Search

Background: The prevalence of hypertensive heart disease (HHD) is high and there is currently no easy way to detect early HHD. Explore the application of radiomics using cardiac magnetic resonance (CMR) non-enhanced cine sequences in diagnosing HHD and latent cardiac changes caused by hypertension., Methods: 132 patients who underwent CMR scanning were divided into groups: HHD (42), hypertension with normal cardiac structure and function (HWN) group (46), and normal control (NOR) group (44). Myocardial regions of the end-diastolic (ED) and end-systolic (ES) phases of the CMR short-axis cine sequence images were segmented into regions of interest (ROI). Three feature subsets (ED, ES, and ED combined with ES) were established after radiomic least absolute shrinkage and selection operator feature selection. Nine radiomic models were built using random forest (RF), support vector machine (SVM), and naive Bayes. Model performance was analyzed using receiver operating characteristic curves, and metrics like accuracy, area under the curve (AUC), precision, recall, and specificity., Results: The feature subsets included first-order, shape, and texture features. SVM of ED combined with ES achieved the highest accuracy (0.833), with a macro-average AUC of 0.941. AUCs for HHD, HWN, and NOR identification were 0.967, 0.876, and 0.963, respectively. Precisions were 0.972, 0.740, and 0.826; recalls were 0.833, 0.804, and 0.863, respectively; and specificities were 0.989, 0.863, and 0.909, respectively., Conclusions: Radiomics technology using CMR non-enhanced cine sequences can detect early cardiac changes due to hypertension. It holds promise for future use in screening for latent cardiac damage in early HHD., (© 2024. The Author(s).)

Objective: This study employs the Geographically and Temporally Weighted Regression (GTWR) model to assess the impact of meteorological elements and imported cases on dengue fever outbreaks, emphasizing the spatial-temporal variability of these factors in border regions., Methods: We conducted a descriptive analysis of dengue fever's temporal-spatial distribution in Yunnan border areas. Utilizing annual data from 2013 to 2019, with each county in the Yunnan border serving as a spatial unit, we constructed a GTWR model to investigate the determinants of dengue fever and their spatio-temporal heterogeneity in this region., Results: The GTWR model, proving more effective than Ordinary Least Squares (OLS) analysis, identified significant spatial and temporal heterogeneity in factors influencing dengue fever's spread along the Yunnan border. Notably, the GTWR model revealed a substantial variation in the relationship between indigenous dengue fever incidence, meteorological variables, and imported cases across different counties., Conclusion: In the Yunnan border areas, local dengue incidence is affected by temperature, humidity, precipitation, wind speed, and imported cases, with these factors' influence exhibiting notable spatial and temporal variation., (Copyright © 2024 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.)

Chondrosarcoma is a malignant bone tumor that arises from abnormalities in cartilaginous tissue and is associated with lung metastases. Lymphangiogenesis plays an essential role in cancer metastasis. Visfatin is an adipokine reported to enhance tumor metastasis, but its relationship with VEGF-D generation and lymphangiogenesis in chondrosarcoma remains undetermined. Our results from clinical samples reveal that VEGF-D levels are markedly higher in chondrosarcoma patients than in normal individuals. Visfatin stimulation promotes VEGF-D-dependent lymphatic endothelial cell lymphangiogenesis. We also found that visfatin induces VEGF-D production by activating HIF-1α and reducing miR-2277-3p generation through the Raf/MEK/ERK signaling cascade. Importantly, visfatin controls chondrosarcoma-related lymphangiogenesis in vivo. Therefore, visfatin is a promising target in the treatment of chondrosarcoma lymphangiogenesis.

The baobab trees (genus Adansonia) have attracted tremendous attention because of their striking shape and distinctive relationships with fauna 1 . These spectacular trees have also influenced human culture, inspiring innumerable arts, folklore and traditions. Here we sequenced genomes of all eight extant baobab species and argue that Madagascar should be considered the centre of origin for the extant lineages, a key issue in their evolutionary history 2,3 . Integrated genomic and ecological analyses revealed the reticulate evolution of baobabs, which eventually led to the species diversity seen today. Past population dynamics of Malagasy baobabs may have been influenced by both interspecific competition and the geological history of the island, especially changes in local sea levels. We propose that further attention should be paid to the conservation status of Malagasy baobabs, especially of Adansonia suarezensis and Adansonia grandidieri, and that intensive monitoring of populations of Adansonia za is required, given its propensity for negatively impacting the critically endangered Adansonia perrieri., (© 2024. The Author(s).)

