Search

The application of logistic regression (LR) and Cox Proportional Hazard (CoxPH) models are well-established for evaluating exposure-response (E-R) relationship in large molecule oncology drugs. However, applying machine learning (ML) models on evaluating E-R relationships has not been widely explored. We developed a workflow to train regularized LR/CoxPH and tree-based XGboost (XGB) models, and derive the odds ratios for best overall response and hazard ratios for overall survival, across exposure quantiles to evaluate the E-R relationship using clinical trial datasets. The E-R conclusions between LR/CoxPH and XGB models are overall consistent, and largely aligned with historical pharmacometric analyses findings. Overall, applying this interpretable ML workflow provides a promising alternative method to assess E-R relationships for impacting key dosing decisions in drug development., (© 2022 The Authors. CPT: Pharmacometrics & Systems Pharmacology published by Wiley Periodicals LLC on behalf of American Society for Clinical Pharmacology and Therapeutics.)

Although considerable scientific research data is available for sepsis and cytokine storm syndrome, there is a need to develop new treatments or drugs for sepsis management. Antimicrobial peptides (AMPs) possess anti-bacterial and anti-inflammatory activity, neutralizing toxins such as lipopolysaccharides (LPS, endotoxin). Most AMPs have been designed as a substitute for conventional antibiotics, which kill drug-resistant pathogens. The present study aimed to determine the anti-inflammatory potential of 10 designed XIW (X: lysine, arginine, or glutamic acid) α-helical peptides in macrophages and a mouse model in the presence of LPS. Among them, WIKE-14, a peptide with a helix-to-helix structure, having the 12th amino acid substituted with glutamic acid, suppressed pro-inflammatory cytokines in RAW 264.7 macrophages. This reaction was mediated by the inhibition of the binding between LPS and macrophages. In addition, the WIKE-14 peptide exhibited a potent anti-inflammatory activity in mice ears and lungs inflamed using LPS. Thus, our results may provide useful insights for the development of anti-sepsis agents via the sequence and structure information of the WIKE-14 peptide.

Introduction: Chronic pruritus persists for > 6 weeks and is known to decrease patients' quality of life. Due to the complex pathological mechanism of chronic pruritus, there is still a lack of satisfactory therapeutic agents; therefore, complementary therapies are required to improve itching symptoms. In the Republic of Korea, Sopoongsan, an herbal formula, has been used to treat itching, dizziness, and skin paralysis. To our knowledge, this is the first study to evaluate whether Sopoongsan improves chronic pruritus and to identify Sopoongsan-related changes in the immune response in patients with chronic upper body pruritus., Methods: A randomized, double-blind, placebo-controlled parallel trial will be conducted to assess 20 patients with chronic upper body pruritus for 3 months who have been diagnosed with allergic atopic dermatitis or seborrheic dermatitis. The patients will be randomly allocated to either the placebo-control (n = 10) or treatment (n = 10) group. The total study period will be 8 weeks (i.e., administration of Sopoongsan or placebo drugs for 4 wk and follow-up for 4 wk). Participants will be allowed to receive external treatment, except for antipruritic medications administered orally, throughout the study period. The primary outcome measure will be the numeric rating scale results for itching, whereas the secondary outcome measures will be questionnaire survey (Dermatological Life Quality Index and Epworth Sleepiness Scale) findings and the immune response index, including interferon gamma, interleukin-4, immunoglobulin E, thymic stromal lymphopoietic protein, and histamine, to investigate the biological mechanisms underlying chronic pruritus., Discussion and Conclusions: We expect that the results of this study will provide important clinical evidence regarding the effectiveness of Sopoongsan on itching symptoms, quality of life, sleep disturbance, and changes in the immune response. The findings will help elucidate the mechanism underlying the therapeutic effect of Sopoongsan for chronic pruritus and lay the foundation for further studies in this area., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.)

(1) Background: Currently, limited data are available regarding the relationship between epicardial fat and plaque composition. The aim of this study was to assess the relationship between visceral fat surrounding the heart and the lipid core burden in patients with coronary artery diseases; (2) Methods: Overall, 331 patients undergoing coronary angiography with combined near-infrared spectroscopy and intravascular ultrasound imaging were evaluated for epicardial adipose tissue (EAT) thickness using transthoracic echocardiography. Patients were divided into thick EAT and thin EAT groups according to the median value; (3) Results: There was a positive correlation between EAT thickness and maxLCBI4mm, and maxLCBI4mm was significantly higher in the thick EAT group compared to the thin EAT group (437 vs. 293, p < 0.001). EAT thickness was an independent predictor of maxLCBI4mm ≥ 400 along with age, low-density lipoprotein-cholesterol level, acute coronary syndrome presentation, and plaque burden in a multiple linear regression model. Receiver operating characteristic curve analysis showed that EAT thickness was a predictor for maxLCBI4mm ≥ 400; (4) Conclusions: In the present study, EAT thickness is related to the lipid core burden assessed by NIRS-IVUS in patients with CAD which suggests that EAT may affect the stability of the plaques in coronary arteries.

Malaysia has been experiencing smoke-haze episodes almost annually for the past few decades. PM2.5 is the main component in haze and causes harmful impacts on health due to its small aerodynamic size. This study aimed to explore the implications of PM2.5 exposure on the dietary intake of working individuals. Two phased 13-weeks follow-up study was conducted involving 440 participants, consisting of two cohorts of outdoor and indoor workers. Ambient PM2.5 concentrations were monitored using DustTrakTM DRX Aerosol Monitor. Data on Simplified Nutritional Appetite Questionnaire (SNAQ) and 24 h diet recall were collected weekly. The highest PM2.5 concentration of 122.90 ± 2.07 µg/m3 was recorded in August, and it vastly exceeded the standard value stipulated by US EPA and WHO. SNAQ scores and calorie intake were found to be significantly (p < 0.05) associated with changes in PM2.5 exposure of outdoor workers. Several moderate and positive correlations (R-value ranged from 0.4 to 0.6) were established between SNAQ scores, calorie intake and PM2.5 exposure. Overall findings suggested that long hours of PM2.5 exposure affect personal dietary intake, potentially increasing the risk of metabolic syndromes and other undesired health conditions. The current policy should be strengthened to safeguard the well-being of outdoor workers.

Antimicrobial peptides (AMPs) can combat drug-resistant bacteria with their unique membrane-disruptive mechanisms. This study aimed to investigate the antibacterial effects of several membrane-acting peptides with amphipathic structures and positional alterations of two tryptophan residues. The synthetic peptides exhibited potent antibacterial activities in a length-dependent manner against various pathogenic drug-resistant and susceptible bacteria. In particular, the location of tryptophan near the N-terminus of AMPs simultaneously increases their antibacterial activity and toxicity. Furthermore, the growth inhibition mechanisms of these newly designed peptides involve cell penetration and destabilization of the cell membrane. These findings provide new insights into the design of peptides as antimicrobial agents and suggest that these peptides can be used as substitutes for conventional antibiotics.

Objective: To investigate whether support vector machine (SVM) trained with radiomics features based on breast magnetic resonance imaging (MRI) could predict the upgrade of ductal carcinoma in situ (DCIS) diagnosed by core needle biopsy (CNB) after surgical excision., Materials and Methods: This retrospective study included a total of 349 lesions from 346 female patients (mean age, 54 years) diagnosed with DCIS by CNB between January 2011 and December 2017. Based on histological confirmation after surgery, the patients were divided into pure (n = 198, 56.7%) and upgraded DCIS (n = 151, 43.3%). The entire dataset was randomly split to training (80%) and test sets (20%). Radiomics features were extracted from the intratumor region-of-interest, which was semi-automatically drawn by two radiologists, based on the first subtraction images from dynamic contrast-enhanced T1-weighted MRI. A least absolute shrinkage and selection operator (LASSO) was used for feature selection. A 4-fold cross validation was applied to the training set to determine the combination of features used to train SVM for classification between pure and upgraded DCIS. Sensitivity, specificity, accuracy, and area under the receiver-operating characteristic curve (AUC) were calculated to evaluate the model performance using the hold-out test set., Results: The model trained with 9 features (Energy, Skewness, Surface Area to Volume ratio, Gray Level Non Uniformity, Kurtosis, Dependence Variance, Maximum 2D diameter Column, Sphericity, and Large Area Emphasis) demonstrated the highest 4-fold mean validation accuracy and AUC of 0.724 (95% CI, 0.619-0.829) and 0.742 (0.623-0.860), respectively. Sensitivity, specificity, accuracy, and AUC using the test set were 0.733 (0.575-0.892) and 0.7 (0.558-0.842), 0.714 (0.608-0.820) and 0.767 (0.651-0.882), respectively., Conclusion: Our study suggested that the combined radiomics and machine learning approach based on preoperative breast MRI may provide an assisting tool to predict the histologic upgrade of DCIS., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Lee, Park, Nguyen, Do, Park, Lee, Park and Lim.)

