TFE inhibited p-P53/p21 and chk1/chk2 expression levels. Collectively, TFE effectively reduce oxidative DNA damage in testis of ageing rats via a p53-dependent pathway. Thus, inhibition of oxidative DNA damage is likely to represent a promising strategy for restoration of ageing-related testicular dysfunction., (© 2017 Blackwell Verlag GmbH.)

Objective: To investigate the clinical characteristics and prognosis in patients with stroke after percutaneous coronary intervention (PCI). Methods: From January 2013 to December 2013, 10 724 consecutive patients undergoing PCI including acute coronary syndrome and stable angina pectoris were enrolled.A two years' follow up was conducted among these patients to investigate the clinical characteristics and prognosis of patients with stroke and of those without. A comparison was done between the two groups. Results: One hundred and forty-five patients had stroke (1.4%) during the follow-up period after PCI, including 124 cases with ischemic stroke (1.2%), out of whom 4 (3.2%) patients died; 21 cases with hemorrhagic stroke, out of whom 9 patients (42.9%) died.There was more female, and more patients with risks factors, hypertension, previous myocardial infarction, previous stroke, etc. in the patients with stroke.During the 2-year follow-up, patients with stroke experienced higher incidence of all-cause mortality (9% vs 1.1%, P <0.000 1). There were no significant differences in the incidences of cardiac death, myocardial infarction, revascularization, stent thrombosis and major adverse cardiovascular event rates between the two groups.COX regression analysis showed that stroke after PCI was associated with the increased mortality ( HR =8.387, 95% CI : 4.725-14.855, P <0.000 1). Meanwhile, after propensity score matched analyses (129 pairs), the trend was not changed, and stroke was still an independent risk factor of all-cause mortality ( HR =6.737, 95% CI : 1.52-29.85, P =0.012). Conclusions: The patients underwent PCI, who had stroke later, had more clinical risk factors, and more serious degree of atherosclerosis.The incidence of stroke is an independent risk factor for all-cause mortality in patients with coronary heart disease after PCI.

The achievement of more accurate diagnosis would greatly benefit the management of patients with osteogenesis imperfecta (OI). In this study, we present the largest OI sample in China as screened by next generation sequencing. In particular, we successfully identified 81 variants, which included 45 novel variants. We further did a genotype-phenotype analysis, which helps make a better understanding of OI., Introduction: This study aims to reveal the gene mutation spectrum and the genotype-phenotype relationship among Chinese OI patients by next generation sequencing (NGS)., Methods: We developed a NGS-based panel for targeted sequencing of all exons of 14 genes related to OI, and performed diagnostic gene sequencing for a cohort of 103 Chinese OI patients from 101 unrelated families. Mutations identified by NGS were further confirmed by Sanger sequencing and co-segregation analysis., Results: Of the 103 patients from 101 unrelated OI families, we identified 79 mutations, including 43 novel mutations (11 frameshift, 17 missense, 5 nonsense, 9 splice site, and 1 chromosome translocation) in 90 patients (87.4%). Mutations in genes encoding type I collagen, COL1A1 (n = 37), and COL1A2 (n = 29) accounts for 73.3% of all molecularly diagnosed patients, followed by IFITM5 (n = 9, 10%), SERPINF1 (n = 4, 4.4%), WNT1 (n = 4, 4.4%), FKBP10 (n = 3, 3.3%), TMEM38B (n = 3, 3.3%), and PLOD2 (n = 1, 1.1%). This corresponds to 75 autosomal dominant inherited (AD) OI patients and 15 autosomal recessive (AR) inherited patients. Compared with AD inherited OI patients, AR inherited patients had lower bone mineral density (BMD) at spine (P = 0.05) and less frequent blue sclera (P = 0.001). Patients with type I collagen qualitative defects had lower femoral neck BMD Z-score (P = 0.034) and were shorter compared with patients with type I collagen quantitative defects (P = 0.022)., Conclusion: We revealed the gene mutation spectrum in Chinese OI patients, and novel mutations identified here expanded the mutation catalog and genotype and phenotype relationships among OI patients.