Microglial activation is a critical factor in the pathogenesis and progression of neuroinflammatory diseases. Mild hypothermia, known for its neuroprotective properties, has been shown to alleviate microglial activation. In this study, we explore the differentially expressed (DE) mRNAs and long non-coding RNAs (lncRNAs) in BV-2 microglial cells under different conditions: normal temperature (CN), mild hypothermia (YT), normal temperature with lipopolysaccharide (LPS), and mild hypothermia with LPS (LPS + YT). Venn analysis revealed 119 DE mRNAs that were down-regulated in the LPS + YT vs LPS comparison but up-regulated in the CN vs LPS comparison, primarily enriched in Gene Ontology terms related to immune and inflammatory responses. Furthermore, through Venn analysis of YT vs CN and LPS + YT vs LPS comparisons, we identified 178 DE mRNAs and 432 DE lncRNAs. Among these transcripts, we validated the expression of Tent5c at the protein and mRNA levels. Additionally, siRNA-knockdown of Tent5c attenuated the expression of pro-inflammatory genes (TNF-α, IL-1β, Agrn, and Fpr2), cellular morphological changes, NLRP3 and p-P65 protein levels, immunofluorescence staining of p-P65 and number of cells with ASC-speck induced by LPS. Furthermore, Tent5c overexpression further potentiated the aforementioned indicators in the context of mild hypothermia with LPS treatment. Collectively, our findings highlight the significant role of Tent5c down-regulation in mediating the anti-inflammatory effects of mild hypothermia., Competing Interests: Declaration of competing interest All the authors declare that they have no conflicts of interest., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin ( SPAST ) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain ( COL6A3 ) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST : c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND., Competing Interests: The authors declare that they have no competing interests., (Copyright: © 2024 Chen et al.)

X-ray scintillators have gained significant attention in medical diagnostics and industrial applications. Despite their widespread utility, scintillator development faces a significant hurdle when exposed to elevated temperatures, as it usually results in reduced scintillation efficiency and diminished luminescence output. Here we report a molecular design strategy based on a hybrid perovskite (TpyBiCl 5 ) that overcomes thermal quenching through multi-excited state switching. The structure of perovskite provides a platform to modulate the luminescence centers. The rigid framework constructed by this perovskite structure stabilized its triplet states, resulting in TpyBiCl 5 exhibiting an approximately 12 times higher (45 % vs. 3.8 %) photoluminescence quantum yield of room temperature phosphorescence than that of its organic ligand (Tpy). Most importantly, the interactions between the components of this perovskite enable the mixing of different excited states, which has been revealed by experimental and theoretical investigations. The TpyBiCl 5 scintillator exhibits a detection limit of 38.92 nGy s -1 at 213 K and a detection limit of 196.31 nGy s -1 at 353 K through scintillation mode switching between thermally activated delayed fluorescence and phosphorescence. This work opens up the possibility of solving the thermal quenching in X-ray scintillators by tuning different excited states., (© 2024 The Authors. Angewandte Chemie International Edition published by Wiley-VCH GmbH.)

Objective: Unsafe medication practices and medication errors are a major cause of harm in healthcare systems around the world. This study aimed to explore the factors that influence the risk of medication and provide medication risk evaluation model for adults in Shanxi province, China., Methods: The data was obtained from the provincial questionnaire from May to December 2022, relying on the random distribution of questionnaires and online questionnaires by four hospitals in Shanxi Province. Multiple linear regression analysis was used to explore the factors affecting the KAP score of residents. Univariate and multivariate logistic regression was used to determine the independent risk factors, and the nomogram was verified by receiver operating characteristic curve, calibration and decision curve analysis., Results: A total of 3,388 questionnaires were collected, including 3,272 valid questionnaires. The average scores of drugs KAP were 63.2 ± 23.04, 33.05 ± 9.60, 23.67 ± 6.75 and 33.16 ± 10.87, respectively. On the evaluation criteria of the questionnaire, knowledge was scored "fair", attitude and practice were scored "good". Sex, monthly income, place of residence, insurance status, education level, and employment were regarded as independent risk factors for medication and a nomogram was established by them., Conclusion: Males, low-income, and low-educated people are important factors affecting the risk of medication. The application of the model can help residents understand the risk of their own medication behavior and reduce the harm of medication., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Xie, Xie, Yang, Li, Zhang, Xie, Yang, Ning, Xie, Cheng, Duan, Wang, Hao and Shi.)

Irinotecan plays a crucial role in the neoadjuvant chemoradiotherapy (nCRT) of rectal cancer, but its optimal dosing is still unclear. In this study, we included 101 eligible patients with the UGT1A1*28 genotype of UGT1A1*1*1 (74.3%) and UGT1A1*1*28 (25.7%) and UGT1A1*6 genotypes of GG (63.4%), GA (32.7%), and AA (3.9%). All patients received preoperative radiotherapy (50 Gy/25 fractions) with concurrent irinotecan (UGT1A1*1*1: 80 mg/m 2 ; UGT1A1*1*28: 65 mg/m 2 ) and capecitabine (CapIri). SN-38 concentrations were measured at 1.5, 24, and 49 h post-administration. Patients were divided into four groups (Q1-Q4) based on the SN-38 concentration. The complete-response (CR) rate was the primary endpoint. The analysis demonstrated that the 49 h SN-38 concentration was relatively optimal for predicting efficacy and toxicity. The Q4 group had a significantly higher CR rate than the Q1 group (p = .019), but also higher rates of adverse events (p = .009). We screened the recommended 49 h SN-38, with a 0.5-1.0 ng/mL concentration range. We also validated the correlation between UGT1A1*6 polymorphism and SN-38 concentration, along with the clinical efficacy of irinotecan. In conclusion, our study identified the relatively optimal timepoint and concentration range for monitoring SN38 concentrations and revealed the clinical significance of UGT1A1*6 and UGT1A1*28 polymorphisms in guiding irinotecan administration, offering meaningful insights for personalised irinotecan dosing., (© 2023 UICC.)