UV rays constitute an extremely important environmental factor known to operate adaptative mechanisms that maintain biological homeostasis in the skin, adrenal glands, and the brain. The skin is extremely vulnerable to UV rays. UV rays deform collagen, the main component of elastic fibers, decreasing its normal function, and ultimately reducing skin's elasticity. We confirmed that psychological stress occurring during the early stages of UVB-irradiation degraded collagen function by inhibiting production rather than the decomposition of collagen, thereby promoting skin aging. UV irradiation for 0-2 weeks increased the level of a stress factor, corticosterone (CORT). High-performance liquid chromatography and western blot analysis confirmed that the increase was caused by enhanced CYP11B1/2 levels during steroid synthesis in the adrenal gland. Precursor levels decreased significantly during the two weeks of UV irradiation. Skin collagen and collagen fibers reduced drastically during this time. Furthermore, the administration of osilodrostat, a USFDA-approved drug that selectively inhibits CYP11B1/2, preserved skin collagen. The mechanism underlying the reduction of CORT by osilodrostat confirmed that the amount of skin collagen could be preserved with treatment. In addition, upon suppression of the CORT receptor, the amount of collagen was controlled, and skin aging was suppressed by the hypothalamic-pituitary-adrenal axis. Therefore, this study confirmed an inverse relationship between adrenal CYP11B1/2 levels and collagen during the initial stages of UV irradiation of the skin. The findings of this study may be useful for developing new detection mechanisms for aging, following their further verification., Competing Interests: Conflicts of Interest The authors declare no competing financial interests., (Copyright © 2022 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Chondroid syringoma is a rare benign adnexal tumor and tends to occur in the head and neck region. Involvement in the axilla is very unusual, and the differential diagnosis of such presentations includes lymphadenopathy and cyst. Fine needle aspiration cytology (FNAC) is a very useful tool for the diagnosis of chondroid syringoma. The characteristic feature of chondroid syringoma in cytology is the presence of distinct biphasic cell populations of epithelial and myoepithelial cells in the chondromyxoid stroma. If the typical biphasic cellular and chondromyxoid stromal elements are not visible in smears, it may be misdiagnosed in cytology. Here, we describe a case of axillary chondroid syringoma that was initially misdiagnosed as a metastatic carcinoma by FNAC. Although chondroid syringoma rarely occurs in the axilla, it should be included among the differential diagnoses of an axillary mass. Cytopathologists need to discern the unique cytological features of chondroid syringoma and avoid misdiagnosis for prompt management of the patient., (© 2022 Wiley Periodicals LLC.)

Background: Cells have heterogeneous cellular diversity in size, morphology, cell cycle, metabolism, differentiation degree, and spatial distribution. The shift of specific cells towards the desired cells is crucial for maintaining uniform cellular function and can be represented by homogeneity and heterogeneity. Here, we developed a simple and direct method for evaluating the homogeneous distribution of desired cells in a constant region., Methods: We differentiated osteoclast progenitors into bone-resorbing multinucleated giant osteoclasts in a 2-dimensional culture plate under 2 conditions. Cells were stained with tartrate-resistant acid phosphatase to assess osteoclast differentiation, images were taken using a microscope and divided into sectors, and the number of osteoclasts (≥3 nuclei) in each sector was counted. To assess the homogeneity of the spatial distribution of osteoclasts, the standard deviation (SD) was calculated from the mean number of osteoclasts within each sector., Results: From the 2 groups, a value with a SD close to 0 indicates high spatial homogeneity while a relatively high SD represents low spatial homogeneity., Conclusions: Our findings suggest that spatial homogeneity can be represented as SD.

Background: Macrophages are the major resident immune cells in human airways coordinating responses to infection and injury. In cystic fibrosis (CF), neutrophils are recruited to the airways shortly after birth, and actively exocytose damaging enzymes prior to chronic infection, suggesting a potential defect in macrophage immunomodulatory function. Signaling through the exhaustion marker programmed death protein 1 (PD-1) controls macrophage function in cancer, sepsis, and airway infection. Therefore, we sought to identify potential associations between macrophage PD-1 and markers of airway disease in children with CF., Methods: Blood and bronchoalveolar lavage fluid (BALF) were collected from 45 children with CF aged 3 to 62 months and structural lung damage was quantified by computed tomography. The phenotype of airway leukocytes was assessed by flow cytometry, while the release of enzymes and immunomodulatory mediators by molecular assays., Results: Airway macrophage PD-1 expression correlated positively with structural lung damage, neutrophilic inflammation, and infection. Interestingly, even in the absence of detectable infection, macrophage PD-1 expression was elevated and correlated with neutrophilic inflammation. In an in vitro model mimicking leukocyte recruitment into CF airways, soluble mediators derived from recruited neutrophils directly induced PD-1 expression on recruited monocytes/macrophages, suggesting a causal link between neutrophilic inflammation and macrophage PD-1 expression in CF. Finally, blockade of PD-1 in a short-term culture of CF BALF leukocytes resulted in improved pathogen clearance., Conclusion: Taken together, these findings suggest that in early CF lung disease, PD-1 upregulation associates with airway macrophage exhaustion, neutrophil takeover, infection, and structural damage., Competing Interests: Declaration of Competing Interest None., (Copyright © 2022. Published by Elsevier B.V.)

Bicyclization has proven to be an effective strategy for significantly restricting conformational flexibility in peptides and peptidomimetics such as peptoids. Such constrained bicyclic peptoids would have far higher conformational rigidity than monocyclic and linear ones, allowing them to have enhanced binding affinity and selectivity for their biological targets. Herein, we show that bicyclic peptoids have superior cellular uptake efficiency than their linear counterparts regardless of their side chains and ring sizes. As a representative example, an 8-mer bicyclic peptoid achieves a CP 50 value of 1.2 μM, which is > 5-times superior to the corresponding linear peptoid. Additionally, we also demonstrate that bicyclic peptide-peptoid hybrids are much more cell-permeable than native peptides. Due to their favorable properties including improved cellular uptake, resistance to proteolytic degradation, relatively large sizes, and enormous structural diversity, constrained bicyclic peptoids and peptide-peptoid hybrids will play an important role as potential drug leads, especially in targeting intracellular protein-protein interactions, which are traditionally considered undruggable., (Copyright © 2022. Published by Elsevier Inc.)

Ambient air pollution is a significant contributor to disease burden, leading to an estimated 4.2 million premature deaths and 103.1 million disability-adjusted life years (DALYs) annually worldwide. As industrialization and urbanization surge in Asia, air pollution and its corresponding health issues follow suit. Findings on disease burden in developing countries are extremely scanty. This study aimed to determine the concentration of PM 2.5 and its impact on respiratory health of outdoor workers in Malaysia. A 2-cycled 3-month cohort study involving 440 participants was conducted. Workers' health status was assessed via (1) Total Ocular Symptom Score (TOSS), (2) Total Nasal Symptom Score (TNSS), (3) St. George's Respiratory Questionnaire (SGPQ), and (4) Asthma Control Test (ACT). The maximum PM 2.5 concentration was measured at 122.90 ± 2.07 µg/m 3 during third week of August 2016. Meanwhile, the minimum concentration was measured at 57.47 ± 3.80 µg/m 3 and 57.47 ± 1.64 µg/m 3 during fourth week of July 2016 and first week of August 2017 respectively. Findings revealed that TOSS, TNSS, and SGPQ changes were significantly (p < 0.05) associated with the concentration of PM 2.5 . Outdoor workers were more significantly (p < 0.05) affected by changes in PM 2.5 compared to indoor workers with a moderate correlation (r value ranged from 0.4 to 0.7). Ironically, no significant association was found between ACT assessment and PM 2.5 . Collectively, our findings suggested that changes in the concentration of PM 2.5 threatened the respiratory health of outdoor workers. The existing policy should be strengthened and preventive measures to be enforced safeguarding health status of outdoor workers., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

