Search

A putative new emaravirus, named "ailanthus crinkle leaf-associated emaravirus" (ACrLaV), was detected in Ailanthus altissima with severe crinkle symptoms by RNA-Seq and RT-PCR. Four viral segments associated with ACrLaV were identified and fully sequenced, except for a few nucleotides at the genomic termini. The RNA-dependent RNA polymerase (RNA1), glycoprotein (RNA2), nucleocapsid protein (RNA3), and movement protein (RNA4), showed 26.5%-57%, 17%-49.9%, 14.4%-40.4%, and 14.1%-65.9% amino acid sequence identity, respectively, to those of known emaraviruses. All four ACrLaV genomic RNA segments are most closely related to those of common oak ringspot-associated virus from Germany, as supported by sequence comparisons and phylogenetic analysis. ACrLaV is considered a distinct member of the genus Emaravirus, and this is the first report of an emaravirus in A. altissima. [ABSTRACT FROM AUTHOR]

A new positive-strand RNA virus genome was discovered in Camellia japonica plants. The complete genome of the virus is 12,570 nt in size, excluding the poly(A) tail, and contains one large open reading frame (ORF1) and two small open reading frames (ORF2, ORF3). ORF1 and ORF2 are homologous to sequences of waikaviruses, while ORF3 has no relatives in the databases. ORF1 encodes a putative polyprotein precursor that is putatively processed into eight smaller proteins, as in typical waikaviruses. Comprehensive analysis, including BLAST searches, genome organization and pairwise sequence comparisons, and phylogeny reconstructions, invariably placed the virus with the waikaviruses. Furthermore, due to lower amino acid sequence identity to known waikaviruses than the threshold species demarcation cutoff, this virus may represent a new species in the genus Waikavirus, family Secoviridae, and we have tentatively named it "camellia virus A" (CamVA). Finally, a field survey was conducted to assess the occurrence of CamVA in camellias and its associated symptoms. [ABSTRACT FROM AUTHOR]

Watermelon crinkle leaf-associated virus 1 and watermelon crinkle leaf-associated virus 2 (WCLaV-1 and WCLaV-2), two unclassified members of the order Bunyavirales, are phylogenetically related to members of the genus Coguvirus (family Phenuiviridae). The genome of both viruses was reported previously to be composed of three RNA segments. However, the terminal sequences of two genomic RNA segments, namely those encoding the putative movement protein (MP) and the nucleocapsid (NP) protein, remained undetermined. High-throughput sequencing of total RNA and small RNA preparations, combined with reverse transcription PCR amplification followed by sequencing, revealed that the WCLaV-1 and WCLaV-2 possess a bipartite genome consisting of a negative-sense RNA1, encoding the RNA-dependent RNA polymerase, and an ambisense RNA2, encoding the putative movement (MP) and nucleocapsid (NP) proteins. The two open reading frames of RNA2 are in opposite orientations and are separated by a long AU-rich intergenic region (IR) that may assume a hairpin conformation. RNA1 and RNA2 of both viruses share almost identical 5' and 3' termini, which are complementary to each other up to 20 nt. This genome organization is typical of members of the genus Coguvirus, with which WCLaV-1 and WCLaV-2 also share similar terminal 5' and 3' sequences of RNA1 and RNA2. These molecular features, together with phylogenetic reconstructions support the classification of WCLaV-1 and WCLaV2 as members of two new species in the genus Coguvirus. [ABSTRACT FROM AUTHOR]

A novel positive-stranded RNA virus provisionally named "citrus virus C" (CVC) was discovered in citrus trees displaying mottling symptoms. Its genome comprises 7,215 nucleotides (nt), excluding the 3' poly(A) tail, and contains two open reading frames (ORFs) that encode a replication-associated polyprotein (RP) and a putative coat protein (CP). The CVC genome contains a 16-nt 'marafibox', which is highly conserved in most viruses belonging to the genus Marafivirus of the same family. Sequence analysis suggested that the virus is most closely related to grapevine Red Globe virus (GRGV), which is yet to be officially classified in the family Tymoviridae. The sequence identities between CVC and GRGV in the whole genome (50.7%, nt) and CP (49.4% for amino acid, and 53.9% for nt) are lower than the thresholds (80% in the genome and 90% in the CP) for species demarcation in the family. Therefore, it is legitimate to propose that CVC is a member of new species in the family Tymoviridae. [ABSTRACT FROM AUTHOR]