Reactions of Co(OAc) 2 ·4H 2 O, N'N' -bis(3-pyridylmethyl)oxalamide ( L ) and 4,4'-sulfonyldibenzoic acid (H 2 SDA) afforded four coordination polymers with the same mixed ligands, {[Co( L )(SDA)(H 2 O) 2 ]·H 2 O·CH 3 OH} n , 1 , {[Co( L ) 0.5 (SDA)]·2H 2 O·0.5 L } n , 2 , {[Co( L ) 1.5 (SDA)(H 2 O)]·H 2 O} n , 3 , and {[Co 2 ( L ) 1.5 (SDA) 2 (H 2 O) 2 ]·4H 2 O} n , 4 , which have been structurally characterized using single-crystal X-ray crystallography. Complexes 1 - 4 are 2D layers, revealing topologies of sql , 2,6L1, (4,4)Ia, and 6L12, respectively, and demonstrating that the metal-to-ligand ratio, solvent system, and reaction temperature are important in determining the structural diversity. The immersion of these complexes into various solvents shows that the structural types govern the chemical stabilities of 1 - 4 . Reversible structural transformation is shown for complexes 1 and 2 upon solvent removal and adsorption, while those of 3 and 4 are irreversible.

Macrophages are innate immune cells that interact with complex extracellular matrix environments, which have varied stiffness, composition, and structure, and such interactions can lead to the modulation of cellular activity. Collagen is often used in the culture of immune cells, but the effects of substrate functionalization conditions are not typically considered. Here, we show that the solvent system used to attach collagen onto a hydrogel surface affects its surface distribution and organization, and this can modulate the responses of macrophages subsequently cultured on these surfaces in terms of their inflammatory activation and expression of adhesion and mechanosensitive molecules. Collagen was solubilized in either acetic acid (Col-AA) or N -(2-hydroxyethyl)piperazine- N' -ethanesulfonic acid (HEPES) (Col-HEP) solutions and conjugated onto soft and stiff polyacrylamide (PA) hydrogel surfaces. Bone marrow-derived macrophages cultured under standard conditions (pH 7.4) on the Col-HEP-derived surfaces exhibited stiffness-dependent inflammatory activation; in contrast, the macrophages cultured on Col-AA-derived surfaces expressed high levels of inflammatory cytokines and genes, irrespective of the hydrogel stiffness. Among the collagen receptors that were examined, leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) was the most highly expressed, and knockdown of the Lair-1 gene enhanced the secretion of inflammatory cytokines. We found that the collagen distribution was more homogeneous on Col-AA surfaces but formed aggregates on Col-HEP surfaces. The macrophages cultured on Col-AA PA hydrogels were more evenly spread, expressed higher levels of vinculin, and exerted higher traction forces compared to those of cells on Col-HEP. These macrophages on Col-AA also had higher nuclear-to-cytoplasmic ratios of yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ), key molecules that control inflammation and sense substrate stiffness. Our results highlight that seemingly slight variations in substrate deposition for immunobiology studies can alter critical immune responses, and this is important to elucidate in the broader context of immunomodulatory biomaterial design.