We investigated the sex-specific association between ferritin and adverse body composition in adults aged over 50 years in a population-based cohort. A total of 25,546 participants (16,912 women; 8634 men) were stratified into three groups by the tertiles of ferritin. The number of adverse body compositions was categorized as 0 (without osteopenia/osteoporosis, low muscle mass, or obesity), 1 (having one of the components), 2 (two), and 3 (all three; osteosarcopenic obesity). As ferritin tertile increased, the prevalence of one, two, or three simultaneous adverse body compositions increased, significant only in women ( p &lt; 0.0001), not in men ( p = 0.125). Among women, the prevalence of osteosarcopenic obesity gradually increased from 1.7% in the lowest, to 2.2% in the middle, and 2.5% in the highest tertile. Using multivariate-adjusted analysis, women in the higher tertile had an increased likelihood of having multiple adverse body compositions compared with those in the lowest tertile. Women in the highest tertile had a 1.52 times increased risk of osteosarcopenic obesity than those in the lowest tertile. A high ferritin level was associated with an increased risk of having multiple adverse body compositions, especially for osteosarcopenic obesity in women aged &gt;50 years, suggesting its potential use for detecting osteosarcopenic obesity.

IgE is central to the development of allergic diseases, and its neutralization alleviates allergic symptoms. However, most of these antibodies are based on IgG1, which is associated with an increased risk of fragment crystallizable-mediated side effects. Moreover, omalizumab, an anti-IgE antibody approved for therapeutic use, has limited benefits for patients with high IgE levels. Here, we assess a fusion protein with extracellular domain of high affinity IgE receptor, FcεRIα, linked to a IgD/IgG4 hybrid Fc domain we term IgE TRAP, to reduce the risk of IgG1 Fc-mediated side effects. IgE TRAP shows enhanced IgE binding affinity compared to omalizumab. We also see an enhanced therapeutic effect of IgE TRAP in food allergy models when combined with Bifidobacterium longum, which results in mast cell number and free IgE levels. The combination of IgE TRAP and B. longum may therefore represent a potent treatment for allergic patients with high IgE levels., (© 2022. The Author(s).)

Background: Left ventricular assist device (LVAD) implantation significantly impacts on a recipient's symptoms and quality of life. Capturing their experiences and post implant journey is an important part of clinical practice, research and device design evolution. Patient reported outcome measures (PROMs) are a useful tool for capturing that experience. However, patient reported outcome measures need to reflect recipients' experiences. Discussions with a patient partner group found that none of the frequently used cardiology PROMs captured their unique experiences., Aims: To capture the experiences and important issues for LVAD recipients. Develop a conceptual map of domains and items that should be reflected in patient reported outcomes., Methods: Group concept mapping (GCM) web-based software was used to remotely capture and structure recipients' experiences across a wide geographical area. GCM is a semi-quantitative mixed method consisting of 3 stages: item generation, item sorting and rating (importance, relevance and frequency). Patient partners were involved in all aspects of the study design and development., Results: 18 LVAD recipients consented to take part. 101 statements were generated and multi-dimensional scaling, and hierarchical cluster analysis identified 9 clusters. Cluster themes included: Activities, Partner/family support, Travel, Mental wellbeing, Equipment and clothing, Physical and cognitive limitations, LVAD Restrictions, LVAD Challenges and positive impact of the LVAD (LVAD Positives). LVAD Positives were scored highest across all the rating variables, e.g., frequency (2.85), relevance (2.44) and importance (2.21). Other domains rated high for importance included physical and cognitive limitations (2.19), LVAD restrictions (2.11), Partner/family support (2.02), and Equipment and clothing (2.01)., Conclusion: Online GCM software facilitated the inclusion of geographically dispersed recipients and provided useful insights into the experiences of LVAD recipients. The conceptual framework identifies important domains and items that should be prioritised and included in patient reported outcomes in future research, LVAD design evolution, and clinical practice., Competing Interests: The authors have declared no competing interests exist.

A national study was conducted in Brunei to assess and compare the immunogenicity of the various brands of COVID-19 vaccines administered to the population as part of the National COVID-19 Vaccination Programme. Most of the population have had received at least 2 doses of BBIBP-CorV, AZD1222 or MRNA-1273 vaccines. Neutralising antibodies against SARS-CoV-2 induced by these vaccines will be analysed to infer population-level immune protection against COVID-19. During the 5-week recruitment period, 24,260 eligible individuals were invited to the study via SMS, out of which 2,712 participants were enrolled into the study. This paper describes the novel adaptive strategy used to recruit the study participants. Digital technology was leveraged to perform targeted online recruitment to circumvent the limitations of traditional recruitment methods. Technology also enabled stratified random selection of these eligible individuals who were stratified based on age, gender and vaccine brand. Data was extracted from the electronic health records, the national mobile health application and a third-party survey platform and integrated into a dedicated research platform called EVYDResearch. The instant availability and access to up-to-date data on EVYDResearch enabled the study team to meet weekly and adopt an adaptive recruitment strategy informed by behavioural science, where interventions could be quickly implemented to improve response rates. Some examples of these include incorporating nudge messaging into SMS invitations, involving the Minister of Health to make press announcements on this study, media coverage, setting up an enquiries hotline and reaching out to foreign language speaking expatriates of a local multinational company to participate in this study. Data integration from various data sources, real time information sharing and a strong teamwork led to good outcomes adaptable to the progress of recruitment, compared to the more time-consuming and static traditional recruitment methods., Competing Interests: Author CS is a part-time employee of EVYD Technology Limited which was the technology partner and research collaborator of this study. EVYD Technology Limited is the developer of EVYDResearch, BruHealth and EVYDENCE platforms. SC, YWe, YWa, AL, and HL are full-time employees of EVYD Technology Limited. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Shim, Chan, Wei, Ghani, Ahmad, Sharif, Alikhan, Haji Bagol, Taib, Tan, Ong, Wang, Wang, Liu, Lim, Wong, Naing and Cunningham.)

Importance: Fractional flow reserve (FFR) after percutaneous coronary intervention (PCI) is generally considered to reflect residual disease. Yet the clinical relevance of post-PCI FFR after drug-eluting stent (DES) implantation remains unclear., Objective: To evaluate the clinical relevance of post-PCI FFR measurement after DES implantation., Data Sources: MEDLINE, Embase, and the Cochrane Central Register of Controlled Trials were searched for relevant published articles from inception to June 18, 2022., Study Selection: Published articles that reported post-PCI FFR after DES implantation and its association with clinical outcomes were included., Data Extraction and Synthesis: Patient-level data were collected from the corresponding authors of 17 cohorts using a standardized spreadsheet. Meta-estimates for primary and secondary outcomes were analyzed per patient and using mixed-effects Cox proportional hazard regression with registry identifiers included as a random effect. All processes followed the Preferred Reporting Items for Systematic Review and Meta-analysis of Individual Participant Data., Main Outcomes and Measures: The primary outcome was target vessel failure (TVF) at 2 years, a composite of cardiac death, target vessel myocardial infarction (TVMI), and target vessel revascularization (TVR). The secondary outcome was a composite of cardiac death or TVMI at 2 years., Results: Of 2268 articles identified, 29 studies met selection criteria. Of these, 28 articles from 17 cohorts provided data, including a total of 5277 patients with 5869 vessels who underwent FFR measurement after DES implantation. Mean (SD) age was 64.4 (10.1) years and 4141 patients (78.5%) were men. Median (IQR) post-PCI FFR was 0.89 (0.84-0.94) and 690 vessels (11.8%) had a post-PCI FFR of 0.80 or below. The cumulative incidence of TVF was 340 patients (7.2%), with cardiac death or TVMI occurring in 111 patients (2.4%) at 2 years. Lower post-PCI FFR significantly increased the risk of TVF (adjusted hazard ratio [HR] per 0.01 FFR decrease, 1.04; 95% CI, 1.02-1.05; P < .001). The risk of cardiac death or MI also increased inversely with post-PCI FFR (adjusted HR, 1.03; 95% CI, 1.00-1.07, P = .049). These associations were consistent regardless of age, sex, the presence of hypertension or diabetes, and clinical diagnosis., Conclusions and Relevance: Reduced FFR after DES implantation was common and associated with the risks of TVF and of cardiac death or TVMI. These results indicate the prognostic value of post-PCI physiologic assessment after DES implantation.

