Search

Persistent human papillomavirus (HPV) infection is the leading cause of cervical cancer. Although the fundamental link between HPV infection and oncogenesis is established, the specific mechanisms of virus-mediated transformation are not fully understood. We previously demonstrated that the HPV encoded E6 protein increases the activity of the proto-oncogenic transcription factor STAT3 in primary human keratinocytes; however, the molecular basis for STAT3 activation in cervical cancer remains unclear. Here, we show that STAT3 phosphorylation in HPV positive cervical cancer cells is mediated primarily via autocrine activation by the pro-inflammatory cytokine Interleukin 6 (IL-6). Antibody-mediated blockade of IL-6 signalling in HPV positive cells inhibits STAT3 phosphorylation, whereas both recombinant IL-6 and conditioned media from HPV positive cells leads to increased STAT3 phosphorylation within HPV negative cervical cancer cells. Interestingly, we demonstrate that activation of the transcription factor NFκB, involving the small GTPase Rac1, is required for IL-6 production and subsequent STAT3 activation. Our data provides new insights into the molecular re-wiring of cancer cells by HPV E6. We reveal that activation of an IL-6 signalling axis drives the autocrine and paracrine phosphorylation of STAT3 within HPV positive cervical cancers cells and that activation of this pathway is essential for cervical cancer cell proliferation and survival. Greater understanding of this pathway provides a potential opportunity for the use of existing clinically approved drugs for the treatment of HPV-mediated cervical cancer., Author summary Persistent infection with HPV is the predominant cause of anogenital and oral cancers. Transformation requires the re-wiring of signalling pathways in infected cells by virus encoded oncoproteins. At this point, a comprehensive understanding of the full range of host pathways necessary for HPV-mediated carcinogenesis is still lacking. In this study we describe a signalling circuit resulting in the aberrant production of the IL-6 cytokine. Mediated by the HPV E6 oncoprotein, it requires activation of the NFκB transcription factor. The autocrine and paracrine actions of IL-6 are essential for STAT3 activation in HPV positive cervical cancers and loss of the pathway results in increased cancer cell death and a reduction in proliferation. This study provides molecular insights into the mechanisms by which a virus encoded oncoprotein activates an oncogenic pathway and identifies potential targets for therapeutic intervention.

BK polyomavirus (BKV) is an important cause of graft loss in renal transplant recipients that continues to pose a significant challenge to clinicians due to its frequently unpredictable onset, persistence, and the lack of effective antiviral agents or prevention strategies. This review covers our current understanding of epidemiology, viral transmission and disease progression, and treatment and prevention strategies that have been used to manage this disease.

Malakoplakia (from the Greek malakos, ‘soft’ and plakos ‘plaque’) is a granulomatous inflammatory condition, commonly presenting as a plaque in the genitourinary system, but has been shown to affect a wide variety of structures including the skin. Presentation is varied and a high degree of clinical suspicion is needed to make a diagnosis. We report a case of cutaneous malakoplakia presenting as an inguinal swelling in a 48-year-old kidney transplant patient with temporally associated graft dysfunction. New groin swelling in an immunosuppressed patient often prompts investigation centred on a malignant cause. While this is often appropriate, less common infectious and inflammatory causes should be considered. This case highlights the importance of thorough workup and investigation, including histopathology, in immunosuppressed cohorts and acts as a reminder that less common and more complex diagnoses warrant consideration in this group.

Dural arteriovenous fistulae (DAVFs) are a rare form of intracranial arteriovenous malformation. We present the case of a patient who presented in a previously undescribed manner with facial swelling and bruising initially misdiagnosed as cellulitis. He was found subsequently to have DAVFs of the sphenoparietal sinus that had hemorrhaged. The rarity of DAVFs at this location may account for this unique presentation. Successful treatment was achieved by transarterial embolization.

To assess the effect of normobaric hypoxia on metabolism, gut hormones, and body composition, 11 normal weight, aerobically trained (O2peak: 60.6 ± 9.5 ml·kg(-1)·min(-1)) men (73.0 ± 7.7 kg; 23.7 ± 4.0 years, BMI 22.2 ± 2.4 kg·m(-2)) were confined to a normobaric (altitude ≃ 940 m) normoxic (NORMOXIA; PIO2 ≃ 133.2 mmHg) or normobaric hypoxic (HYPOXIA; PIO was reduced from 105.6 to 97.7 mmHg over 10 days) environment for 10 days in a randomized cross-over design. The wash-out period between confinements was 3 weeks. During each 10-day period, subjects avoided strenuous physical activity and were under continuous nutritional control. Before, and at the end of each exposure, subjects completed a meal tolerance test (MTT), during which blood glucose, insulin, GLP-1, ghrelin, peptide-YY, adrenaline, noradrenaline, leptin, and gastro-intestinal blood flow and appetite sensations were measured. There was no significant change in body weight in either of the confinements (NORMOXIA: -0.7 ± 0.2 kg; HYPOXIA: -0.9 ± 0.2 kg), but a significant increase in fat mass in NORMOXIA (0.23 ± 0.45 kg), but not in HYPOXIA (0.08 ± 0.08 kg). HYPOXIA confinement increased fasting noradrenaline and decreased energy intake, the latter most likely associated with increased fasting leptin. The majority of all other measured variables/responses were similar in NORMOXIA and HYPOXIA. To conclude, normobaric hypoxic confinement without exercise training results in negative energy balance due to primarily reduced energy intake.

Laparoscopic cholecystectomy is commonly performed, and several factors increase the risk of open conversion, prolonging operating time and hospital stay. Preoperative stratification would improve consent, scheduling and identify appropriate training cases. The aim of this study was to develop a validated risk score for conversion for use in clinical practice.Preoperative patient and disease-related variables were identified from a prospective cholecystectomy database (CholeS) of 8820 patients, divided into main and validation sets. Preoperative predictors of conversion were identified by multivariable binary logistic regression. A risk score was developed and validated using a forward stepwise approach.Some 297 procedures (3.4%) were converted. The risk score was derived from six significant predictors: age (p = 0.005), sex (p 0.001), indication for surgery (p 0.001), ASA (p 0.001), thick-walled gallbladder (p = 0.040) and CBD diameter (p = 0.004). Testing the score on the validation set yielded an AUROC = 0.766 (p 0.001), and a score6 identified patients at high risk of conversion (7.1% vs. 1.2%).This validated risk score allows preoperative identification of patients at six-fold increased risk of conversion to open cholecystectomy.