Objectives: To investigate the role of normal weight central obesity (NWCO) in the prognosis of sudden sensorineural hearing loss (SSNHL)., Methods: We retrospectively investigated 807 cases of SSNHL from January of 2008 to August of 2019 from the Department of Otorhinolaryngology at Kaohsiung Medical University Hospital in southern Taiwan. We analyzed the association between overweight and obesity, NWCO, and the prognosis of SSNHL. The demographic and clinical characteristics, audiometry results, and outcomes were also reviewed., Results: The nonobese (body mass index [BMI] < 24 kg/m 2 ) and overweight and obese groups (BMI ≥ 24 kg/m 2 ) comprised 343 (42.50%) and 464 (57.50%) patients, respectively. The favorable prognosis rates in the nonobese and the overweight and obese groups were 45.48% and 45.91%, respectively, without a significant difference ( P  = .9048). Multivariate logistic regression revealed that BMI (adjusted odds ratio [aOR] = 1.00, 95% CI = 0.948-1.062, P  = .9165) was not significantly associated with SSNHL recovery. The normal weight noncentral obesity (NWNCO) and NWCO groups comprised 266 (77.55%) and 77 (22.45%) patients, respectively, and had favorable prognosis rates of 48.50% and 35.06%, respectively. The difference between the groups was significant ( P  = .0371). Multivariate logistic regression analysis revealed that NWCO (aOR = 2.51, 95% CI = 1.292-5.019, P  = .0075) was significantly associated with SSNHL recovery., Conclusions: NWCO may significantly affect the prognosis of SSNHL., Competing Interests: Declaration of Conflicting InterestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Background: Infraorbital aging develops during the natural aging process. Various treatment options offer unique benefits, accompanied by diverse side effect profiles, and can be synergistically combined to optimize results. This study aimed to evaluate the efficacy of a comprehensive approach involving non-cross-linked hyaluronic acid injection and smooth absorbable PPDO (poly p-dioxanone) thread insertion for infraorbital rejuvenation., Methods: This retrospective case series study enrolled ten female patients with infraorbital aging from March 2022 to April 2023. Clinical outcomes, patient satisfaction, and adverse events were assessed at 1, 3, and 6 months posttreatment., Results: The median Global Aesthetic Improvement Scale scores evaluated by the operator and blinded evaluator were 1.70 ± 0.42 and 1.80 ± 0.35, respectively, at six months posttreatment. The median Allergan Infraorbital Hollows Scale determined by the operator was 1.15 ± 0.34 at six months posttreatment, whereas the scores evaluated by the blinded evaluator were 1.15 ± 0.53. At six months after treatment, 50% of patients were satisfied, and an additional 40% reported strong satisfaction with the clinical improvement following treatment. No serious adverse events, such as infections, lumps, irregularities, Tyndall effect, hematoma, or skin necrosis, occurred during the treatment period., Conclusions: The combination of PPDO thread insertion and non-cross-linked hyaluronic acid injection yielded satisfactory and effective clinical outcomes with no occurrence of serious adverse events for infraorbital rejuvenation. We anticipate that this study will contribute to the advancement of novel treatment options for infraorbital aging., Level of Evidence Iv: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 ., (© 2023. The Author(s).)

Glucose disturbances are a common comorbidity of major depressive disorder (MDD) patients and have been extensively studied in the past. However, few studies have explored glucose disturbances in first-episode drug-naïve (FEDN) MDD patients. The purpose of this study was to examine the prevalence and risk factors of glucose disturbances in FEDN MDD patients to understand the relationship between MDD and glucose disturbances in the acute early phase and provide important implications for therapeutic interventions. Using a cross-sectional design, we recruited a total of 1718 MDD patients. We collected their socio-demographic information, clinical data, and blood glucose indicators.17-item Hamilton Depression Rating Scale (HAMD), 14-item Hamilton Anxiety Rating Scale (HAMA), and the positive symptom subscale of the Positive and Negative Syndrome Scale (PANSS) were used to assess their depression, anxiety, psychotic symptoms, respectively. The prevalence of glucose disturbances in FEDN MDD patients was 13.6%. Depression, anxiety and psychotic symptoms, body mass index (BMI) levels and suicide attempts rates were higher in the group with glucose disorders than in the group without glucose disorders among patients with first-episode drug-naive MDD. Correlation analysis showed that glucose disturbances were associated with HAMD score, HAMA score, BMI, psychotic symptoms and suicide attempts. Furthermore, binary logistic regression showed that HAMD score and suicide attempts were independently associated with glucose disturbances in MDD patients. Our findings suggest that the prevalence of comorbid glucose disturbances is very high in FEDN MDD patients. Moreover, more severe depressive symptoms and higher suicide attempts are correlated with glucose disturbances in MDD FEDN patients in the early stage., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany.)

Background: The sterile insect technique (SIT) has proven to be an effective approach in managing the population of major invasive pests. Our previous studies showed that irradiation of Cydia pomonella males at a dosage of 366 Gy X-rays resulted in complete sterility. However, the mating competitiveness of sterilized males is significantly compromised, which can be attributed to a decline in their ability to fly., Results: In this study, we examined the flight patterns of both male and female adults of C. pomonella. The results revealed significant variations in the average flight speed of both genders at different stages of maturity, with females displaying longer flight duration and covering greater distances. Effect of irradiation on the flight performance of 3-day-old male moths was further evaluated, as they demonstrated the longest flight distance. The findings indicated a significant decrease in flight distance, duration, and average speed, due to wing deformities caused by irradiation, which also limited the dispersal distance of moths in orchards, as indicated by the mark-and-recapture assay. Reverse-transcription quantitative polymerase chain reaction analysis revealed a down-regulation of flight-related genes such as Flightin, myosin heavy chain, and Distal-less following radiation exposure., Conclusion: These findings demonstrate that X-ray irradiation at a radiation dose of 366 Gy has a detrimental effect on the flight ability of male C. pomonella adults. These insights not only contribute to a better understanding of how radiation sterilization diminishes the mating competitiveness of male moths, but also aid in the development and improvement of SIT practices for the effective control of C. pomonella. © 2023 Society of Chemical Industry., (© 2023 Society of Chemical Industry.)