Background: The optimal duration of dual-antiplatelet therapy (DAPT) after implantation of a drug-eluting stent (DES), especially recently developed polymer-free DESs, is unknown. This study examined the efficacy and safety of 3- versus 6-month DAPT in patients implanted with Coroflex ISAR polymer-free DESs., Methods: Between May 2015 and August 2020, 488 patients who underwent Coroflex ISAR stent implantation were enrolled in the study and randomly assigned to the 3-month (n=244) or 6-month (n=244) DAPT group., Results: At 1 year, the primary endpoint (composite of cardiovascular death, myocardial infarction, target vessel revascularization, and Bleeding Academic Research Consortium [BARC] type 2-5 bleeding) occurred in 9 (3.7%) patients in the 3-month DAPT group and in 7 (2.9%) patients in the 6-month DAPT group (hazard ratio 1.31; P=.60). There was no difference between the 3- and 6-month DAPT groups in either BARC type 2-5 bleeding (1.6% vs 0.8%; hazard ratio 2.00; P=.42) or any bleeding (2.9% vs 3.3%; hazard ratio 0.87; P=.80)., Conclusion: Compared with 6 months of DAPT, 3 months of DAPT did not increase the risk of primary endpoint 1 year after Coroflex ISAR stent implantation, although it should be noted that the trial has limited power to see differences due to low event rate and low recruitment rate.

Backgrounds: Canine mammary gland tumors (CMGTs) are heterogeneous tumors and share many similar features with human breast cancer. Despite the improvement of current treatment options, new treatment modalities are required to effectively kill tumor cells without general toxicity in the treatment of CMGTs. Photodynamic therapy (PDT) is a promising method for cancer treatment. However, there is a limited study evaluating the therapeutic efficacy of PDT in the treatment of CMGTs., Methods: In this context, we, for the first time, investigated the therapeutic potential of 5-aminolaevulinic acid (5-ALA) mediated PDT at 6 and 12 J/cm 2 in two different subtypes [Tubulopapillary carcinoma (TPC) and carcinosarcoma (CS)] cells via different molecular analysis. The cytotoxic effects of 5-ALA/PDT on these cells were analyzed by intracellular PpIX level, WST-1 and ROS analysis. Furthermore, the underlying moleculer mechanism of 5-ALA/PDT mediated apoptotic effects on TPC and CS cells were evaluated Annexin V, AO/PI, RT-PCR and western blot analysis., Results: The 5-ALA/PDT treatment upon irradiation considerably inhibited the viability of both TPC and CS cells (p<0.01) and caused apoptotic death through elevated ROS levels, the activation of Caspase-9, and Caspase-3, and the overexpression of Bax. However, the response of TPC and CS cells to 5-ALA/PDT was different., Conclusions: Our preliminary in vitro findings provide novel insights into the molecular mechanisms underlying 5-ALA/PDT mediated apoptosis in both TPC and CS cells. However, the therapeutic response of CMGT cells to 5-ALA/PDT is limited., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier B.V. All rights reserved.)

A simple ionic chromatography method for nitrite analysis in processed food products was developed and validated. Nitrite in the sample was extracted using 80 °C distilled deionized water and centrifuged. Purification of nitrite from sample solution was performed using OnGuard II Ag, OnGuard II RP and OnGuard II Na cartridge connected in order. Determination of nitrite was carried out using IonPac AG9-HC (4 × 50 mm) and IonPac AS9-HC (4 × 250 mm) columns and a 9 mM sodium carbonate mobile phase. The validated results showed good linearity (r 2  > 0.999), recoveries (83.7-107.6%) and precision (1.3-5.1%). The levels of nitrite in processed food products were between n.d. to 33.5 mg/kg, and nitrite was detected in ham, sausage and bacon products. The mean nitrite intake was 2.7% of the Acceptable Daily Intake (ADI, 0.07 mg/kg bw/day) for the Korean population. The method was suitable for the analysis of nitrite in processed foods., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

Despite their economic significance in agricultural cropping systems, a lack of suitable molecular tools for manipulating gene expression has hindered progress in the functional genomics of plant parasitic nematodes (PPN). Obligate sexual reproduction and the obligate nature of PPN-host interactions further complicate the development of in vivo gene delivery and expression systems in these pests. Methods such as microinjection and microprojectile bombardment have been developed for introducing gene constructs into the free-living nematode, Caenorhabditis elegans. However, these procedures can be laborious and inefficient. Electroporation has been used extensively to introduce macromolecules, including single-stranded RNAs, into eukaryotic and prokaryotic cells. The technique has also been used for the delivery of DNA and double-stranded RNA constructs into nematodes by whole-animal electroporation. Here, we describe methods for the expression of a nematode-optimized NanoLuc luciferase mRNA in the form of in vitro transcripts following whole-animal electroporation of Heterodera glycines, Meloidogyne incognita, and C. elegans. The ability to transiently express single-stranded RNA constructs in economically important PPN provides a rapid means to evaluate nematode and/or foreign genes for their biological significance and potential role in nematode management., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Parkinson disease (PD) is a prevalent neurodegenerative disorder that is characterized by motor and behavioral disturbances, including resting tremors, rigidity, bradykinesia, and postural instability. The primary cause of PD is the degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNpc) region that subsequently reduces the dopamine content in the striatum (ST); this is a promising therapeutic target for PD. Resilin is an elastomeric protein with high strain, low stiffness, and high resilience that is found in insect cuticles. However, scant evidence supports the application of resilin in neurodegenerative diseases, including PD. Herein, we investigated the protective effects of resilin on 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced PD in mouse models and explored the mechanisms underlying its action. Resilin significantly and concentration-dependently reduced 1-methyl-4-phenylpyridinium + (MPP + )-induced apoptotic neurotoxicity in differentiated PC12 and SH-SY5Y cells. Moreover, resilin prevented dopamine depletion in ST, and immunohistochemical findings indicated that resilin protects against dopaminergic neuronal loss induced by MPTP in the SNpc and ST. Behavioral studies using pole and rotarod tests showed significantly improved PD-related motor impairment in mice treated with resilin. We then explored the molecular mechanisms underlying the apoptosis of dopaminergic neurons using protein arrays and discovered that resilin inhibits dopaminergic neuronal death through the apoptosis signaling factors cytochrome c and caspases-9 and -3 in the SNpc. Thus, resilin has potential in treating PD by controlling apoptosis signals., (Copyright © 2022. Published by Elsevier B.V.)

Three infectious clones of radish mosaic virus (RaMV) were generated from isolates collected in mainland Korea (RaMV-Gg) and Jeju Island (RaMV-Aa and RaMV-Bb). These isolates differed in sequences and pathogenicity. Examination of the wild-type isolates and reassortants between the genomic RNA1 and RNA2 of these three isolates revealed that severe symptoms were associated with RNA1 of isolates Aa or Gg causing systemic necrosis in Nicotiana benthamiana , or with RNA1 of isolate Bb for induction of veinal necrosis and severe mosaic symptoms in radish. Reverse transcription, followed by quantitative real-time PCR (Q-RT-PCR), results from infected N . benthamiana confirmed that viral RNA2 accumulation level was correlated to RaMV necrosis-inducing ability, and that the RNA2 accumulation level was mostly dependent on the origin of RNA1. However, in radish, Q-RT-PCR results showed more similar viral RNA2 accumulation levels regardless of the ability of the isolate to induce necrosis. Phylogenetic analysis of genomic RNAs sequence including previously characterized isolates from North America, Europe, and Asia suggest possible recombination within RNA1, while analysis of concatenated RNA1+RNA2 sequences indicates that reassortment of RNA1 and RNA2 has been more important in the evolution of RaMV isolates than recombination. Korean isolate Aa is a potential reassortant between isolates RaMV-J and RaMV-TW, while isolate Bb might have evolved from reassortment between isolates RaMV-CA and RaMV-J. The Korean isolates were shown to also be able to infect Chinese cabbage, raising concerns that RaMV may spread from radish fields to the Chinese cabbage crop in Korea, causing further economic losses.