The organic matrix from normal and pimpled calcified chicken eggshells were dissociated into acid-insoluble, water-insoluble, and facultative-soluble (both acid- and water-soluble) components, to understand the influence of shell matrix on eggshell qualities. A linear correlation was shown among these 3 matrix components in normal eggshells but was not observed in pimpled eggshells. In pimpled eggshells, the percentage contents of all 4 groups of matrix (the total matrix, acid-insoluble matrix, water-insoluble matrix, and facultative-soluble matrix) were significantly higher than that in normal eggshells. The amounts of both total matrix and acid-insoluble matrix in individual pimpled calcified shells were high, even though their weight was much lower than a normal eggshell. In both normal and pimpled eggshells, the calcified eggshell weight and shell thickness significantly and positively correlated with the amounts of all 4 groups of matrix in an individual calcified shell. In normal eggshells, the calcified shell thickness and shell breaking strength showed no significant correlations with the percentage contents of all 4 groups of matrix. In normal eggshells, only the shell membrane weight significantly correlated with the constituent ratios of both acid-insoluble matrix and facultative-soluble matrix in the whole matrix. In pimpled eggshells, 3 variables (calcified shell weight, shell thickness, and breaking strength) were significantly correlated with the constituent proportions of both acid-insoluble matrix and facultative-matrix. This study suggests that mechanical properties of normal eggshells may not linearly depend on the organic matrix content in the calcified eggshells and that pimpled eggshells might result by the disequilibrium enrichment of some proteins with negative effects., (© 2017 Poultry Science Association Inc.)

Aims: The relationship between socio-economic status and gestational diabetes mellitus has received little attention. The purpose of this study was to investigate the association between socio-economic status and risk of gestational diabetes., Methods: Data were obtained from the ongoing Healthy Baby Cohort study in Hubei Province, China, in 2012-2014. Information on educational level and household income was collected using standard questionnaires during face-to-face interviews. Gestational diabetes was defined based on the International Association of Diabetes and Pregnancy Study Group's criteria. Logistic regression models were used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) for gestational diabetes in relation to socio-economic status., Results: Among 6886 participants, 1005 (14.6%) pregnant women were diagnosed with gestational diabetes. Higher educational level was inversely associated with risk of gestational diabetes (OR, 0.74; 95% CI, 0.58, 0.95 for high school and OR, 0.62; 95% CI, 0.50, 0.76 for college or above). After adjustment for potential confounders, the ORs for gestational diabetes were 0.77 (95% CI, 0.59, 1.00) and 0.65 (95% CI, 0.51, 0.83) for women with high school and college or above education, respectively, compared with women with less than high school education. No significant association between household income and gestational diabetes was observed after adjustment for potential confounders. Subgroup analysis showed that the reduced risk of gestational diabetes with higher educational level was more evident among women with a pre-pregnancy BMI < 24 kg/m 2 (P for interaction = 0.022)., Conclusions: Our findings suggested that educational level was a more robust predictor of gestational diabetes than household income among Chinese women., (© 2017 Diabetes UK.)

Aim: Age at menopause is associated with cardiovascular disease, but little is known of its relationship with diabetes, and previous findings are controversial. The objective of this study was to evaluate the association between earlier menopause (at age ≤45 years) and the prevalence of diabetes in the Chinese population., Methods: A total of 16,299 postmenopausal women, aged 42.0-94.3 years, who completed the study questionnaires, underwent medical examinations and provided blood samples, were included in our analysis. Participants self-reported their age at menopause and were then divided into three age groups (≤45, 46-52, ≥53years). Logistic regression models were used to estimate odds ratios (ORs) and 95% confidence intervals (CIs)., Results: Of the study participants, 2811 (17.2%) had diabetes. The average age at menopause was 49.5±3.3 years. For each 1-year delay in menopausal age, the presence of diabetes was reduced by 2% (OR: 0.98, 95% CI: 0.97-0.99) after adjusting for potential confounding factors. Compared with those whose menopausal age was 46-52 years, the OR for diabetes was 1.20 (95% CI: 1.03-1.39) for those with an earlier menopausal age (≤45years)., Conclusion: Our findings suggest that earlier menopause may be independently associated with an increased prevalence of diabetes. Future prospective studies are needed to verify this relationship., (Copyright © 2017 Elsevier Masson SAS. All rights reserved.)

We report the first dijet transverse momentum asymmetry measurements from Au+Au and pp collisions at RHIC. The two highest-energy back-to-back jets reconstructed from fragments with transverse momenta above 2  GeV/c display a significantly higher momentum imbalance in heavy-ion collisions than in the pp reference. When reexamined with correlated soft particles included, we observe that these dijets then exhibit a unique new feature-momentum balance is restored to that observed in pp for a jet resolution parameter of R=0.4, while rebalancing is not attained with a smaller value of R=0.2.