Deep-sequencing analysis of a chrysanthemum plant with yellow dwarf symptoms led to the discovery of a novel putative cytorhabdovirus, here tentatively named "chrysanthemum yellow dwarf associated virus" (CYDaV). Its negative-sense single-stranded RNA genome comprises 14,086 nucleotides and contains eight open reading frames in the order 3′ leader-N-P′-P-P3-M-G-P6-L-5′ trailer. CYDaV shares moderate sequence similarity (< 54.2% nucleotide and 51% amino acid sequence identity) with its cytorhabdovirus counterparts in cognate genes. Phylogenetic analysis showed that CYDaV clustered with strong support with alfalfa dwarf virus, raspberry vein chlorosis virus, and strawberry crinkle virus. These findings suggest that CYDaV should be considered a novel member of the genus Cytorhabdovirus, family Rhabdoviridae. [ABSTRACT FROM AUTHOR]

In 2019, plants of the genus Viola showing yellow mottling symptoms were collected in Liaoning, China. RNA sequencing and PCR both confirmed the presence of a reverse-transcribing DNA virus. The novel virus was named "viola yellow mottle virus" (VYMV), and its 9,872-bp genome was found to contain eight open reading frames. The polymerase (RT + RNase H) gene shared the most similarity (31.6% nucleotide and 41.6% amino acid sequence identity) with that of rose yellow vein virus (RYVV, NC_020999), which is currently the only member of the genus Rosadnavirus. Phylogenetic analysis indicated a close relationship between these viruses, suggesting that VYMV should be considered a new member of the genus Rosadnavirus. [ABSTRACT FROM AUTHOR]

A novel plant virus with a positive single-stranded (+ss) RNA genome was detected in Taibei pomelo (Citrus grandis (L.) Osbeck cv. Taibeiyou) in China by high-throughput sequencing (HTS). Tentatively named "citrus yellow spot virus" (CiYSV), it has 8,061 nucleotides (nt) excluding the poly(A) tail and contains three open reading frames (ORFs). ORF1 is predicted to encode a replicase polyprotein (RP) with conserved domains typical of members of the family Betaflexiviridae. ORF2 encodes a protein sharing the highest sequence identity with the putative movement protein (MP) found in the negative-stranded RNA virus Trifolium pratense virus B (TpVB, MH982249, genus Cytorhabdovirus). ORF3 overlaps ORF2 by 137 nt and encodes a predicted coat protein (CP) that is distantly related to those of betaflexiviruses. Phylogenetic analysis based on the MP amino acid sequence showed that the CiYSV clustered with cytorhabdoviruses rather than betaflexiviruses, whilst trees based on the whole genome, RP, and CP showed it to belong to the family Betaflexiviridae but to be distinct from any other known betaflexiviruses. These results suggest that the CiYSV should be considered the first member of a tentative new genus in the family Betaflexiviridae. [ABSTRACT FROM AUTHOR]

A novel cytorhabdovirus, tentatively named "paper mulberry mosaic-associated virus" (PMuMaV), was discovered and identified by transcriptome sequencing (RNA-seq), small RNA sequencing (sRNA-seq), and RT-PCR amplification. The whole-genome sequence of PMuMaV is 13,736 nucleotides (nt) in length and contains six open reading frames (ORFs) encoding a nucleocapsid protein (N), a phosphoprotein (P), a putative movement protein (P3), a matrix protein (M), a glycoprotein (G), and an RNA-dependent RNA polymerase (L). The coding sequences are flanked by a 194-nt leader and a 370-nt trailer sequence at the 3' terminus and 5' terminus, respectively. Pairwise sequence comparisons showed that PMuMaV is related to northern cereal mosaic virus (NCMV, 38.97%), barley yellow striate mosaic virus (BYSMV, 38.86%), and maize yellow striate virus (MYSV, 38.76%), and phylogenetic analysis also placed these viruses together into the same branch, thus suggesting that PMuMaV is a member of a new species in the genus Cytorhabdovirus. [ABSTRACT FROM AUTHOR]