Background: Coronary stent dislodgement can cause critical complications. The dislodgement force of coronary drug-eluting stents (DES) remains unknown. This study aimed to compare the dislodgement force and pattern of contemporary DES., Methods: Five DES designs which commonly used in clinical practice were tested. The force at which the stent dislodges relative to the balloon was measured. For the shim test, peak displacement force, defined as the first peak force that occurs during stent displacement and peak dislodgement force, defined as the peak force required to completely dislodge the stent from the delivery system, were measured. Three examples of each of the stents were tested using the shim test., Results: The peak displacement force of Orsiro (3.1±0.8 N) was lower than that of Xience Sierra (5.8±0.5 N) [Firehawk 3.8±0.2 N, Resolute Onyx 4.5±1.5 N, Synergy 4.8±0.5 N (P=0.024)]. The peak dislodgement force was lowest in Orsiro (3.2±0.8 N) when compared to the other stents (Firehawk 6.6±0.6 N, Resolute Onyx 7.4±0.3 N, Synergy 11.8±0.4 N, Xience Sierra 11.1±1.6 N) (P<0.001); this remained significant in the multiple comparison analysis. During pullback of the stents, most stents buckled without removal. However, the whole Orsiro stent was completely removed from the delivery system., Conclusions: The dislodgement force of DESs differed between stent designs. The Orsiro stent was lower than that of other DES; additionally, it easily removed the whole stent from the delivery system. During the coronary intervention, operators should consider stent design and be cautious when pulling DES back in lesions with calcifications or a previously implanted stent, which are at high risk for stent dislodgement., Competing Interests: Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://cdt.amegroups.com/article/view/10.21037/cdt-22-49/coif). The authors have no conflicts of interest to declare., (2022 Cardiovascular Diagnosis and Therapy. All rights reserved.)

Potato virus X (PVX), a species of the genus Potexvirus , is a plant pathogenic virus that causes severe symptoms such as mild mosaic, crinkling, necrosis, and mottling on leaves. The objectives of the present study were to investigate the effect of PVX virus infection on the metabolic system in nontransgenic and Arabidopsis thaliana production of anthocyanin pigment 1 ( AtPAP 1) transgenic tobacco using transcript expression analysis and metabolic profiling. Potato virus X inoculation increased the gene expression of phenylpropanoid and flavonoid biosynthesis and the production of chlorogenic acid, p -coumaric acid, benzoic acid, rutin, quercetin, and kaempferol in nontransgenic tobacco leaves. However, in the AtPAP 1 transgenic tobacco leaves, PVX inoculation decreased the expression of AtPAP 1 and phenylpropanoid and flavonoid biosynthesis genes, and the production of phenolics and anthocyanin also declined. In contrast, the levels of amino acids and tricarboxylic acid (TCA) cycle intermediates increased after infection in the AtPAP 1 transgenic plant leaves. To date, these results have not been reported previously. We suggest that PVX infection decreases AtPAP 1 expression, leading to the downregulation of phenylpropanoid and flavonoid biosynthesis in transgenic plants.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae , has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato ( Solanum lycopersicum ) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

Background: There are few reports of mechanical circulatory support (MCS) in patients with cardiogenic shock (CS) due to end-stage heart failure (ESHF). We evaluated our institutional MCS strategy and compared the outcomes of INTERMACS 1 and 2 patients with CS due to ESHF., Methods: Retrospective analysis of prospectively collected data (November 2014 to July 2019) from a single centre. ESHF was defined by a diagnosis of HF prior to presentation with CS. Other causes of CS (eg: acute myocardial infarction) were excluded. We compared the clinical course, complications and 90-day survival of patients with CS due to ESHF in INTERMACS profile 1 and 2., Results: We included 60 consecutive patients with CS due to ESHF Differences in baseline characteristics were consistent with the INTERMACS profiles. The duration of MCS was similar between INTERMACS 1 and 2 patients (14 (10-33) vs 15 (7-23) days, p = 0.439). There was no significant difference in the number of patients with complications that required intervention. Compared to INTERMACS 2, INTERMACS 1 patients had more organ dysfunction on support and significant lower 90-day survival (66% vs 34%, p = 0.016)., Conclusion: Our temporary MCS strategy, including earlier intervention in patients with CS due to ESHF at INTERMACS 2 was associated with less organ dysfunction and better 90-day survival compared to INTERMACS 1 patients., Competing Interests: Declaration of conflicting interests: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article., (© The Intensive Care Society 2021.)

Background/aims: The composition of the microbiota in the esophagus is only partially understood, especially in patients with achalasia. We aim to investigate the esophageal microbial community and nutritional intakes in patients with achalasia before and after peroral endoscopic myotomies (POEM)., Methods: Twenty-nine patients were prospectively enrolled from 4 referral institutions across Korea. We collected esophageal samples (mucosal biopsies and retention fluid) and conducted dietary surveys for nutritional intake before and 8 weeks after POEM. The esophageal microbiota was analyzed by 16S rRNA gene sequencing targeting the V3-V4 region., Results: Out of the 105 samples from 29 patients, 99 samples were subjected to microbial bioinformatic analysis after quality control, which excluded samples with no amplification or low-quality sequence data. The overall esophageal microbial compositions of patients with achalasia showed that Firmicutes, Bacteroidetes, Proteobacteria, Actinobacteria, and Fusobacteria were the dominant phyla, representing over 95% of the total phyla in all groups. At the genus level, Streptococcus was the most abundant in all groups. The observed operational taxonomic unit number was significantly higher in the retention fluid than in the tissue biopsies. However, the esophageal microbial composition showed no significant changes 8 weeks post POEM. The dietary survey analysis showed that nutritional intake significantly improved post POEM., Conclusion: This study determined the unique esophageal microbial composition of patients with achalasia, and also found that the microbial composition did not significantly change after POEM in the short-term, despite a significant improvement in the nutritional intake.

This study sought to investigate the effects of the enhanced recovery after surgery (ERAS) program on postoperative recovery and nutritional status in patients with colorectal cancer undergoing laparoscopic surgery. A total of 37 patients were included: 19 in the experimental group and 18 in the control group. The experimental group was supplemented with carbohydrate drinks before and after surgery, and the control group was maintained with fasting and water intake in the traditional method. Both care management and nutrition education were implemented for both groups. Patients were evaluated for physical condition, clinical indicators, blood tests, pain, length of stay, nutritional status, and nutrient intake. Use of the ERAS program for the experimental group resulted in shorter length of stay ( p = 0.006), less pain ( p < 0.001), and a lower rate of malnutrition ( p = 0.014) compared with controls. In conclusion, carbohydrate drinks provide great advantages by reducing discomfort, such as pain or thirst, during fasting in patients after colon cancer surgery, helping patients to eat comfortably and actively, minimizing insulin resistance, maintaining nitrogen balance, and reducing infection and anastomosis leakage. For use of ERAS as a standardized program, repeated and expanded research is needed, and a Korean-style ERAS should be prepared by using this approach for various diseases., Competing Interests: Conflict of Interest: The authors declare that they have no competing interests., (Copyright © 2022. The Korean Society of Clinical Nutrition.)

Aim: Higenamine [1-[(4-hydroxyphenyl) methyl]-1, 2, 3, 4-tetrahydroisoquinoline-6, 7-diol], a potent cardiotonic compound from Aconitum , contributes to vascular relaxation and bronchodilation. However, the effects and mechanisms of action of higenamine on skin aging remain poorly understood. In this study, the effects of higenamine on UVB-induced photoaging were examined in the hairless mouse model., Methods: The dorsal skin of hairless mice (CrlOri : SKH1) was exposed to chronic UVB irradiation (100-300 mJ/cm 2 for 6 weeks), with subsequent administration of higenamine (1-20 mg/kg, p.o.) for 2 weeks. TGF- β , Smad3 DNA-binding phosphorylation, and COL1A1 levels were analyzed by immunohistochemistry, and histological analysis of the skin was performed via H&E and MT staining., Results: Higenamine increased TGF- β , Smad3 DNA-binding phosphorylation, and COL1A1 expression in primary human fibroblast cells and mouse skin. Higenamine suppressed UVB-induced photoaging via skin recovery, improved epidermal thickness, and prevented Smad3, DNA-binding phosphorylation, and COL1A1 depletion via TGF- β signaling., Conclusion: Higenamine enhances collagen production in the skin through TGF- β /Smad3 signaling and potentially suppresses UVB-induced skin aging., Competing Interests: The authors declare that they have no conflicts of interest., (Copyright © 2022 Hye-Sun Lim et al.)