High-risk human papillomavirus type 16 (HPV16) is the primary causative agent of cervical cancer and therefore is responsible for significant morbidity and mortality worldwide. Cellular transformation is mediated directly by the expression of viral oncogenes, the least characterized of which, E5, subverts cellular proliferation and immune recognition processes. Despite a growing catalogue of E5-specific host interactions, little is understood regarding the molecular basis of its function. Here we describe a novel function for HPV16 E5 as an oligomeric channel-forming protein, placing it within the virus-encoded “viroporin” family. The development of a novel recombinant E5 expression system showed that E5 formed oligomeric assemblies of a defined luminal diameter and stoichiometry in membranous environments and that such channels mediated fluorescent dye release from liposomes. Hexameric E5 channel stoichiometry was suggested by native PAGE studies. In lieu of high-resolution structural information, established de novo molecular modeling and design methods permitted the development of the first specific small-molecule E5 inhibitor, capable of both abrogating channel activity in vitro and reducing E5-mediated effects on cell signaling pathways. The identification of channel activity should enhance the future understanding of the physiological function of E5 and could represent an important target for antiviral intervention.

Type I IFNs (IFNα/β) are essential anti-viral cytokines produced in response to the detection of viral components by host pattern recognition receptors. IFNα/β production is transient, and aberrant activation can be hazardous to the host. In this article, we review our current understanding of host negative regulatory mechanisms that control IFNα/β production.

Merkel cell carcinoma (MCC) is an aggressive skin cancer with a high propensity for recurrence and metastasis. Merkel cell polyomavirus (MCPyV) is recognised as the causative factor in the majority of MCC cases. The MCPyV small tumour antigen (ST) is considered to be the main viral transforming factor, however potential mechanisms linking ST expression to the highly metastatic nature of MCC are yet to be fully elucidated. Metastasis is a complex process, with several discrete steps required for the formation of secondary tumour sites. One essential trait that underpins the ability of cancer cells to metastasise is how they interact with adjoining tumour cells and the surrounding extracellular matrix. Here we demonstrate that MCPyV ST expression disrupts the integrity of cell-cell junctions, thereby enhancing cell dissociation and implicate the cellular sheddases, A disintegrin and metalloproteinase (ADAM) 10 and 17 proteins in this process. Inhibition of ADAM 10 and 17 activity reduced MCPyV ST-induced cell dissociation and motility, attributing their function as critical to the MCPyV-induced metastatic processes. Consistent with these data, we confirm that ADAM 10 and 17 are upregulated in MCPyV-positive primary MCC tumours. These novel findings implicate cellular sheddases as key host cell factors contributing to virus-mediated cellular transformation and metastasis. Notably, ADAM protein expression may be a novel biomarker of MCC prognosis and given the current interest in cellular sheddase inhibitors for cancer therapeutics, it highlights ADAM 10 and 17 activity as a novel opportunity for targeted interventions for disseminated MCC., Author summary The majority of cancer-related deaths occur due to metastatic disease. Therefore, understanding the molecular and cellular mechanisms underlying the process of metastasis is essential to developing new therapeutic interventions to improve cancer patient survival. Merkel cell carcinoma (MCC) is an aggressive and highly metastatic cancer. Merkel cell polyomavirus (MCPyV) has been implicated as the causative agent in the majority of MCC cases. The MCPyV small tumour antigen (ST) is believed to function as the major oncoprotein. However, little is known about the mechanisms through which MCPyV ST may be implicated in causing the high rates of metastatic spread observed in MCC tumours. Here we show that specific cellular sheddases, namely A disintegrin and metalloproteinase (ADAM) 10 and 17 protein levels are increased upon MCPyV ST expression. Moreover, we show that MCPyV ST-induced ADAM 10 and 17 are required to breakdown cell-cell junctions resulting in increased cell dissociation, migration and invasion. As such, ADAM protein expression may provide a novel biomarker of MCC prognosis. In addition, linking cellular sheddases to MCPyV-positive MCC metastasis may provide novel therapeutic interventions.

Virus-host interactions involve complex interplay between viral and host factors, rendering them an ideal target for proteomic analysis. Here we detail a high throughput quantitative proteomics analysis of Vero cells infected with the coronavirus infectious bronchitis virus (IBV), a positive strand RNA virus that replicates in the cytoplasm. Stable isotope labeling with amino acids in cell culture (SILAC) was used in conjunction with LC-MS/MS to identify and quantify 1830 cellular and two viral proteins from IBV-infected cells. Fractionation of cells into cytoplasmic, nuclear, and nucleolar extracts was used to reduce sample complexity and provide information on the trafficking of proteins between the different compartments. Each fraction showed a proportion of proteins exhibitingor=2-fold changes in abundance. Ingenuity Pathway Analysis revealed that proteins that changed in response to infection could be grouped into different functional categories. These included proteins regulated by NF-kappaB- and AP-1-dependent pathways and proteins involved in the cytoskeleton and molecular motors. A luciferase-based reporter gene assay was used to validate the up-regulation of AP-1- and NF-kappaB-dependent transcription in IBV-infected cells and confirmed using immunofluorescence. Immunofluorescence was used to validate changes in the subcellular localization of vimentin and myosin VI in IBV-infected cells. The proteomics analysis also confirmed the presence of the viral nucleocapsid protein as localizing in the cytoplasm, nucleus, and nucleolus and the viral membrane protein in the cytoplasmic fraction. This research is the first application of SILAC to study total host cell proteome changes in response to positive sense RNA virus infection and illustrates the versatility of this technique as applied to infectious disease research.