Ischemic stroke is a significant burden on human health worldwide. Carotid Atherosclerosis stenosis plays an important role in the comprehensive assessment and prevention of ischemic stroke patients. High-resolution vessel wall magnetic resonance imaging has emerged as a successful technique for assessing carotid atherosclerosis stenosis. This advanced imaging modality has shown promise in effectively displaying a wide range of characteristics associated with the condition, leading to a comprehensive evaluation. High-resolution vessel wall magnetic resonance imaging not only enables a comprehensive evaluation of the instability of carotid atherosclerosis stenosis plaques but also provides valuable information for understanding the pathogenesis and predicting the prognosis of ischemic stroke patients. The purpose of this article is to review the application of high-resolution magnetic resonance imaging in ischemic stroke and carotid atherosclerotic stenosis., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2024 The Authors. Published by Elsevier Ltd.)

Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (>3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 Cobb et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Aim: To understand how liver sinusoidal endothelial cells (LSECs) respond to nonalcoholic steatohepatitis (NASH)., Methods: We profiled single-LSEC from livers of control and MCD-fed mice. The functions of C-Kit + -LSECs were determined using coculture and bone marrow transplantation (BMT) methods., Results: Three special clusters of single-LSEC were differentiated. C-Kit + -LSECs of cluster 0, Msr1 + -LSECs of cluster 1 and Bmp4 + Selp + -VECs of cluster 2 were revealed, and these cells with diverse ectopic expressions of genes participated in regulation of endothelial, fibrosis and lipid metabolism in NASH. The number of C-Kit + -primary LSECs isolated from MCD mice was lower than control mice. Immunofluorescence co-staining of CD31 and C-KIT showed C-Kit + -LSECs located in hepatic sinusoid were also reduced in NASH patients and MCD mice, compared to AIH patients and control mice respectively. Interestingly, lipotoxic hepatocytes/HSCs cocultured with C-Kit + -LSECs or the livers of MCD mice receipting of C-Kit + -BMCs (bone marrow cells) showed less steatosis, inflammation and fibrosis, higher expression of prolipolytic FXR and PPAR-α, lower expression of TNF-α and α-SMA. Furthermore, coculturing or BMT of C-Kit + -endothelial derived cells could increase the levels of hepatic mitochondrial LC3B, decrease the degree of mitochondrial damage and ROS production through activating Pink1-mediated mitophagy pathway in NASH., Conclusions: Hence, a novel transcriptomic view of LSECs was revealed to have heterogeneity and complexity in NASH. Importantly, a cluster of C-Kit + -LSECs was confirmed to recovery Pink1-related mitophagy and NASH progression., (© 2024. The Author(s).)

Climate warming and air pollution are the main environmental problems in China. This study used China's Carbon Accounting Database, energy economic model, and air quality model to analyze the potential carbon emission peaking path and synergistic air quality improvement gain in the industrial sector in Hunan Province. Based on China's Carbon Accounting Database and the local industry/energy statistical yearbooks in Hunan, the total CO 2 emissions in Hunan Province in 2019 were 310.6 Mt, of which the industrial sector accounted for over 70% of the emissions, mainly from the production and supply of electricity, steam, and heat; the production of non-metallic minerals; and the smelting and pressing of ferrous metals. Three potential industrial carbon emission peaking scenarios were analyzed using the LEAP energy economic model, including the business-as-usual scenario (peaking by 2030), moderate emission reduction scenario (peaking by 2028), and aggressive emission reduction scenario (peaking by 2025), by employing different economic growth rates, energy technology progress, and energy structures of the industrial sector. Furthermore, by combining the anthropogenic air pollutant emission inventory and the regional air quality model WRF-Chem, we analyzed the air quality improvement associated with various carbon emission peak paths. The results showed that the annual mean concentrations of major air pollutants had decreased in the three scenarios, especially in the Chang-Zhu-Tan Region. The aggressive emission reduction scenario was the most effective scenario, followed by the moderate emission reduction scenario and the business-as-usual scenario. Manufacturing was the sector with the most significant synergistic effect of pollution and carbon reduction. When carbon emission peaks were achieved, the annual average concentrations of PM 2.5 and PM 10 in Hunan Province could be synergistically reduced by 0.6-1.8 μg·m -3 and 1.8-8.9 μg·m -3 , respectively. Our findings offer important insights into carbon emission peaking and can provide useful information for potential mitigation actions.