Despite cobalt (Co)-free/nickel (Ni)-rich layered oxides being considered as one of the promising cathode materials due to their high specific capacity, their highly reactive surface still hinders practical application. Herein, a polyimide/polyvinylpyrrolidone (PI/PVP, denoted as PP) coating layer is demonstrated as dual protection for the LiNi 0.96 Mg 0.02 Ti 0.02 O 2 (NMT) cathode material to suppress surface contamination against moist air and to prevent unwanted interfacial side reactions during cycling. The PP-coated NMT (PP@NMT) preserves a relatively clean surface with the bare generation of lithium residues, structural degradation, and gas evolution even after exposure to air with ∼30% humidity for 2 weeks compared to the bare NMT. In addition, the exposed PP@NMT significantly enhances the electrochemical performance of graphite||NMT cells by preventing byproducts and structural distortion. Moreover, the exposed PP@NMT achieves a high capacity retention of 86.7% after 500 cycles using an advanced localized high-concentration electrolyte. This work demonstrates promising protection of Co-free/Ni-rich layered cathodes for their practical usage even after exposure to moist air.

Coronary artery calcium (CAC), which can be measured in various types of computed tomography (CT) examinations, is a hallmark of coronary artery atherosclerosis. However, despite the clinical value of CAC scores in predicting cardiovascular events, routine measurement of CAC scores is limited due to high cost, radiation exposure, and lack of widespread availability. It would be of great clinical significance if CAC could be predicted by electrocardiograms (ECGs), which are cost-effective and routinely performed during various medical checkups. We aimed to develop binary classification artificial intelligence (AI) models that predict CAC using only ECGs as input. Moreover, we aimed to address the generalizability of our model in different environments by externally validating our model on a dataset from a different institution. Among adult patients, standard 12-lead ECGs were extracted if measured within 60 days before or after the CAC scores, and labeled with the corresponding CAC scores. We constructed deep convolutional neural network models based on residual networks using only the raw waveforms of the ECGs as input, predicting CAC at different levels, namely CAC score ≥100, ≥400 and ≥1,000. Our AI models performed well in predicting CAC in the training and internal validation dataset [area under the receiver operating characteristics curve (AUROC) 0.753 ± 0.009, 0.802 ± 0.027, and 0.835 ± 0.024 for the CAC score ≥100, ≥400, and ≥1,000 model, respectively]. Our models also performed well in the external validation dataset (AUROC 0.718, 0.777 and 0.803 for the CAC score ≥100, ≥400, and ≥1,000 model, respectively), indicating that our model can generalize well to different but plausibly related populations. Model performance in terms of AUROC increased in the order of CAC score ≥100, ≥400, and ≥1,000 model, indicating that higher CAC scores might be associated with more prominent structural changes of the heart detected by the model. With our AI models, a substantial proportion of previously unrecognized CAC can be afforded with a risk stratification of CAC, enabling initiation of prophylactic therapy, and reducing the adverse consequences related to ischemic heart disease., Competing Interests: DY and TK are employees of BUD.on Inc. BUD.on Inc. did not have any role in the study design, analysis, decision to publish, or preparation of the manuscript. There are no patents, products in development, or marketed products to declare. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Han, Kang, Kim, Uhm, Park, Jung, Kim, Bae, Lim and Yoon.)

In this work, two new turnip mosaic virus (TuMV) strains (Canola-12 and Canola-14) overcoming resistance in canola (Brassica napus) were isolated from a B. napus sample that showed typical TuMV-like symptoms and was collected in the city of Gimcheon, South Korea, in 2020. The complete genome sequence was determined and an infectious clone was made for each isolate. Phylogenetic analysis indicated that the strains isolated from canola belonged to the World-B group. Both infectious clones, which used 35S and T7 promoters to drive expression, induced systemic symptoms in Nicotiana benthamiana and B. napus. To our knowledge, this is the first report of TuMV infecting B. napus in South Korea., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Perilla is an annual herb with a unique aroma and taste that has been cultivated in Korea for hundreds of years. It has been widely cultivated in many Asian and European countries as a food and medicinal crop. Recently, several viruses have been reported to cause diseases in perilla in Korea, including turnip mosaic virus (TuMV), which is known as a brassica pathogen due to its significant damage to brassica crops. In this study, we determined the complete genome sequences of two new TuMV isolates originating from perilla in Korea. Full-length infectious cDNA clones of these two isolates were constructed, and their infectivity was tested by agroinfiltration of Nicotiana benthamiana and sap inoculation of Chinese cabbage and radish plants. In addition, we analyzed the phylogenetic relationship of six new Korean TuMV isolates to members of the four major groups. We also used RDP4 software to conduct recombination analysis of recent isolates from Korea, which provided new insight into the evolutionary relationships of Korean isolates of TuMV., (© 2022. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Background & Aims: Cardiovascular disease remains a leading cause of mortality following liver transplantation (LT). Whether it may be partially attributable to accelerated development of subclinical coronary artery disease is unclear. We sought to assess the longitudinal effect of LT on coronary plaque burden., Methods: A prospective observational study was conducted in 30 asymptomatic patients who underwent computed tomographic coronary angiography (CTCA) pre- and a median 4-years following LT. Serial changes were quantified using coronary artery calcium score (CACS) and semi-quantitative CTCA scores, in a blinded fashion. High-risk plaque (HRP) characteristics were also assessed. Plaque progression was defined using prognostically significant cut-offs., Results: In the study population (age 59.8 ± 8 years, 80% male), 93 of 459 coronary segments had plaque at baseline. On follow-up CTCA, 68 (+73.1%) new lesions appeared in segments without plaque initially. Nineteen (63.3%) patients demonstrated a clinically significant rise in plaque burden on CACS and semi-quantitative indices on CTCA (all p<0.001). CAD-RADS score rose to ≥4 (≥70% stenosis) in 9 (30%) patients, necessitating ischemia-guided revascularization in 3 (10%) patients. While the absence of coronary calcification or plaque pre-LT was protective, presence of HRP and development of post-transplant metabolic syndrome were both strong independent predictors of atherosclerosis progression., Conclusions: Our findings suggest that LT is associated with early progression of coronary atherosclerosis. Accelerated progression was noted particularly in those with HRP and post-transplant metabolic syndrome. Understanding the mechanisms of this novel observation and the potential role of preventive cardiovascular therapies in this population merit further study., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Canine mammary gland tumors (CMGTs) are heterogeneous disease and subclassified [sarcomas (S), carcinomas (C), and carcinosarcomas (CS)] according to histopathological differentiation. Photodynamic therapy (PDT) is a promising treatment strategy based on the use of a photosensitizer (PS) activated by light. However, the therapeutic potential of PDT in the treatment of CMGTs has not been investigated, yet. Therefore, the aim of this study was to determine the in vitro protocol of 5-ALA-based-PDT for the treatment of three subtypes of CMGTs, for the first time. The intracellular PpIX florescence intensity was measured for 5-ALA (0.5 and 1 mM). After irradiation with different light doses (6, 9, 12, 18, and 24 J/cm 2 ) for two different modes [continuous wave (CW) and pulse radiation (PR)], the cytotoxic effects of 5-ALA (0.5 and 1 mM) on the subtypes (C, S, and CS) of CMGTs were analyzed by WST-1. Finally, the optimal PDT treatment protocol was validated through Annexin V and AO/EtBr staining. Our results showed that 1 mM 5-ALA for 4-h incubation was the best treatment condition in all subtypes of CMGTs due to higher intracellular PpIX level. After irradiation with different light doses, PR mode was more effective in S primary cells at 9 J/cm 2 . However, a significant decrease in the viability of C and CS cells was detected at 12 /cm 2 in CW mode (p < 0.05). Additionally, 1 mM 5-ALA induced apoptotic cell death in each subtype of CMGTs. Our preliminary findings suggest that (i) each subtype of CMGTs differentially responds to PDT and (ii) the light dose and mode could play an important role in the effective PDT treatment. However, further studies are needed to investigate the role of the different light sources and PDT-based apoptotic cell death in CMGTs cells., (© 2021. The Author(s), under exclusive licence to Springer-Verlag London Ltd., part of Springer Nature.)