PurposeThe purpose of this case study is to identify areas of weakness in the patient‐centric organizational culture of Baylis Medical Company in Montreal, and to propose specific actions to address these deficiencies.Design/methodology/approachFollowing initial interviews with company management and observations of corporate environment, variations in organizational culture are measured using a company‐wide survey designed to evaluate customer satisfaction, accountability, empowerment, results focus and employee satisfaction. Survey data are analyzed across departments and experience levels.FindingsQualitative assessment of the company via interviews and observations revealed a lack of artifacts relating to organizational culture, no formal feedback channels from clients, and a diversity of corporate visions among management and employees. Survey analysis revealed lower organizational culture valuation among less experienced employees and non‐managerial workers. Specific areas of weakness include accountability, empowerment and results focus in non‐manufacturing employees.Research limitations/implicationsThe qualitative assessment was limited to selected interviews. No visit was made to the Toronto office. No interviews or surveys were conducted with clients. No data are available to evaluate fluctuations in organizational culture over time.Practical implicationsFour alternative action plans are evaluated using specific decision criteria. The introduction of artifacts relating to the patient‐centric organizational culture is recommended in the short term. Long‐term recommendations include the development of client‐oriented key performance indicators for management and employee use, and a multi‐step training program describing the clinical importance of the company products.Originality/valueThis study proposes a novel model to evaluate the level of patient‐centricity in an organizational culture. Specific recommendations may apply across a variety of industries, but are especially applicable in health care delivery sectors.

An estimated 3% of the global population are infected with hepatitis C virus (HCV), and the majority of these individuals will develop chronic liver disease. As with other chronic viruses, establishment of persistent infection requires that HCV-infected cells must be refractory to a range of pro-apoptotic stimuli. In response to oxidative stress, amplification of an outward K+current mediated by the Kv2.1 channel, precedes the onset of apoptosis. We show here that in human hepatoma cells either infected with HCV or harboring an HCV subgenomic replicon, oxidative stress failed to initiate apoptosis via Kv2.1. The HCV NS5A protein mediated this effect by inhibiting oxidative stress-induced p38 MAPK phosphorylation of Kv2.1. The inhibition of a host cell K+channel by a viral protein is a hitherto undescribed viral anti-apoptotic mechanism and represents a potential target for antiviral therapy.

ERK5 has been implicated in regulating the MEF2-dependent genes Klf2 and nur77 downstream of the TCR and the maintenance of expression of CD62L on peripheral T cells. Based on this data, knockout of ERK5 would be predicted to compromise T-cell development and the maintenance of T cells in the periphery. Using an ERK5 conditional knockout, driven by CD4-CRE or Vav-CRE transgenes resulting in the loss of ERK5 in T cells, we have found that ERK5 is not required for T-cell development. In addition, normal numbers of T cells were found in the spleens and lymph nodes of these mice. We also find that TCR stimulation is not a strong signal for ERK5 activation in primary murine T cells. ERK5 was found to contribute to the induction of Klf2 but not nur77 mRNA following TCR activation. Despite the reduction in Klf2 mRNA, no effect was seen in ERK5 knockouts on either the mRNA levels for the Klf2 target genes CD62L, CCR7 and S1P, or the cell surface expression of CD62L. These results suggest that while ERK5 does contribute to Klf2 regulation in T cells, it is not essential for the expression of CD62L or T-cell survival.

This article develops recent trans-national perspectives by considering Chinese indentured labor to South Africa (1904–1907), with a spatial focus on the port of Durban and the adjacent Indian Ocean. I examine the relationship of Chinese workers with medicine as a particular form of colonial authority. Far from being part of the notoriously unregulated exchanges of “coolie-labor” characterized by high mortality rates, the South African case is unusual in its extensive state and capital regulation in the healthy transport of workers. I consider the mediating role played by colonial doctors on board the vessels in managing the steamships as “floating compounds” closely allied to the imperatives of discipline-discipline. This article thus details quasi-medical efforts at control and management of miners in the shift to industrial capitalism, and assesses where these measures failed or encountered forms of resistance from the Chinese.

MSK1 (mitogen- and stress-activated kinase 1) is a dual kinase domain protein that acts downstream of the ERK1/2 (extracellular-signal-regulated kinase 1/2) and p38 MAPK (mitogen-activated protein kinase) signalling pathways in cells. MSK1, and its related isoform MSK2, phosphorylate the transcription factors CREB (cAMP-response-element-binding protein) and ATF1 (activating transcription factor 1), and the chromatin proteins histone H3 and HMGN1 (high-mobility-group nucleosomal-binding protein 1) in response to either mitogenic stimulation or cellular stress. MSK1 activity is tightly regulated in cells, and activation requires the phosphorylation of MSK1 by either ERK1/2 or p38α. This results in activation of the C-terminal kinase domain, which then phosphorylates further sites in MSK1, leading to the activation of the N-terminal kinase domain and phosphorylation of substrates. Here, we use precursor ion scanning MS to identify five previously unknown sites in MSK1: Thr630, Ser647, Ser657, Ser695 and Thr700. One of these sites, Thr700, was found to be a third site in MSK1 phosphorylated by the upstream kinases ERK1/2 and p38α. Mutation of Thr700 resulted in an increased basal activity of MSK1, but this could be further increased by stimulation with PMA or UV-C radiation. Surprisingly, however, mutation of Thr700 resulted in a dramatic loss of Thr581 phosphorylation, a site essential for activity. Mutation of Thr700 and Thr581 to an alanine residue resulted in an inactive kinase, while mutation of both sites to an aspartic acid residue resulted in a kinase with a significant basal activity that could not be further stimulated. Together these results are consistent with a mechanism by which Thr700 phosphorylation relieves the inhibition of MSK1 by a C-terminal autoinhibitory helix and helps induce a conformational shift that protects Thr581 from dephosphorylation.