Purpose: To analyze changes in survival outcomes in patients with ovarian clear cell carcinoma (OCCC) treated consecutively over a 16-year period using a population-based cohort., Methods: We conducted a retrospective analysis of OCCC from 2000 to 2015 using data from the Surveillance, Epidemiology, and End Results (SEER) program. The ovarian cancer-specific survival (OCSS) and overall survival (OS) were analyzed according to the year of diagnosis. Joinpoint Regression Program, Kaplan-Meier analysis, and multivariate Cox regression analyses were used for statistical analysis., Results: We included 4257 patients in the analysis. The analysis of annual percentage change in OCSS (P=0.014) and OS (P=0.006) showed that patients diagnosed in later years had significantly better outcomes compared to those diagnosed in early years. The results of the multivariate Cox regression analyses showed that the year of diagnosis was the independent prognostic factor associated with OCSS (P=0.004) and had a borderline effect on OS (P=0.060). Regarding the SEER staging, the OCSS (P=0.017) and OS (P=0.004) of patients with distant stage showed a significant trend toward increased, while no significant trends were found in the survival of patients with localized or regional stage diseases. Similar trends were found in those aged <65 years or those treated with surgery and chemotherapy. However, no statistically significant changes in the survival rate were found in those aged ≥65 years or those receiving surgery alone regardless of SEER stage during the study period., Conclusions: Our study observed a significant increase in the survival outcomes in OCCC from 2000 to 2015, and patients aged <65 years and those with distant stage experienced a greater improvement in survival., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision., (Copyright © 2024 Tian, Wang, Xu, Wu and Zhou.)

Purpose: To determine the prevalence and characteristics of radial fundus autofluorescence (FAF) in highly myopic women., Methods: This was a retrospective, observational case study to determine the prevalence of radial FAF in the ultra-widefield FAF images in women. The clinical characteristics of these patients were evaluated., Results: Fifteen of 1,935 (0.78%) highly myopic women were found to have radial FAF. Their mean age was 36.6 ± 25.6 years, and their mean best-corrected visual acuity was 0.3 ± 0.42 logMAR units. The mean axial length (AL) was 28.8 ± 2.8 mm. Among the 15 cases, eight did not have pigmentary changes and seven had pigmentary changes in the ultra-widefield FAF images. The women with the pigmentary changes were significantly older ( P = 0.021), had poorer BCVA ( P = 0.001), and had longer ALs ( P = 0.002). The visual fields and electroretinograms were worse in the eyes with pigmentary changes., Conclusion: The prevalence of radial FAF was 0.78% in women with high myopia. These patients might have mutations in the RPGR or RP2 genes and can develop high myopia and retinitis pigmentosa. Ultra-widefield FAF images should be examined in all highly myopic patients for early detection of radial FAF, and myopia prevention and genetic counseling for possible genetic therapy are recommended.

AGS-30, a new andrographolide derivative, showed significant anticancer and anti-angiogenic characteristics. However, its role in controlling macrophage polarization and tumor immune response is unknown. Thus, the main goals of this study are to investigate how AGS-30 regulates macrophage polarization and how it suppresses breast cancer metastasis. AGS-30 inhibited IL-4 and IL-13-induced RAW 264.7 and THP-1 macrophages into M2-like phenotype. However, AGS-30 did not affect the LPS and IFN-γ-induced polarization of M1-like macrophages. AGS-30 reduced the mRNA expressions of CD206, Arg-1, Fizz-1, Ym-1, VEGF, IL-10, MMP2, and MMP9 in M2-like macrophages in a concentration-dependent manner. In contrast, andrographolide treatment at 5 μM did not affect M1-like and M2-like macrophage polarization. The conditioned medium from M2-like macrophages increased 4T1 breast cancer cell migration and invasion, whereas AGS-30 inhibited these effects. In the 4T1 breast tumor xenograft mice, the tumor volume and weight were reduced without affecting body weight after receiving AGS-30. AGS-30 treatment also reduced lung and liver metastasis, with reduced STAT6, CD31, VEGF, and Ki67 protein expressions. Moreover, the tumors had considerably fewer M2-like macrophages and Arg-1 expression, but the proportion of M1-like macrophages and iNOS expression increased after AGS-30 treatment. Same results were found in the tail vein metastasis model. In conclusion, this study shows that AGS-30 inhibits breast cancer growth and metastasis, probably through inhibiting M2-like macrophage polarization. Our findings suggest that AGS-30 may be a potential immunotherapeutic alternative for metastatic breast cancer., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Masson SAS.. All rights reserved.)

Background: The demand for soft tissue filler injections has experienced a significant increase in recent years. Therefore, this study used bibliometric analysis to identify prominent research areas and emerging trends within the field., Methods: Publications concerning research on soft tissue filler injections were collected from the Web of Science Core Collection database. Subsequently, VOSviewer 1.6.18 and CiteSpace 6.2.R4 software were used to analyze the co-authorship, co-occurrence, and citations of countries, institutions, authors, hotspot keywords, and journals associated with these studies., Results: A total of 1370 records pertaining to filler injection research conducted between 2000 and 2022 were identified. The United States (524 publications) emerged as the country with the highest number of publications in this field, with Mayo Clinic (37 publications) making the most substantial contribution. Dermatologic Surgery emerged as the leading journal in this field, publishing the highest number of research articles (151 publications) and also being the most frequently co-cited. Cotofana proved to be the most prolific author with 51 publications, and Lemperle emerged as the most frequently co-cited author with 628 citations (including total link strength: 6587). The most popular keywords, in descending order of popularity, were "dermal filler," "injection," "soft-tissue augmentation," "complications," and "hyaluronic acid.", Conclusions: The findings of this study offer a comprehensive overview of the main directions in filler injection research. Furthermore, they underscore the imperative of intensifying efforts to prevent complications linked to filler injections., Competing Interests: The authors have no financial interest to declare in relation to the content of this article., (Copyright © 2024 The Authors. Published by Wolters Kluwer Health, Inc. on behalf of The American Society of Plastic Surgeons.)