Importance: More than 1 billion adults have hypertension globally, of whom 70% cannot achieve their hypertension control goal with monotherapy alone. Data are lacking on clinical use patterns of dual combination therapies prescribed to patients who escalate from monotherapy., Objective: To investigate the most common dual combinations prescribed for treatment escalation in different countries and how treatment use varies by age, sex, and history of cardiovascular disease., Design, Setting, and Participants: This cohort study used data from 11 electronic health record databases that cover 118 million patients across 8 countries and regions between January 2000 and December 2019. Included participants were adult patients (ages ≥18 years) who newly initiated antihypertensive dual combination therapy after escalating from monotherapy. There were 2 databases included for 3 countries: the Iqvia Longitudinal Patient Database (LPD) Australia and Electronic Practice-based Research Network 2019 linked data set from South Western Sydney Local Health District (ePBRN SWSLHD) from Australia, Ajou University School of Medicine (AUSOM) and Kyung Hee University Hospital (KHMC) databases from South Korea, and Khoo Teck Puat Hospital (KTPH) and National University Hospital (NUH) databases from Singapore. Data were analyzed from June 2020 through August 2021., Exposures: Treatment with dual combinations of the 4 most commonly used antihypertensive drug classes (angiotensin-converting enzyme inhibitor [ACEI] or angiotensin receptor blocker [ARB]; calcium channel blocker [CCB]; β-blocker; and thiazide or thiazide-like diuretic)., Main Outcomes and Measures: The proportion of patients receiving each dual combination regimen, overall and by country and demographic subgroup., Results: Among 970 335 patients with hypertension who newly initiated dual combination therapy included in the final analysis, there were 11 494 patients from Australia (including 9291 patients in Australia LPD and 2203 patients in ePBRN SWSLHD), 6980 patients from South Korea (including 6029 patients in Ajou University and 951 patients in KHMC), 2096 patients from Singapore (including 842 patients in KTPH and 1254 patients in NUH), 7008 patients from China, 8544 patients from Taiwan, 103 994 patients from France, 76 082 patients from Italy, and 754 137 patients from the US. The mean (SD) age ranged from 57.6 (14.8) years in China to 67.7 (15.9) years in the Singapore KTPH database, and the proportion of patients by sex ranged from 24 358 (36.9%) women in Italy to 408 964 (54.3%) women in the US. Among 12 dual combinations of antihypertensive drug classes commonly used, there were significant variations in use across country and patient subgroup. For example starting an ACEI or ARB monotherapy followed by a CCB (ie, ACEI or ARB + CCB) was the most commonly prescribed combination in Australia (698 patients in ePBRN SWSLHD [31.7%] and 3842 patients in Australia LPD [41.4%]) and Singapore (216 patients in KTPH [25.7%] and 439 patients in NUH [35.0%]), while in South Korea, CCB + ACEI or ARB (191 patients in KHMC [20.1%] and 1487 patients in Ajou University [24.7%]), CCB + β-blocker (814 patients in Ajou University [13.5%] and 217 patients in KHMC [22.8%]), and ACEI or ARB + CCB (147 patients in KHMC [15.5%] and 1216 patients in Ajou University [20.2%]) were the 3 most commonly prescribed combinations. The distribution of 12 dual combination therapies were significantly different by age and sex in almost all databases. For example, use of ACEI or ARB + CCB varied from 873 of 3737 patients ages 18 to 64 years (23.4%) to 343 of 2292 patients ages 65 years or older (15.0%) in South Korea's Ajou University database (P for database distribution by age < .001), while use of ACEI or ARB + CCB varied from 2121 of 4718 (44.8%) men to 1721 of 4549 (37.7%) women in Australian LPD (P for drug combination distributions by sex < .001)., Conclusions and Relevance: In this study, large variation in the transition between monotherapy and dual combination therapy for hypertension was observed across countries and by demographic group. These findings suggest that future research may be needed to investigate what dual combinations are associated with best outcomes for which patients.

Understanding the immune response to hydrogel implantation is critical for the design of immunomodulatory biomaterials. To study the progression of inflammation around poly(ethylene glycol) hydrogels presenting Arg-Gly-Asp (RGD) peptides and vascular endothelial growth factor, we used temporal analysis of high-dimensional flow cytometry data paired with intravital imaging, immunohistochemistry, and multiplexed proteomic profiling. RGD-presenting hydrogels created a reparative microenvironment promoting CD206 + cellular infiltration and revascularization in wounded dorsal skin tissue. Unbiased clustering algorithms (SPADE) revealed significant phenotypic transition shifts as a function of the cell-adhesion hydrogel properties. SPADE identified an intermediate macrophage subset functionally regulating in vivo cytokine secretion that was preferentially recruited for RGD-presenting hydrogels, whereas dendritic cell subsets were preferentially recruited to RDG-presenting hydrogels. Last, RGD-presenting hydrogels controlled macrophage functional cytokine secretion to direct polarization and vascularization. Our studies show that unbiased clustering of single-cell data provides unbiased insights into the underlying immune response to engineered materials.

Purpose: The combined administration of tadalafil, a phosphodiesterase-5 inhibitor, and amlodipine, a calcium channel blocker, can be a promising therapeutic option for hypertension patients with erectile dysfunction. This study aimed to examine the pharmacokinetic drug interaction between tadalafil and amlodipine and the tolerability of their combined administration in healthy male subjects., Subjects and Methods: Healthy volunteers (N = 24) were randomly assigned to one of the six sequences that consisted of three treatments: tadalafil (5 mg) alone, amlodipine (10 mg) alone, and tadalafil plus amlodipine. The study drugs were administered orally for 9 d, and the collected serial blood samples were analyzed up to 72 h after the last dosing. Pharmacokinetic parameters were calculated using non-compartmental analysis., Results: For tadalafil, geometric mean ratios (GMRs) (90% confidence interval (CI)) of the combined therapy over the monotherapy were 1.57 (1.46-1.68) for AUC τ,ss and 1.34 (1.24-1.45) for C max,ss . For amlodipine, the GMRs (90% CI) of AUC τ,ss and C max,ss were 0.93 (0.90-0.97) and 0.95 (0.91-0.99), respectively. The severity of all observed adverse events (AEs) related to the study drugs was mild, and the frequency of AEs of the combined administration was not significantly different from the monotherapy., Conclusion: A substantial pharmacokinetic drug interaction between tadalafil and amlodipine was observed with respect to the concentration of tadalafil when administered concomitantly. However, the dose range of the combined administration of tadalafil and amlodipine in the present study was well tolerated by the subjects., Competing Interests: Jina Jung and Junghee Hong are employees of Hanmi Pharmaceutical Co. Ltd. Prof. Dr. Hyeong-Seok Lim reports grants from Hanmi Pharmaceutical Company, outside the submitted work. The other authors report no conflicts of interest in this work., (© 2022 Kim et al.)

Delpazolid, an oxazolidinone, has been studied in non-clinical studies of efficacy and toxicity and Phase 1 clinical studies. Delpazolid has in vitro activity against Gram-positive bacteria, including Mycobacterium tuberculosis. This study evaluated the bactericidal activity, safety, and pharmacokinetics of delpazolid in patients with pulmonary tuberculosis (TB). Seventy-nine subjects, aged 19 to 75 years with newly diagnosed smear-positive TB with no prior treatment for the current episode and no confirmed resistance to rifampin or isoniazid, were randomized to receive delpazolid 800 mg once a day (QD), 400 mg twice a day (BID), 800 mg BID or 1,200 mg QD or an active control of isoniazid, rifampin, pyrazinamide, and ethambutol (HRZE) or linezolid 600 mg BID. The primary endpoint was the average daily reduction in log transformed bacterial load, assessed on 7H11 solid-media culture, from days 0 to 14. The average daily decline in log-CFU was 0.044 ± 0.016, 0.053 ± 0.017, 0.043 ± 0.016, and 0.019 ± 0.017, for the delpazolid 800 mg QD, 400 mg BID, 800 mg BID, and the 1,200 mg QD groups, respectively. The average daily decline in log-CFU was 0.192 ± 0.028 for the HRZE group and 0.154 ± 0.023 for the linezolid 600 mg BID group. Three serious adverse events (SAE) were reported, one each in the delpazolid 400 mg BID group (death due to worsening of TB at day 2), the HRZE group (hospitalization due to pleural effusion) and the linezolid group (hyperkalemia); none of the SAEs were assessed as related to study drugs. This study has been registered at ClinicalTrials.gov with registration number NCT02836483.