Merkel cell carcinoma (MCC) is a rare but highly metastatic neuroendocrine skin cancer [1]. Approximately 80% of MCC are caused by the recently described Merkel cell polyomavirus (MCPyV). Since its discovery in 2008 by the Chang and Moore laboratory, this small DNA virus has been the subject of intensive research. In particular, efforts have focussed on elucidating the mechanisms by which the virus encoded tumor antigens drive cancer progression. Whilst both the small T (sT) antigen and a truncated form of the Large T (LT) antigen are required for MCC cell survival and proliferation [2], expression of sT-antigen is sufficient to transform rodent fibroblast cells [3]. The recent generation of a transgenic mouse expressing sT-antigen under the control of an epidermis specific (keratin-5) promoter confirmed the oncogenic potential of this protein in vivo and should now provide a powerful tool to confirm cell based studies and aid in the identification of the mechanisms of transformation [4]. Undoubtedly, these studies have significantly increased our understanding of the molecular basis by which MCPyV drives MCC development, however, there has remained a frustrating lack of information regarding the highly metastatic nature of MCC. In a recent publication, we have begun to address this deficit and highlight a link between sT-antigen expression and cell motility [5]. Using a quantitative proteomic approach, we found levels of microtubule regulatory proteins enriched in a stable cell line inducibly expressing the sT-antigen. Microtubules are essential components of the cytoskeleton and play a crucial role in a number of cellular functions ranging from mitosis to cell polarity. Both the assembly and dynamics of microtubules are exquisitely controlled and are often deregulated in cancers. One of the most prominent microtubule regulators is stathmin, also known as oncoprotein-18. Stathmin overexpression is a feature of multiple cancer types and correlates with high metastatic potential. Levels of stathmin were significantly higher in Merkel cells expressing sT-antigen and in MCC tumor biopsy samples. Given the critical role of stathmin in promoting microtubule destabilisation, which is known to promote a more motile phenotype in cells, we compared levels of cell motility and migration between control and sT-antigen expressing cells. Using an Incucyte kinetic live cell imaging system we showed that sT-antigen expression increased cell motility. Moreover, using scratch assays we could clearly demonstrate changes in the migratory behaviour of cells containing sT-antigen. This phenotype was likely due to the deregulation of stathmin function. Specifically, stathmin localisation was modified in sT-antigen expressing cells. Compared to the diffuse, cytoplasmic staining observed in control cells, stathmin was sequestered to a perinuclear localisation, which co-localised with a population of sT-antigen. Importantly, the halo-like redistribution was co-incident with a decrease in levels of acetylated β-tubulin, a marker of microtubule stability. Together these data are indicative of a destabilised microtubule network [5]. Using small molecule inhibitors that target virus proteins or the host factors they subvert is a promising avenue to disrupt virus-associated oncogenesis. Accordingly, we took advantage of clinically tested taxanes to confirm that microtubule destabilisation was necessary for sTantigen mediated cell motility. Addition of Paclitaxel strikingly slowed down cell mobilisation and migration of cells expressing sT-antigen, with minimal impact on control cells. Whilst the clinical efficacy of taxanes is often constrained by acquired resistance mutations, the possibility of developing alternative inhibitors of sTinduced migration might be a useful avenue to pursue. In experiments to understand the molecular mechanisms for microtubule destabilisation we demonstrated that levels of stathmin phosphorylation were significantly lower in cells expressing sT-antigen compared to controls. The reversible phosphorylation of stathmin controls its biological activity by reducing its affinity for tubulin and hence preventing microtubule disassembly. Given that the regulation of protein phosphatase activity is believed to be a principal mechanism by which polyomaviruses manipulate intracellular signalling pathways, we investigated whether such enzymes were implicated in the observed microtubule destabilisation and cell motility. In stark contrast to other polyomaviruses, which mediate a number of their functions via a conserved interaction with PP2A, MCPyV sT-antigen has been shown to bind to several phosphatase subunits, including PP4c [6]. Using a panel of sT-antigen mutants we clearly demonstrated that the interaction with PP2A is dispensable for microtubule destabilisation, and that binding to PP4c is necessary for the observed dephosphorylation of stathmin (Figure ​(Figure1).1). Differences in phosphatase sub-unit binding may help to explain some of the unique functions of MCPyV sTantigen compared to other polyomaviruses and warrants a greater scrutiny of the binding partners of sT-antigens from other polyomaviruses. In this light, recent findings now suggest that PP4c binding is conserved with the sTantigen of Simian Virus 40 (SV40) [7] but not the related BK and JC viruses (our unpublished data). Figure 1 Stathmin is a phosphorylation regulated tubulin binding protein In summary, our study highlights a potential mechanism by which tumor antigen expression may enhance the migratory and invasive phenotype of MCC cells and further emphasises the critical role of stathmin in metastasis. It further distinguishes the sT-antigen of MCPyV from other polyomaviruses through its utilisation of alternative phosphatase binding partners. Importantly, it may provide a target for novel antitumor therapies to treat MCC.

High-risk human papillomaviruses (HPV) are the etiological pathogen of cervical and a number of ano-genital cancers. How HPVs overcome the significant barriers of the skin immune system has been the topic of intensive research. The E6 and E7 oncoproteins have emerged as key players in the deregulation of host innate immune pathways that are required for the recruitment of effector cells of the immune response. Here we demonstrate that E7 and to a lesser extend E6, strongly reduce NFκB activation in response to the inflammatory mediator imiquimod. Moreover, we establish that undifferentiated keratinocytes do not express the putative receptor for imiquimod, TLR7 and as such are stimulated by imiquimod through a novel pathway. Inhibition of imiquimod induced cytokine production required residues in the CR1 and CR3 regions of E7 and resulted in reduced nuclear translocation and acetylation of the p65 sub-unit of NFκB. The results provide further evidence for a TLR7-independent role of imiquimod in the epithelial immune response and reinforce the ability of the HPV oncoproteins to disrupt the innate immune response, which may have important consequences for establishment of a chronic infection.

Hepatitis C virus (HCV) establishes a persistent infection that in many cases leads to cirrhosis and hepatocellular carcinoma. The non-structural 5A protein (NS5A) has been implicated in this process as it contains a C-terminal polyproline motif (termed P2) that binds to Src homology 3 (SH3) domains to regulate cellular signalling and trafficking pathways. We have shown previously that NS5A impaired epidermal growth factor (EGF) receptor (EGFR) endocytosis, thereby inhibiting EGF-stimulated EGFR degradation by a mechanism that remained unclear. As EGFR has been implicated in HCV cell entry and trafficking of the receptor involves several SH3-domain containing proteins, we investigated in more detail the mechanisms by which NS5A perturbs EGFR trafficking. We demonstrated that the P2 motif was required for the NS5A-mediated disruption to EGFR trafficking. We further demonstrated that the P2 motif was required for an interaction between NS5A and CMS, a homologue of CIN85 that has previously been implicated in EGFR endocytosis. We provided evidence that CMS was involved in the NS5A-mediated perturbation of EGFR trafficking. We also showed that NS5A effected a loss of EGFR ubiquitination in a P2-motif-dependent fashion. These data provide clues to the mechanism by which NS5A regulates the trafficking of a key cellular receptor and demonstrate for the first time the ability of NS5A to regulate host cell ubiquitination pathways.