A putative novel virus was identified in Agastache rugosa in China and tentatively named "Agastache rugosa-associated varicosavirus" (ARaVV). The nearly complete genome sequence of ARaVV was obtained through RNA sequencing (RNA-seq) and subsequent RT-PCR. The ARaVV genome consists of two negative-sense single-stranded RNA segments that are 6428 and 3862 nucleotides (nt) in size, respectively. RNA1 encodes a large polymerase (L), and RNA2 encodes a putative nucleocapsid protein (N), protein 2 (P2), and protein 3 (P3). The L protein shared the highest amino acid (aa) sequence identity (51.3%) with Erysimum virus 1 (EryV1, BK061766.1). The N, P2, and P3 shared the highest aa sequence identity (33.1%, 14.0%, and 24.2%) with Leucanthemum virus 1, Raphanus virus 1, and Spinach virus 1, respectively. Phylogenetic analysis based on amino acid sequences of the L protein showed that ARaVV clustered in a clade with the varicosaviruses, indicating that ARaVV is a putative new member of the genus Varicosavirus., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Cucumber green mottle mosaic virus (CGMMV) was first discovered on cucumber in the United Kingdom in 1935 (Ainsworth, 1935), and has spread worldwide except to Antarctica (Jones, 2021). Given its extensive damage, it is considered an important pathogen on global cucurbit plants and fruit crops. In China, CGMMV was first reported on pumpkin in Guangxi Province in 2003 (Qin et al., 2005), and occurred on 34 plants species across 23 provinces (Liu et al., 2016). Cynanchum rostellatum is a member of the family Apocynaceae. In July 2021, leaves of C. rostellatum exhibiting virus-like symptoms (yellowing, severe crinkling, deformation) were observed and collected in Liaoning Province, China. Aphids were also observed on the leaves and stems (Fig. S1) of the plants and were collected. Total RNA was extracted from diseased leaves following the CTAB method, followed by the depletion of ribosomal RNAs (rRNA) with TIANSeq rRNA Depletion Kit (Tiangen, China). The RNAs were, then processed into a DNBSEQ LncRNA-Seq library, and sequenced on the MGISEQ-2000 platform at BGI Genomics (Wuhan, China). A total of 106.98 M clean reads were obtained after data filtering using SOAPnuke software (BGI, China). The clean reads were assembled into contigs using CLC Genomics Workbench 11 (Qiagen, USA) and Trinity v2.0.6 (Haas et al., 2013). A contig (4,760 reads, average coverage:73.76) of 6,391 nucleotides was found to share the highest sequence identity (99.83%) with CGMMV isolate GDLZ (MK933286), irrespective of other virus-like contigs related to Polerovirus and Totivirus. Based on the genome of GDLZ isolate, seven specific primers (Table S1) were designed to amplify the full viral genomic sequences using a PrimeScriptTM One-Step RT-PCR Kit. Seven expected amplicons were obtained, cloned, and sequenced. The complete genome was determined to be 6,423 nucleotides (GenBank accession number OR854819) in length and designated as LNMJ isolate. LNMJ shared 96.8%-99.7% nucleotide sequence identities with CGMMV isolates from China. Phylogenetic analysis based on the complete genome sequences showed that LNMJ clustered together with CGMMV isolates hn (GenBank accession number KC851866), GDLZ (GenBank accession number MK933286), and JD8 (GenBank accession number KM873784) from China. The specific primers LM-TJ-3F/3R were designed to determine the virus-symptom association for LNMJ, and all twelve symptomatic C. rostellatum plants collected from fields tested positive for LNMJ. Two out of six randomly selected aphids from the diseased plants also tested positive. To further prove its infectivity, LNMJ was inoculated mechanically onto ten healthy Nicotiana benthamiana plants, and the results indicated a high infection rate of 80% (8/10), at 30 days post-inoculation despite no distinct symptoms observed. To our knowledge, this is the first report of the natural infection of C. rostellatum plants with CGMMV. C. rostellatum is a widespread herb in China (Wei et al., 2019) and more surveys are needed to determine the distribution of CGMMV. The habitats of C. rostellatum span diverse agroecological zones, and thus our study underscores the potential spillover of CGMMV to neighboring crops as a significant risk.