Objective: To investigate the impact of previous coronary artery bypass grafting(CABG) on long-term outcomes in patients undergoing percutaneous coronary intervention(PCI). Methods: A total of 10 724 consecutive coronary heart disease patients undergoing PCI between January and December 2013 in Fuwai hospital were prospectively included in this research. According to CABG history, the patients were divided into CABG group(437 cases) and without CABG group(10 287 cases). The patients were followed up for 2 years. Major adverse cardiovascular and cerebrovascular events(MACCE) including death, myocardial infarction, revascularization and stroke, and in-stent thrombosis following PCI were compared between the 2 groups. Multivariate Cox regression analysis was used to identify independent risk factors of poor prognosis. Results: Compared with without CABG group, CABG group were older((61±10)years vs.(58±10)years, P <0.001), and more often had diabetes(35.7%(156/437) vs. 30.0%(3 082/10 287), P =0.012), hyperlipoidemia(73.9%(323/437) vs. 67.0%(6 888/10 287), P =0.003), previous myocardial infarction(31.1%(136/437) vs. 18.7%(1 925/10 287), P <0.001), PCI history(61.6%(269/437) vs. 23.0%(2 371/10 287), P <0.001), and cerebrovascular disease(7.1%(31/437) vs. 10.9%(1 119/10 287), P =0.013). After 2 years follow-up, rates of cardiac death(1.8%(8/437) vs. 0.6%(66/10 287), P =0.010), revascularization(11.2%(49/437) vs. 8.5%(877/10 287), P =0.049) and MACCE(15.1%(66/437) vs. 12.0%(1 231/10 287), P =0.049) were significantly higher in CABG patients than in without CABG group. There were no significant difference in all cause death(2.1%(9/437) vs. 1.2%(122/10 287), P =0.114), recurrence of myocardial infarction(2.3%(10/437) vs. 2.0%(204/10 287), P =0.600), stroke(1.1%(5/437) vs. 1.4%(140/10 287), P =0.701), and in-stent thrombosis(1.1%(5/437) vs. 0.6%(61/10 287), P =0.194). Multivariate Cox regression analysis showed that previous CABG was an independent risk factor of cardiac death( HR =2.13, 95% CI 1.02-4.46, P =0.045)and revascularization( HR =1.35, 95% CI 1.01-1.81, P =0.040). However, after propensity score matched analyses(429 pairs), previous CABG was no longer an independent risk factor of cardiac mortality ( HR =0.97, 95% CI 0.37-2.54, P =0.954)and revascularization( HR =1.74, 95% CI 0.94-3.21, P =0.753). Conclusion: Previous CABG is not an independent risk factor of poor prognosis in coronary heart disease patients undergoing PCI.

Objective: To evaluate the therapeutic efficacy and safety of immunosuppressive therapy (IST) combined with recombinant human thrombopoietin (rhTPO) for severe aplastic anemia (SAA) in pediatric patients. Method: A retrospective case-control study was conducted and the clinical data of 45 pediatric patients with de novo SAA admitted to the Anemia Diagnosis and Treatment Center of Chinese Academy of Medical Sciences & Blood Disease Hospital during the period from December 2009 to December 2014 were analyzed. Among them, 15 patients were treated with the regimen of IST together with rhTPO and 30 patients were given IST treatment only. The variation characteristics of the peripheral blood routine as well as the transfusion of blood products was dynamically observed, and the therapeutic efficacy was assessed respectively after 3, 6 and 12 months after the treatment. In the meantime, adverse effects related to rhTPO application were recorded. Thereafter, the statistics of the two groups were compared by non-parametric rank sum test. Result: Among 45 pediatric patients, there were 26 male and 19 female, and the median age was 11 years (6-14). The number of patients received good hematological response(complete remission (CR) plus good partial response (GPR)) in the combinatory group versus vs . the IST group was 6 vs . 3 patients (χ(2)=3.906, P =0.048) at the 3rd month, 7 vs . 7 patients (χ(2)=1.568, P =0.210) at the 6th month, and 13 vs . 14 patients (χ(2)=6.667, P =0.01) at the 12th month respectively. For those achieved good hematological response at the 3rd month, the amount of platelets transfusion and red blood cells transfusion of the combined group were both less than that of the IST group during the period from the 10th to the 12th weeks (platelets transfusion: 1.4 U vs . 2.9 U, t =-3.523, P =0.002; red blood cells transfusion: 0.8 U vs . 2.6 U, t =-2.392, P =0.026). No serious adverse effect related to rhTPO application was observed in the IST combined with rhTPO group. Conclusion: Application of rhTPO can improve the short-term therapeutic efficacy of IST for pediatric SAA, alleviate transfusion dependence, and has a good safety profile.