Background: The clinical and cost-effectiveness of left ventricular assist device (LVAD) therapy for patients with advanced heart failure (HF) who are ineligible for heart transplantation is debated in the UK. This study develops an indirect comparison between the fully magnetically levitated HeartMate 3 (HM 3) LVAD and medical therapy (MT) to evaluate expected clinical and cost-effectiveness in the UK National Health Service (NHS) context., Methods: We performed an economic analysis comparing the HM3 pump against the HeartMate II LVAD (MOMENTUM 3), and then another analysis comparing MT with the first- and second-generation HeartMate XVE pump LVAD and HeartMate II LVAD for the same patient population (REMATCH and ROADMAP, respectively). By bridging those 2 analyses, an indirect comparison between HM3 and MT in the form of a network meta-analysis was developed. A literature search was performed to select the most appropriate pair of studies for this purpose. Outcomes were adjusted to produce Kaplan-Meier curves for the cost-effectiveness evaluation by using a decision-analytic model. Data were extrapolated linearly over a 5-year time horizon. Uncertainty and additional scenarios were addressed by one-way and probabilistic sensitivity analysis. Local costs and health utility were used from England, thereby representing the UK context., Results: The incremental cost-effectiveness ratio (ICER) for LVAD vs MT in transplant ineligible patients with advanced HF was estimated to be £47,361 per quality-adjusted life year gained, with a 97.1% probability of being cost-effective at £50,000. In a subgroup of patients who are inotropic therapy dependent (INTERMACS 1-3 severity profile), the ICER was £45,616, while for a population with less-ill ambulatory HF (INTERMACS profile 4-7) the ICER changed to £64,051., Conclusions: This study provides evidence that HM3 LVAD therapy in advanced HF patients ineligible for heart transplantation may be cost-effective compared to MT in the NHS UK-England context. The ICER is lowest for patients dependent on inotropic support, but exceeds the willingness to pay threshold of £50,000 in ambulatory noninotropic therapy dependent advanced HF patients., Competing Interests: Disclosure statement Hoong Sern Lim reports honoraria from Abbott and Abiomed. Steven Shaw reports honoraria from Abbott. Mandeep R. Mehra reports payments made to his institution from Abbott for consulting; Consultant fees from Medtronic, Janssen, Mesoblast, Portola, Bayer, Triple Gene, and Baim Institute for Clinical Research. Scientific Advisory Board Member for NuPulseCV, Leviticus and FineHeart., (Copyright © 2021 The Authors. Published by Elsevier Inc. All rights reserved.)

BACKGROUND . Tumor-infiltrating lymphocytes (TILs) are associated with therapeutic outcomes and prognosis in patients with human epidermal growth factor receptor type 2 (HER2)-positive breast cancer. Identification of TIL levels is clinically relevant. OBJECTIVE . The purpose of our study was to explore associations of clinicopathologic and MRI features with TIL levels in patients with HER2-positive breast cancer. METHODS . A total of 212 consecutive women (mean age, 54.0 years) diagnosed with HER2-positive breast cancer between January 2017 and December 2019 were included in this retrospective study. Patients were divided into low-TIL (< 10%) and high-TIL (≥ 10%) groups. Three breast radiologists independently reviewed images; interreader agreement was assessed, and the first reader's findings were used for further analysis. Associations of clinicopathologic and MRI features with TIL levels were evaluated using multivariable logistic regression analysis. Subanalysis of TIL levels by hormone receptor (HR) status was also performed. RESULTS . A total of 115 (54.2%) patients had low TIL levels, and 97 (45.8%) patients had high TIL levels. A high TIL level was associated (all, p < .05) with histologic grade 3 (odds ratio [OR] = 3.98; frequency, 78.4% vs 52.2% in high- vs low-TIL groups, respectively), high tumor cellularity (OR = 4.59; median cellularity, 60% vs 50%), lower frequency of associated ductal carcinoma in situ (OR = 0.16; frequency, 86.6% vs 94.8%), and higher frequency of peritumoral edema on T2-weighted images (OR = 2.83; 71.1% vs 50.4%). In subgroup analysis by HR status, histologic grade 3 (OR = 5.03, p = .002) was a significant independent predictor of high TIL level in the HR-positive/HER2-positive group, whereas high tumor cellularity (OR = 9.06, p = .002), peritumoral edema (OR = 5.23, p = .03), and low ADC (OR = 11.69, p = .047) were independent predictors of high TIL level in the HR-negative/HER2-positive group. Interreader agreement for peritumoral edema was moderate among the three radiologists (к = 0.432-0.539). CONCLUSION . Peritumoral edema on MRI and the histopathologic feature of tumor aggressiveness help predict high TIL levels in patients with HER2-positive breast cancer. CLINICAL IMPACT . Pretreatment MRI features may serve as a useful tool for assessing TIL levels in patients with HER2-positive breast cancer and for helping to classify patients with variable clinical outcomes related to immune activity and to guide selection among neoadjuvant chemotherapy or HER2-targeted therapy or immunotherapy.

Aims: The CardioMEMS HF System Post-Market Study (COAST) was designed to evaluate the safety, effectiveness, and feasibility of haemodynamic-guided heart failure (HF) management using a small sensor implanted in the pulmonary artery of New York Heart Association (NYHA) Class III HF patients in the UK, Europe, and Australia., Methods and Results: COAST is a prospective, international, multicentre, open-label clinical study (NCT02954341). The primary clinical endpoint compares annualized HF hospitalization rates after 1 year of haemodynamic-guided management vs. the year prior to sensor implantation in patients with NYHA Class III symptoms and a previous HF hospitalization. The primary safety endpoints assess freedom from device/system-related complications and pressure sensor failure after 2 years. Results from the first 100 patients implanted at 14 out of the 15 participating centres in the UK are reported here. At baseline, all patients were in NYHA Class III, 70% were male, mean age was 69 ± 12 years, and 39% had an aetiology of ischaemic cardiomyopathy. The annualized HF hospitalization rate after 12 months was 82% lower [95% confidence interval 72-88%] than the previous 12 months (0.27 vs. 1.52 events/patient-year, respectively, P < 0.0001). Freedom from device/system-related complications and pressure sensor failure at 2 years was 100% and 99%, respectively., Conclusions: Remote haemodynamic-guided HF management, using frequent assessment of pulmonary artery pressures, was successfully implemented at 14 specialist centres in the UK. Haemodynamic-guided HF management was safe and significantly reduced hospitalization in a group of high-risk patients. These results support implementation of this innovative remote management strategy to improve outcome for patients with symptomatic HF. Clinical registration number: ClinicalTrials.gov identifier: NCT02954341., (© 2021 The Authors. ESC Heart Failure published by John Wiley & Sons Ltd on behalf of European Society of Cardiology.)

Air surface temperature (AST) is a crucial importance element for many applications such as hydrology, agriculture, and climate change studies. The aim of this study is to develop regression equation for calculating AST and to analyze and investigate the effects of atmospheric parameters (O 3 , CH 4 , CO, H 2 Ovapor, and outgoing longwave radiation (OLR)) on the AST value in Iraq. Dataset retrieved from the Atmospheric Infrared Sounder (AIRS) at EOS Aqua Satellite, spanning the years of 2003 to 2016, and multiple linear regression were used to achieve the objectives of the study. For the study period, the five atmospheric parameters were highly correlated (R, 0.855-0.958) with predicted AST. Statistical analyses in terms of β showed that OLR (0.310 to 1.053) contributes significantly in enhancing AST values. Comparisons among selected five stations (Mosul, Kanaqin, Rutba, Baghdad, and Basra) for the year 2010 showed a close agreement between the predicted and observed AST from AIRS, with values ranging from 0.9 to 1.5 K and for ground stations data, within 0.9 to 2.6 K. To make more complete analysis, also, comparison between predicted and observed AST from AIRS for four selected month in 2016 (January, April, July, and October) has been carried out. The result showed a high correlation coefficient (R, 0.87 and 0.95) with less variability (RMSE ≤ 1.9) for all months studied, indicating model's capability and accuracy. In general, the results indicate the advantage of using the AIRS data and the regression analysis to investigate the impact of the atmospheric parameters on AST over the study area., (© 2021. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)