Medulla Tetrapanacis (MT) is a commonly used herb to promote lactation and manage mastitis in lactating mothers. However, its anti-inflammatory and anti-bacterial effects are currently unknown. We hypothesized that MT water extract possesses anti-inflammatory and anti-bacterial effects by modulating macrophage polarization to reduce the release of inflammatory mediators and phagocytosis via inactivation of MAPKs pathways. The chemical composition of the MT water extract was analyzed by UPLC-Orbitrap-mass spectrometry. The anti-inflammatory and anti-bacterial properties of the MT water extract were examined using LPS-stimulated inflammation and Staphylococcus aureus infection model in RAW 264.7 cells, respectively. The underlying mechanism of action of the MT water extract was also investigated. We identified eight compounds by UPLC-Orbitrap-mass spectrometry that are abundant within the MT water extract. MT water extract significantly suppressed LPS-induced nitric oxide, TNF-α and IL-6 secretion in RAW 264.7 cells which was accompanied by the promotion of macrophage polarization from pro-inflammatory towards anti-inflammatory phenotypes. MT water extract significantly suppressed the LPS-induced MAPK activation. Finally, MT water extract decreased the phagocytic capacity of the RAW 264.7 cells against S. aureus infection. MT water extract could suppress LPS-induced inflammation by promoting macrophages towards an anti-inflammatory phenotype. In addition, MT also inhibited the growth of S. aureus., (© 2023. The Author(s), under exclusive licence to Springer Nature Switzerland AG.)

Cancer of unknown primary (CUP) presents a complex diagnostic challenge, characterized by metastatic tumors of unknown tissue origin and a dismal prognosis. This review delves into the emerging significance of artificial intelligence (AI) and machine learning (ML) in transforming the landscape of CUP diagnosis, classification, and treatment. ML approaches, trained on extensive molecular profiling data, have shown promise in accurately predicting tissue of origin. Genomic profiling, encompassing driver mutations and copy number variations, plays a pivotal role in CUP diagnosis by providing insights into tumor type-specific oncogenic alterations. Mutational signatures (MS), reflecting somatic mutation patterns, offer further insights into CUP diagnosis. Known MS with established etiology, such as ultraviolet (UV) light-induced DNA damage and tobacco exposure, have been identified in cases of dedifferentiated/transdifferentiated melanoma and carcinoma. Deep learning models that integrate gene expression data and DNA methylation patterns offer insights into tissue lineage and tumor classification. In digital pathology, machine learning algorithms analyze whole-slide images to aid in CUP classification. Finally, precision oncology, guided by molecular profiling, offers targeted therapies independent of primary tissue identification. Clinical trials assigning CUP patients to molecularly guided therapies, including targetable alterations and tumor mutation burden as an immunotherapy biomarker, have resulted in improved overall survival in a subset of patients. In conclusion, AI- and ML-driven approaches are revolutionizing CUP management by enhancing diagnostic accuracy. Precision oncology utilizing enhanced molecular profiling facilitates the identification of targeted therapies that transcend the need to identify the tissue of origin, ultimately improving patient outcomes., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Lysine specific demethylase 1 (LSD1), a transcriptional modulator that represses or activates target gene expression, is overexpressed in many cancer and causes imbalance in the expression of normal gene networks. Over two decades, numerous LSD1 inhibitors have been reported, especially some of which have entered clinical trials, including eight irreversible inhibitors (TCP, ORY-1001, GSK-2879552, INCB059872, IMG-7289, ORY-2001, TAK-418, and LH-1802) and two reversible inhibitors (CC-90011 and SP-2577). Most clinical LSD1 inhibitors demonstrated enhanced efficacy in combination with other agents. LSD1 multitarget inhibitors have also been reported, exampled by clinical dual LSD1/histone deacetylases (HDACs) inhibitors 4SC-202 and JBI-802. Herein, we present a comprehensive overview of the combination of LSD1 inhibitors with various antitumor agents, as well as LSD1 multitarget inhibitors. Additionally, the challenges and future research directionsare also discussed, and we hope this review will provide new insight into the development of LSD1-targeted anticancer agents.