Electromagnetic tracking allows for increased flexibility in designing image-guided interventions, however it is well understood that electromagnetic tracking is prone to error. Visualization and assessment of the tracking error should take place in the operating room with minimal interference with the clinical procedure. The goal was to achieve this ideal in an open-source software implementation in a plug and play manner, without requiring programming from the user. We use optical tracking as a ground truth. An electromagnetic sensor and optical markers are mounted onto a stylus device, pivot calibrated for both trackers. Electromagnetic tracking error is defined as difference of tool tip position between electromagnetic and optical readings. Multiple measurements are interpolated into the thin-plate B-spline transform visualized in real time using 3D Slicer. All tracked devices are used in a plug and play manner through the open-source SlicerIGT and PLUS extensions of the 3D Slicer platform. Tracking error was measured multiple times to assess reproducibility of the method, both with and without placing ferromagnetic objects in the workspace. Results from exhaustive grid sampling and freehand sampling were similar, indicating that a quick freehand sampling is sufficient to detect unexpected or excessive field distortion in the operating room. The software is available as a plug-in for the 3D Slicer platforms. Results demonstrate potential for visualizing electromagnetic tracking error in real time for intraoperative environments in feasibility clinical trials in image-guided interventions.

E5 proteins are amongst the least understood of the Human Papillomavirus (HPV) encoded gene products. They are small, membrane-integrated proteins known to modulate a number of critical host pathways associated with pathogenesis including growth factor receptor signaling and immune evasion. Their role in the virus life cycle is less clear, indicating a role in the productive stages of the life cycle. However, a mechanism for this is currently lacking. Here we describe the identification of a novel binding partner of E5, YIPF4 using yeast two-hybrid analysis. YIPF4 is also a poorly characterized membrane spanning protein. Mutagenesis studies implicated the transmembrane regions of each protein as important for their interaction. Binding to YIPF4 was found for all E5 proteins tested suggesting that this interaction may mediate a conserved E5 function. In normal human keratinocytes YIPF4 expression was down-regulated upon differentiation and this reduction was partially rescued in cells harbouring HPV. Despite the conserved nature of the interaction with E5, siRNA mediated depletion of YIPF4 failed to impede two well-characterized functions of E5, namely EGFR trafficking or HLA class I presentation. Continued studies of YIPF4 are warranted to determine its role in the PV life cycle.

Typical hospital procurement processes do not include a formal product evaluation beyond a short trial and soliciting of user preference. Usability evaluations can be an informative aid to determine the best match for a particular healthcare institution. The ergonomics of three short-listed point of care carts were evaluated by having hospital staff use the carts in realistic scenarios and environments. The carts' maneuverability, ease of recharging the point of care device, adequacy of space (storage and workspace), adjustability, keyboard/mouse position, suitability of use in the daily practice, and size were assessed. Usability testing of the point of care carts provided many insights into their strengths and weaknesses, such as whether or not they provided enough storage space for transporting medication to the patient bedside. The results of usability evaluations could be a critical factor in deciding which products can be successfully integrated into a particular healthcare institution.

The hepatitis C virus (HCV) nonstructural NS5A protein has been shown to bind to and activate phosphoinositide 3-kinase (PI3K), resulting in activation of the downstream effector serine/threonine kinase Akt/protein kinase B. Here we present data pertaining to the effects of NS5A-mediated Akt activation on its downstream targets. Using a recombinant baculovirus to deliver the complete HCV polyprotein to human hepatoma cells in a tetracycline-regulable fashion, we confirm that expression of the complete HCV polyprotein also activates PI3K and Akt. We further show that this results in the inhibition of the Akt substrate Forkhead transcription factor and the stimulation of phosphorylation of a second key Akt substrate, glycogen synthase kinase-3β (GSK-3β). Phosphorylation of GSK-3β results in its inactivation; consistent with this, we show that expression of the HCV polyprotein results in the accumulation of β-catenin. Finally, we show that levels of β-catenin-dependent transcription are also elevated in the presence of the HCV polyprotein. Given the prevalence of β-catenin mutations in many human tumors, especially colon and hepatocellular carcinomas, these data implicate NS5A-mediated PI3K activation as a contributory factor in the increasingly common association between HCV infection and the development of hepatocellular carcinoma.

Hepatitis C virus non-structural NS5A protein inhibits epidermal growth factor (EGF)-stimulated activation of the Ras–ERK mitogen-activated protein kinase pathway at a point upstream of Ras activation. To determine the mechanism of this inhibition, the events occurring between the EGF receptor and Ras in Huh-7 cells harbouring the HCV subgenomic replicon were investigated. It was shown that, following EGF stimulation, these cells exhibited decreased EGF receptor tyrosine phosphorylation, aberrant recruitment of the adaptor proteins ShcA and Grb2 to the EGF receptor, reduced phosphorylation of ShcA and reduced Ras activation in comparison with control cells. These data are consistent with effects of NS5A and/or other components of the replicon on multiple events occurring upstream of Ras.