Hibiscus latent Singapore virus (HLSV) and Hibiscus latent Fort Pierce virus (HLFPV) both belong to the genus Tobamovirus in the family Virgaviridae. The genomes of both HLSV and HLFPV consist of a linear positive sense single-stranded RNA of about 6.3 kb. HLSV is the causal agent of hibiscus leaf crinkle disease. Infections of HLSV in hibiscus (Hibiscus rosa-sinensis) have so far only been reported in Singapore, Japan and Malaysia (Srinivasan et al., 2002; Yoshida et al., 2018; Yusop et al., 2021). In 2017, leaf curling and chlorosis symptoms of lantana (Lantana camara) plants were found in Chenshan Botanical Garden, Shanghai, China. To detect potential virus(es) in these lantana samples, leaves from one lantana plant were collected and total RNA was extracted with RNAiso Plus (TaKaRa). A cDNA library was prepared by TruSeq RNA Sample Prep Kit (Illumina) after removing ribosomal RNA by Ribo-ZeroTM rRNA Removal Kit (Epicentre). The paired-end sequencing was then performed on an Illumina NovaSeq 6000. A total of 61,085,018 high quality reads were obtained and de novo assembly by StringTie revealed 124,516 contigs (greater than 50 bp, N50=719 bp) with an average length of 537 bp. BLASTx analyses in the National Center for Biotechnology Information (NCBI) database showed that 1 long contig of 6,305 bp, assembled of 1794 clean reads, shared significant nucleotide similarities with the genomic sequence of HLSV, and 1 contig of 6,271 bp, assembled of 3174 clean reads, shared significant similarities with the genomic sequence of HLFPV, yielding an average coverage of the whole genome at 42.65 and 75.83 per million reads, respectively. To obtain the complete genome of the viral RNA in this lantana sample, eleven overlapping regions covering the entire HLSV viral genome, and nine overlapping regions covering the entire HLFPV viral genome were amplified by reverse transcription-PCR (RT-PCR) and sequenced. In addition, the exact 5' and 3' ends of the genomic RNA of each virus were determined by rapid amplification of the cDNA ends (RACE) (Wang et al. 2020). The complete genome of the identified HLSV, deposited in GenBank: MZ020960, is 6,486 nt in length and shows 98.4% nucleotide sequence identity with HLSV Singapore isolate (GenBank: AF395898). Similar to other HLSV isolates, this virus isolate possesses an internal poly(A) tract of 87 nucleotides, which is crucial to virus replication (Niu et al., 2015). The complete genome of the Lantana HLFPV isolate is 6,463 nt (GenBank MZ020961) including a 73 nt internal poly(A) tract, and has 98.4% nt identity to HLFPV-Japan (AB917427). In two other lantana plants from the same site, the presence of HLSV and HLFPV was confirmed by RT-PCR using the primer pairs (5'-GCATCTGCATAACACGGTTG-3'/5'-ACGTTGTAGTAGACGTTGTTGTAG-3' and 5'-GGACCTTGCTAATCCGCTAAAGTTG-3'/5'-GGTCCATGTCCATCCAGATGCAATC-3'). In addition to the HLSV and HLFPV genomes, BLASTx analysis of three contigs of 3,006 bp, 2,845 bp and 2,200 bp, assembled of 1328, 352 and 2280 clean reads respectively, showed high identity to RNAs 1 (MG182148), 2 (DQ412731) and 3 (KY794710) of cucumber mosaic virus. To the best of our knowledge, this is the first report of L. camara as a new natural host of HLSV and HLFPV, and first identification of a mixed infection of HLSV and HLFPV.