Metastatic relapse remains largely incurable and a major challenge of clinical management in breast cancer, but the underlying mechanisms are poorly understood. Herein, we report that CGI-99 is overexpressed in breast cancer tissues from patients with metastatic recurrence within 5 years. High CGI-99 significantly predicts poorer 5-year metastasis-free patient survival. We find that CGI-99 increases breast cancer stem cell properties, and potentiates efficient tumor lung colonization and outgrowth in vivo. Furthermore, we demonstrate that CGI-99 activates the autocrine interleukin-6 (IL-6)/STAT3 signaling by increasing the accumulation and activity of RNA polymerase II and p300 cofactor at the proximal promoter of IL-6. Importantly, delivery of the IL-6-receptor humanized monoclonal antibody tocilizumab robustly abrogates CGI-99-induced metastasis in vivo. Finally, we find that high levels of CGI-99 are significantly correlated with STAT3 hyperactivation in breast cancer patients. These findings reveal a potential mechanism for constitutive activation of autocrine IL-6/STAT3 signaling and may suggest a novel target for clinical intervention in breast cancer.

Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose.

Objective: To investigate the relationship between the eosin-5'-maleimide (EMA) binding test and the clinical severity of hereditary spherocytosis (HS). Methods: A total of 258 un-splenectomize HS patients were consecutively enrolled. Correlation of hemoglobin concentration, hemolytic parameters, compensating erythropoiesis and the EMA binding test were evaluated. Results: 258 (128 male and 130 female) patients were included in this study, including 91 compensatory hemolysis patients, 53 patients with mild anemia, 78 patients with moderate anemia and 36 patients with severe anemia. The median age at diagnosis was 23 (2-70) years. The median decreased fluorescence intensity of EMA binding test was 29.97% (16.09%-47.34%) and the average intensity was (29.70±6.28) % of 258 HS patients. The decreased EMA binding fluorescence intensity correlated with MCV ( r =-0.343, P <0.001) and MCHC ( r =0.223, P <0.001). There was no relationship between EMA fluorescence intensity and absolute reticulocyte count ( r =0.080, P =0.198) , reticulocyte percentile ( r =-0.015, P =0.813) , IBIL levels ( r =-0.009, P =0.902) , HGB levels ( r =-0.067, P =0.280). Evaluated as a quartile variable, EMA fluorescence intensity was not correlated with anemia severity ( C =0.150, P =0.746). Conclusion: EMA binding test does not related to anemia levels and has no major clinical implications for disease severity in HS.

Aim: Early age at menarche has been reported to increase type 2 diabetes risk, but little is known of its impact on gestational diabetes mellitus (GDM) risk. The aim of this study was to examine the association between age at menarche and plasma glucose levels as well as GDM risk., Methods: A total of 6900 pregnant women from the Healthy Baby Cohort Study were included in our analysis. Age at menarche was self-reported and categorized into five groups (9-11, 12, 13, 14 and 15-18 years of age). GDM was diagnosed using the International Association of Diabetes and Pregnancy Study Groups criteria. Comparisons of plasma glucose levels according to age at menarche categories were performed using analysis of covariance. Logistic regression models were used to estimate the association between age at menarche and GDM risk., Results: Of our 6900 participants, 1015 (14.7%) were diagnosed with GDM. Mean age at menarche was 13.1±1.2 years. Early age at menarche (9-11 years) was associated with higher fasting, 1-h and 2-h plasma glucose levels (all P<0.05) compared with menarche at age 13 years. Furthermore, early age at menarche was linked to increased GDM risk after adjusting for potential confounders (OR: 1.41, 95% CI: 1.06-1.87)., Conclusion: Early age at menarche is an independent risk factor for GDM and, as such, may help to identify women at higher GDM risk who would benefit from early preventative strategies., (Copyright © 2017 Elsevier Masson SAS. All rights reserved.)