The motivations of colonial health regimes have undergone a number of sustained critiques in recent years, each charting the complex part played by bio-medicine, public health policies and medical professionals as intermediaries in the larger project of empire. Taking its cue from these studies, this article begins in the middle of 1904, a month before the first group of Chinese indentured miners were due to arrive in Durban’s well-policed port on chartered steamship. The Chinese were en-route to the Transvaal goldfields at the behest of the Chamber of Mines (COM) and Lord Alfred Milner’s self-consciously modernist administration, in a meticulously planned scheme to salvage an acute labour crisis in the Transvaal. Natal’s settler population, well-versed in an exclusionary politics of race, labour and immigration, took a keen interest as the COM officials prepared the passage of the Chinese across the Indian Ocean and through the self-governing colony. The impending arrival of the Chinese miners was of no small interest to those in Natal, given the social and political implications of Indian indenture to the sugarcane fields which had begun in Natal four decades before. It is to the social history of Indian-ocean indentured labour that this paper seeks to contribute, by making an exploratory investigation of the nexus of labour-discipline with colonial medical preoccupations. In so doing I highlight precocious state intervention in the lived spaces of migration. The spatial focus will, however, shift from Natal itself to the high seas of the Indian Ocean into which Durban’s Bluff extends an admonishing finger.

Hepatitis C virus (HCV) establishes a persistent infection, with up to 80% of infected individuals proceeding to chronic hepatitis, which in many cases may result in liver cirrhosis and hepatocellular carcinoma (HCC); indeed HCV infection is increasingly associated with the development of HCC. The long time period (up to 30 years) between primary infection and the onset of HCC implies that HCV is not directly oncogenic but in some way predisposes patients to develop tumors, though the mechanism for this is unclear as yet. We report here that NS5A binds directly to the Src homology 3 domain of the p85 regulatory subunit of phosphoinositide 3-kinase (PI3K), and this interaction is mediated by a novel (non-proline-rich) motif within NS5A. Coimmunoprecipitation analysis revealed that NS5A bound native heterodimeric PI3K and enhanced the phosphotransferase activity of the catalytic (p110) subunit both in vitro and in human cell lines harboring a subgenomic HCV replicon or expressing NS5A alone. NS5A-mediated activation of PI3K resulted in increased phosphorylation and activity of Akt/protein kinase B and concomitantly provided protection against the induction of apoptosis in both replicon-harboring cells and cells stably expressing NS5A alone. These data suggest that stimulation of PI3K by NS5A may represent an indirect mechanism for development of HCC in HCV-infected patients and further suggests potential therapeutic strategies to counteract the occurrence of HCV-related HCC.

The hepatitis C virus nonstructural 5A (NS5A) protein is a pleiotropic phosphoprotein that has been shown to associate with a wide variety of cellular signaling proteins. Of particular interest is the observation that a highly conserved C-terminal Class II polyproline motif within NS5A mediated association with the Src homology 3 domains of members of the Src family of tyrosine kinases and the mitogenic adaptor protein Grb2 (A. Macdonald, K. Crowder, A. Street, C. McCormick, and M. Harris, submitted for publication). In this study, we analyzed the consequences of NS5A expression on mitogenic signaling pathways within a variety of cell lines. Utilizing a transient luciferase reporter system, we observed that NS5A inhibited the activity of the mitogenic and stress-activated transcription factor activating protein-1 (AP1). This inhibition was dependent upon a Class II polyproline motif within NS5A. Using a combination of dominant active and negative mutants of components of the MAPK signaling pathways, selective inhibitors, together with immunoblotting with phospho-specific and phosphorylation-independent antibodies, we determined the signaling pathways targeted by NS5A to inhibit AP1. These studies demonstrated that in both stable NS5A-expressing cells and Huh-7-derived cells harboring subgenomic hepatitis C virus (HCV) replicons, this inhibition was mediated through the ERK signaling pathway. Importantly, a comparable inhibition of AP1 reporter activity was observed in hepatocyte-derived cell lines transduced with a baculovirus vector driving expression of full-length HCV polyprotein. In conclusion, these data strongly suggest a role for the NS5A protein in the perturbation of mitogenic signaling pathways in HCV-infected hepatocytes.

To assess how acute consumption of fructose affects flow-mediated dilatation in brachial artery.The randomised cross-over study was conducted at the University of Nottingham's Medical School, Nottingham, United Kingdom in July 2009. Ten healthy, white European males visited the laboratory twice, on separate mornings. On each visit, the volunteers consumed water (3 ml/kg bodyweight) and rested semi-supine on the bed. After 30 minutes, baseline diastolic brachial artery diameter and blood velocity was measured. At 60 minutes, blood velocity and five scans of brachial artery diameter were recorded before a blood pressure cuff was inflated on the forearm for 5 minutes and at 50-60-70-80 and 90 sec after cuff deflation. Fifteen minutes later, the volunteers consumed 500 ml of test-drink containing either fructose (0.75 g/kg bodyweight) or sucralose (sweetness-matched with fructose drink); 45 minutes later, baseline and flow-mediated dilatation was re-measured.Pre-drink and post-drink baseline values were similar on two occasions (p0.05). Brachial artery diameter increased (p0.05) by 7 +/- 3% pre-fructose and by 6.9 +/- 3% above baseline values post-fructose with no significant difference in these responses (p0.15). It increased (p0.05) by 5.9 +/- 3% above baseline before and by 6.7 +/- 2% (p0.01) after sucralose; a significant difference was noted in these flow-mediated dilatation responses (p0.02). Responses before and after sucralose were not different from those before and after fructose (p0.294).Acute ingestion of fructose or sucralose had no effect on flow-mediated dilatation measured at brachial artery.

Academic prototyping, like ethnography or bench studies, is a way of producing new knowledge about an idea. It is a phase in a critical process. In fact, it is perhaps better to speak of academic prototyping, rather than of academic prototypes. In this paper, as an example, we discuss the Dynamic Table of Contexts, an academic prototyping project that has served for many years as a focus of ideas about what it means to remediate and improve on a venerable print tradition.