Viruses with split genomes are classified as being either segmented or multipartite based on whether their genomic segments occur within a single virion or across different virions. Despite variations in number and sequence during evolution, the genomic segments of many viruses are conserved within the untranslated regions (UTRs). In this study, we present a methodology that combines RNA sequencing with iterative BLASTn of UTRs (https://github.com/qq371260/Iterative-blast-v.1.0) to identify new viral genomic segments. Some novel multipartite-like viruses related to the phylum Kitrinoviricota were annotated using sequencing data from field plant samples and public databases. We identified potentially plant-infecting jingmen-related viruses (order Amarillovirales ) and jivi-related viruses (order Martellivirales ) with at least six genomic components. The number of RNA molecules associated with a genome of the novel viruses in the families Closteroviridae, Kitaviridae , and Virgaviridae within the order Martellivirales reached five. Several of these viruses seem to represent new taxa at the subgenus, genus, and family levels. The diversity of novel genomic components and the multiple duplication of proteins or protein domains within single or multiple genomic components emphasize the evolutionary roles of genetic recombination (horizontal gene transfer), reassortment, and deletion. The relatively conserved UTRs at the genome level might explain the relationships between monopartite and multipartite viruses, as well as how subviral agents such as defective RNAs and satellite viruses can coexist with their helper viruses., Competing Interests: The authors declare no competing interests., (© The Author(s) 2024. Published by Oxford University Press.)

A novel emaravirus, tentatively named "clematis yellow mottle associated virus" (CYMaV), was identified through transcriptome sequencing and RT-PCR analysis of yellow-mottled leaf samples from Clematis brevicaudata DC. The genome of CYMaV consists of five viral RNAs: RNA1 (6591 nucleotides, nt), RNA2 (1982 nt), RNA3a (1301 nt), RNA3b (1397 nt), and RNA4 (1192 nt). The 13-nt sequences at the 5'- and 3'-termini of the CYMaV RNAs are conserved and have reverse complementary, as typically seen in emaraviruses. The proteins encoded by CYMaV shared the highest amino acid sequence similarity with those of the unclassified Karaka Okahu purepure emaravirus (KOPV), with 60.2% identity in the RNA-dependent RNA polymerase (RdRp), 44.4% in the glycoprotein precursor, and 46.9% in the nucleocapsid protein. A phylogenetic tree based on amino acid sequences of the RdRp revealed that CYMaV is most closely related to KOPV and clusters with ChMaV (chrysanthemum mosaic-associated virus, LC576445) and PCLSaV (pear chlorotic leaf spot-associated virus, MK602177) in one distinct clade. Transmission electron microscopy observation of negatively stained samples from C. brevicaudata revealed spherical virus-like particles (VLPs) approximately 100 nm in diameter. Five primers, specific for each viral RNA, were used to detect CYMaV in 11 symptomatic and two asymptomatic C. brevicaudata samples, but the results failed to show a consistent association of viral infection with symptoms. CYMaV can be considered a putative new member in the genus Emaravirus, and this marks the first report of an emaravirus found infecting C. brevicaudata plants., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Reverse transcription-polymerase chain reaction (RT-PCR) is an effective method for detecting the presence of viroids in plant tissue. Viroid RNA is converted to cDNA and amplified to detectable levels, making it a fast and useful detection tool, even when the viroid is present at low levels. Methods of viroid detection using conventional RT-PCR are described in this chapter., (© 2022. Springer Science+Business Media, LLC, part of Springer Nature.)

In March 2021, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by four families (Aliusviridae, Crepuscuviridae, Myriaviridae, and Natareviridae), three subfamilies (Alpharhabdovirinae, Betarhabdovirinae, and Gammarhabdovirinae), 42 genera, and 200 species. Thirty-nine species were renamed and/or moved and seven species were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV., (© 2021. This is a U.S. government work and not under copyright protection in the U.S.; foreign copyright protection may apply.)

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses&#95;NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