Human papillomavirus (HPV) can successfully evade the host immune response to establish a persistent infection. We show here that expression of the E7 oncoprotein in primary human keratinocytes results in increased production of interleukin-18 (IL-18) binding protein (IL-18BP). This anti-inflammatory cytokine binding protein is a natural antagonist of IL-18 and is necessary for skin homeostasis. We map increased IL-18BP production to the CR3 region of E7 and demonstrate that this ability is shared among E7 proteins from different HPV types. Furthermore, mutagenesis shows that increased IL-18BP production is mediated by a gamma-activated sequence (GAS) in the IL-18BP promoter. Importantly, the increased IL-18BP levels seen in E7-expressing keratinocytes are capable of diminishing IL-18-mediated CD4 lymphocyte activation. This study provides the first evidence for a virus protein that targets IL-18BP and further validates E7 as a key component of the HPV immune evasion armor. IMPORTANCE Infection with human papillomavirus is a leading cause of morbidity and mortality worldwide. This study demonstrates that the E7 protein increases production of the anti-inflammatory IL-18BP, a major regulator of epithelial homeostasis. A number of E7 proteins can increase IL-18BP production, and a region within the CR3 of E7 is necessary for mediating the increase. A consequence of increased IL-18BP production is a reduction in CD4-positive lymphocyte activation in response to IL-18 costimulation. These findings may shed light on the immune evasion abilities of HPV.

Purpose It has previously been suggested that failure to achieve 70% metaphyseal fit with the Austin Moore prosthesis predisposes to subsidence and failure of the prosthesis secondary to stem loosening. We performed a radiological review to test this hypothesis, and determine whether a correlation existed between head size and metaphyseal fit of the uncemented Austin Moore hip prosthesis.

Merkel cell carcinoma (MCC) is a highly aggressive nonmelanoma skin cancer arising from epidermal mechanoreceptor Merkel cells. In 2008, a novel human polyomavirus, Merkel cell polyomavirus (MCPyV), was identified and is strongly implicated in MCC pathogenesis. Currently, little is known regarding the virus-host cell interactions which support virus replication and virus-induced mechanisms in cellular transformation and metastasis. Here we identify a new function of MCPyV small T antigen (ST) as an inhibitor of NF-κB-mediated transcription. This effect is due to an interaction between MCPyV ST and the NF-κB essential modulator (NEMO) adaptor protein. MCPyV ST expression inhibits IκB kinase α (IKKα)/IKKβ-mediated IκB phosphorylation, which limits translocation of the NF-κB heterodimer to the nucleus. Regulation of this process involves a previously undescribed interaction between MCPyV ST and the cellular phosphatase subunits, protein phosphatase 4C (PP4C) and/or protein phosphatase 2A (PP2A) Aβ, but not PP2A Aα. Together, these results highlight a novel function of MCPyV ST to subvert the innate immune response, allowing establishment of early or persistent infection within the host cell.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Aims and methodsWe aimed to update Information on the development of old age psychiatric services using a postal survey of consultants.ResultsThe response rate (51%) was lower than previous surveys in the 1980s. Senior academic appointments showed little increase and academic posts were largely National Health Service (NHS) funded. Services had smaller catchment areas and increased numbers of staff in medicine, nursing and social work, but not in occupational therapy, physiotherapy and psychology. Relative workload was increasing and most services included early-onset dementia. There was a decrease in provision of NHS long-stay beds with only marginal changes in other facilities.Clinical implicationsServices were offering more to patients than previously. Weakness in academic development may cause problems for the future; the results suggested that recruitment in some disciplines may already be problematical. There is a need to develop the role of NHS long-stay facilities.

We describe a procedure for the measurement of pyridoxal 5'-phosphate and of 4-pyridoxic acid in human plasma samples. It is based on the conversion of pyridoxal 5'-phosphate to 4-pyridoxic acid 5'-phosphate by cyanide in alkaline medium, followed by a high pressure liquid chromatographic separation, with fluorescence detection at acid pH. The assay is robust, sensitive, linear over a wide range, reproducible, and simple to perform. Samples stored at -80 degrees C are stable. Satisfactory agreement was obtained with results from the tyrosine decarboxylase-based assay for pyridoxal 5'-phosphate, in two other laboratories. Plasma samples from a National Survey of older British people were analyzed, and reference intervals for plasma pyridoxal 5'-phosphate intervals were derived. From the lower 2.5 percentile of the reference group, taken as the lower cut-off of the normal range, ca. 20% of elderly men and 11% of elderly women in the UK showed evidence of biochemical deficiency.

The difficulties of accurately measuring thermal properties, such as thermal conductivity of fractured and/or vuggy rocks are well known. Many commercially available methods are suitable only for liquids or re-packed sands. Others either require samples to be fairly uniform or are potentially destructive due to sample size limitations. In-situ measurements are possible, but can be costly. It can also be affected by in-situ distributions of fluids in the fractures and vugs, such as water, oil and possibly gas. In order to adapt the highly non-uniform nature of the carbonate cores without having to create further destruction of these cores, we developed a non-destructive method for measuring thermal conductivity of highly vuggy and moderately fractured carbonate cores in their whole diameter. In this paper, we report the theoretical background of this methodology; laboratory observations of thermal behaviours; data analysis and resulting thermal conductivity values of carbonates cores. Using this method, we measured 20 cleaned carbonate cores (88 mm in diameter) from Grosmont C and D Formation in Saleski area. Measured thermal conductivity values ranged from 1.00 to 2.87 W/m•K in Grosmont C, and 0.82 to 3.16 W/m•K in Grosmont D. These values were determined to be a strong function of porosity rather than mineralogy, as the Grosmont Formation typically consists of greater than 95% dolomite. These measurements are also shown to be in good agreement with prior studies on non-fractured dolomite reservoirs. A correlation for thermal conductivity was derived which can be used for numerical simulation models.

Oculodentodigital dysplasia (ODDD) is mainly an autosomal dominant human disease caused by mutations in the GJA1 gene, which encodes the gap junction protein connexin43 (Cx43). Surprisingly, there have been two autosomal recessive mutations reported that cause ODDD: a single amino acid substitution (R76H) and a premature truncation mutation (R33X). When expressed in either gap junctional intercellular communication (GJIC)-deficient HeLa cells or Cx43-expressing NRK cells, the R76H mutant trafficked to the plasma membrane to form gap junction-like plaques, whereas the R33X mutant remained diffusely localized throughout the cell, including the nucleus. As expected, the R33X mutant failed to form functional channels. In the case of the R76H mutant, dye transfer studies in HeLa cells and electrical conductance analysis in GJIC-deficient N2a cells revealed that this mutant could form functional gap junction channels, albeit with reduced macroscopic and single channel conductance. Alexa 350 dye transfer studies further revealed that the R76H mutant had no detectable negative effect on the function of co-expressed Cx26, Cx32, Cx37 or Cx40, whereas the R33X mutant exhibited significant dominant or trans-dominant effects on Cx43 and Cx40 as manifested by a reduction in wild-type connexin gap junction plaques. Taken together, our results suggest that the trans-dominant effect of R33X together with its complete inability to form a functional channel may explain why patients harboring this autosomal recessive R33X mutant exhibit greater disease burden than patients harboring the R76H mutant.

لقد أضفى حديث الدكتور فريد بن يحيى توازنا إلى ورشة العمل حيث أنه أثرى حالة النقاش الصحية حول العديد من المشاكل الفنية والسياسية التي يجب على المؤيدين لسلسلة احتجاز الكربون وتخزينه وضعها في اعتبارهم، وذلك إن كانوا يسعون حقا لتحقيق تغيير شامل ودائم الأثر. وقد أشار، على سبيل المثال، أن المناطق المحتملة لتخزين الكربون تحت الأرض ليست موزعة -بأي حال من الأحوال- بالتساوي على سطح الكرة الأرضية؛ وأوضح أن عمليتي نقل الكربون وتخزينه تتخللهما الكثير من المشكلات القانونية والمتعلقة بالسلامة التي لم تحل حتى الآن.

Transient knock-down of the gap junction protein Cx43 by antisense and siRNA, or gap junction block with mimetic peptides, have been shown to enhance epidermal wound healing. However, patients with oculodentodigital dysplasia (ODDD) express mutant Cx43 that leads to a chronic reduction in gap junctional intercellular communication. To determine whether mutant Cx43 in keratinocytes would impact upon the wound healing process, we localized Cx43 in human and mouse skin tissue expressing mutant Cx43 and assessed the ability of primary keratinocytes derived from a mouse model of ODDD to proliferate, migrate and differentiate. In the epidermis from an ODDD patient and in the epidermis of mice expressing the G60S mutant or in keratinocytes obtained from mutant mice, Cx43 was frequently found within intracellular compartments and rarely localized to punctate sites of cell-cell apposition. Primary keratinocytes derived from G60S mutant mice proliferated faster but migrated similarly to keratinocytes derived from wild-type control mice. Keratinocytes derived from mutant mice expressed abundant Cx43 and higher levels of involucrin and loricrin under low calcium conditions. However, after calcium-induced differentiation, similar levels of Cx43, involucrin and loricrin were observed. Thus, we conclude that during wound healing, mutant Cx43 may enhance keratinocyte proliferation and promote early differentiation of keratinocytes.

There are still specific areas where our knowledge of carbon storage is in need of improvement, particularly in carbonate reservoirs, since currently we extrapolate data from limited sources and the predictive modelling technologies employed have a level of uncertainty that needs to be addressed. We will highlight our efforts through the Qatar Carbonates and Carbon Storage Research Centre (a $70 million, 10 year research programme with currently 20 PhD students and 10 postdoctoral researchers along with 14 faculty members) to investigate the underlying science and engineering concerning carbonate reservoir characterisation, rock-fluid-CO₂ interactions and multiphase flow experiments under reservoir conditions linked to complimentary simulation and modelling advances, including the rapidly developing field of digital rocks. This has involved developing unique HTHP experimental rigs and pioneering new modelling techniques, enhancing the toolbox available to engineers and geoscientists to select suitable reservoirs and optimally design CO₂ storage processes. These capabilities extend over molecular-pore-core-field scales. We have four focused research laboratories (Qatar Stable Isotope Lab; Qatar Thermophysical Property Lab; Qatar Complex Fluids Lab; Qatar CCS Multiscale Imaging Lab) and will discuss the highlights of major research findings to date in the context of carbon storage in the Middle East.

Small RNA viruses have evolved many mechanisms to increase the capacity of their short genomes. Here we describe the identification and characterization of a novel open reading frame (ORF4) encoded by the murine norovirus (MNV) subgenomic RNA, in an alternative reading frame overlapping the VP1 coding region. ORF4 is translated during virus infection and the resultant protein localizes predominantly to the mitochondria. Using reverse genetics we demonstrated that expression of ORF4 is not required for virus replication in tissue culture but its loss results in a fitness cost since viruses lacking the ability to express ORF4 restore expression upon repeated passage in tissue culture. Functional analysis indicated that the protein produced from ORF4 antagonizes the innate immune response to infection by delaying the upregulation of a number of cellular genes activated by the innate pathway, including IFN-Beta. Apoptosis in the RAW264.7 macrophage cell line was also increased during virus infection in the absence of ORF4 expression. In vivo analysis of the WT and mutant virus lacking the ability to express ORF4 demonstrated an important role for ORF4 expression in infection and virulence. STAT1-/- mice infected with a virus lacking the ability to express ORF4 showed a delay in the onset of clinical signs when compared to mice infected with WT virus. Quantitative PCR and histopathological analysis of samples from these infected mice demonstrated that infection with a virus not expressing ORF4 results in a delayed infection in this system. In light of these findings we propose the name virulence factor 1, VF1 for this protein. The identification of VF1 represents the first characterization of an alternative open reading frame protein for the calicivirus family. The immune regulatory function of the MNV VF1 protein provide important perspectives for future research into norovirus biology and pathogenesis., Author Summary This report describes the identification and characterization of a novel protein of unknown function encoded by a mouse virus genetically similar to human noroviruses. This gene is unique to the mouse virus and occupies the same part of the genome that codes for the major capsid protein. The protein that we have described as virulence factor 1 (VF1) is found in all murine norovirus isolates, absent in all human strains but is indeed expressed during infection. Its expression enables MNV-1 to establish efficient infection of its natural host through interference with interferon-mediated response pathways and apoptosis. Our data would indicate that the VF1 protein is multi-functional with an ability to modulate the host's response to infection. Murine noroviruses are frequently used firstly as a model to study human norovirus replication and pathogenesis, studies hampered by their inability to replicate in cell culture. Secondly, persistent infection of laboratory animals with murine norovirus may affect other models of disease using experimental mice. The role of VF1 in infection and pathology in the differential outcome of infection is the source of continued research in our laboratory.