Tomato spotted wilt virus (TSWV, Genus Orthotospovirus, Family Tospoviridae) is a thrips-transmitted negative-stranded RNA virus with a large host range. Major economic losses caused by TSWV have been recorded in various crops such as tomato, pepper and lettuce (Pappu et al., 2009; Adams et al., 2017). Nasturtium (Tropaeolum majus L.), a common flowering plant species native to Peru, is generally cultivated as a garden and greenhouse ornamental plant in China. It is also known for its medical, edible and cosmetic values (Jakubczyk et al., 2018). In June 2019, a serious leaf mosaic disease (Figure S1) was observed in ~77% of T. majus plants in Beiling Park in Shenyang City, Liaoning, China. To reveal the possible viral agent associated with the disease, leaf tissue was collected from 9 symptomatic and 2 asymptomatic plants, followed by total RNA extraction from each of the samples using RNASimple Total RNA Kit (Tiangen, Beijing, China). The RNA from one representative symptomatic sample (Figure S1, d) was used to construct an rRNA-depleted library using the Ribo-Zero™ rRNA Removal Kit (Plant Leaf) (Illumina, CA, USA). The library was subjected to RNA-Seq using a BGISEQ platform (Shenzhen Huada Gene Science and Technology Service Co., Ltd., Shenzhen, China). A total of 109,279,540 quality-filtered reads were obtained using the CLC Genomics Workbench 9.5 software (Qiagen, Valencia, CA, USA). Clean reads were assembled into 88,091 contigs ranging in length from 200 to 19,695 bp using Velvet (Zerbino and Birney 2008). Among the contigs, three sized at 8801, 4617 and 2909 bp were found to share a sequence identity of 98.74-99.35% with the RNA segments (L, M and S) of TSWV. No sequences of other viruses, viroids included, were detected. Ten primer pairs were designed based on the TSWV contigs to obtain the full genome sequence of the virus (Table S1). Five, three, and two amplicons were obtained for the TSWV RNA segments L, M and S, respectively, from the same RNA sample used in the RNA-Seq process. These amplicons were then cloned into the pMD18T vector (TaKaRa, Dalian, China) and Sanger sequenced. The resulting sequences were assembled and analyzed using the DNAMAN version 8.0 (LynnonBiosoft, Quebec, Canada) and DNAStar version 6.0 software (DNAStar Inc, Madison, WI, USA) (Table S1). The RNA segments were determined to be 8,914 nt (L, accession no. MT241883), 4,791 nt (M, MT241884) and 2,922 nt (S, MT241885) in length. They shared a sequence identity of >99% with the "LL-N.05" (segment L, KP008128) and "SPAIN-1" (segment S, AY744479) isolates from tomatoes in Spain and the "Beijing" isolate (segment M, MH717046) from chrysanthemum in China. These results, together with phylogenetic analysis, suggest that the isolate (designated as isolate LN-HJL) was likely resulted from genome reassortment between other isolates. No reliable recombination events were detected in the RNA segments of LN-HJL by the RDP4 program (Martin et al., 2015). RT-PCR assay with primer pair S-1F/1R on all samples led to positive detection of TSWV only in the symptomatic samples (Figure S1, g), indicating that the virus was likely responsible for the disease symptoms observed in T. majus. To the best of our knowledge, this is the first report of the TSWV infection in T. majus in China, and the second in the world since the first report in the USA (Ie, 1964). TSWV-infected T. majus plants not only lose their aesthetic and economic values (Figure S1, f), but also may act as reservoirs for the spread of TSWV to other important crops. T. majus should therefore be monitored regularly for the virus and managed accordingly in China.

A new virus with sequence similarities to members of the genus Cavemovirus in the family Caulimoviridae was identified in an Epiphyllum hybrid. The complete genome of the virus, tentatively named "epiphyllum virus 4" (EpV-4), was determined to be 7,296 nucleotides long. Its circular genome organization is typical of cavemoviruses, containing four open reading frames. This virus and the two known cavemoviruses share 67-69% and 72-75% overall nucleotide sequence identity in the replicase gene. Phylogenetic analysis placed EpV-4 in a same cluster with the two recognized cavemoviruses. Thus, EpV-4 should be considered a representative of a third species of the genus Cavemovirus. The virus was transmitted by grafting.

Contigs with the highest sequence similarity (73%) to Apricot pseudo-chlorotic leaf spot virus (genus Trichovirus, family Betaflexiviridae) were identified by high-throughput sequencing from a symptomless sweet cherry accession. The complete genome sequence of this new virus is 7460 nucleotides, excluding the 3' poly(A) tail. Its genome organization is very similar to several trichoviruses infecting fruit trees, with three open reading frames encoding putative replicase, movement protein and coat protein (CP). The virus shares amino acid sequence identities of 60-73% at replicase and 53-76% at CP with other trichoviruses. Phylogenetic analyses group it and other trichoviruses in a cluster. These results support that this virus, which is tentatively named cherry latent virus 1, should be considered a new member in the genus Trichovirus.