Background: The detection rate of depression among university students has been increasing in recent years, becoming one of the main psychological diseases that endangers their physical and mental health. According to statistics, self-harm and suicide, for which there is no effective intervention, are the second leading causes of death., Aim: To explore the relationship between different elements and levels of physical activity and college students' depression-symptom-specific working memory indicators., Methods: Of 143 college students were analyzed using the Beck Depression Self-Rating Scale, the Physical Activity Rating Scale, and the Working Memory Task., Results: There was a significant difference between college students with depressive symptoms and healthy college students in completing verbal and spatial working memory (SWM) tasks correctly (all P < 0.01). Physical Activity Scale-3 scores were significantly and positively correlated with the correct rate of the verbal working memory task ( r = 0.166) and the correct rate of the SWM task ( r = 0.210) (all P < 0.05). There were significant differences in the correct rates of verbal and SWM tasks according to different exercise intensities (all P < 0.05) and different exercise durations (all P < 0.05), and no significant differences in the correct rates of verbal and SWM tasks by exercise frequency (all P > 0.05)., Conclusion: An increase in physical exercise among college students, particularly medium- and high-intensity exercise and exercise of 30 min or more, can improve the correct rate of completing working memory tasks., Competing Interests: Conflict-of-interest statement: The authors declare no conflicts of interest., (©The Author(s) 2024. Published by Baishideng Publishing Group Inc. All rights reserved.)

Objective: To understand the epidemiological characteristics and incidence trend of severe fever with thrombocytopenia syndrome (SFTS) in China. Methods: The incidence data of SFTS in China from 2018 to 2021 were collected from Chinese Disease Prevention and Control Information System for a statistical and descriptive epidemiological analysis by using software such as Excel 2016, Joinpoint 5.0.2, SPSS 26.0, and GraphPad Prism 8.0, especially, the SFTS cases reported monthly by key provinces were analyzed. Results: From 2018 to 2021, a total of 8 835 SFTS cases were reported in 25 provinces and the annual incidence showed an upward trend. The distribution of SFTS cases showed clustering, but the cases were mainly sporadic ones. The cases began to increase in March, mainly occurred during April to October (96.79%,8 551/8 835), and peaked during May to July. The cases were mainly distributed in middle-aged and old farmers, and slight more cases were women. The average case fatality rate was 5.38%, which varied greatly with areas. The case fatality rate tended to increase with age. Conclusion: From 2018 to 2021, the epidemiological characteristics of SFTS in China remained stable, but the number of reported cases gradually increased and the distribution showed an expanding trend, to which close attention should be paid.

Hawthorn has the efficacy of eliminating turbidity and lowering the blood lipid level, and it is used for treating hyperlipidemia in clinic. However, the bioactive components of hawthorn are still unclear. In this study, the spectrum-effect relationship was employed to screen the bioactive components of hawthorn in the treatment of hyperlipidemia, and then the bioactive components screened out were verified in vivo. Furthermore, the quality control method for hawthorn was developed based on liquid chromatography-mass spectrometry(LC-MS). The hyperlipidemia model of rats was built, and different polar fractions of hawthorn extracts and their combinations were administrated by gavage. The effects of different hawthorn extract fractions on the total cholesterol(TC), triglycerides(TG), and low-density lipoprotein-cholesterol(LDL-C) in the serum of model rats were studied. The orthogonal projections to latent structures(OPLS) algorithm was used to establish the spectrum-effect relationship model between the 24 chemical components of hawthorn and the pharmacodynamic indexes, and the bioactive components were screened out and verified in vivo. Finally, 10 chemical components of hawthorn, including citric acid and quinic acid, were selected to establish the method for evaluating hawthorn quality based on LC-MS. The results showed that different polar fractions of hawthorn extracts and their combinations regulated the TG, TC, and LDL-C levels in the serum of the model rats. The bioactive components of hawthorn screened by the OPLS model were vitexin-4″-O-glucoside, vitexin-2″-O-rhamnoside, rutin, citric acid, malic acid, and quinic acid. The 10 chemical components of hawthorn, i.e., citric acid, quinic acid, rutin, gallic acid, vitexin-4″-O-glucoside, vitexin-2″-O-rhamnoside, malic acid, vanillic acid, neochlorogenic acid, and fumaric acid were determined, with the average content of 38, 11, 0.018, 0.009 5, 0.037, 0.017, 8.1, 0.009 5, 0.073, and 0.98 mg·g~(-1), respectively. This study provided a scientific basis for elucidating the material basis of hawthorn in treating hyperlipidemia and developed a content determination method for evaluating the quality of hawthorn.

Background/purpose: In 2020, metabolic Associated Fatty Liver Disease (MAFLD) was proposed to replace non-alcoholic fatty liver disease (NAFLD) with new diagnostic criteria. The prevalence and clinical outcomes of MAFLD subtypes remained unclear., Methods: The participants from Taiwan bio-bank cohort were included. MAFLD was defined as the presence of fatty liver, plus any of the following three conditions: overweight/obesity, diabetes mellitus (DM), or metabolic dysfunction. The patients with positive HBsAg or anti-HCV were considered as chronic HBV or HCV infection. NAFLD fibrosis score (NFS) > 0.676 plus fibrosis 4 (FIB-4) score > 2.67 was defined as advanced liver fibrosis. Atherosclerosis was diagnosed as having carotid plaques on duplex ultrasounds. The clinical outcomes were assessed among four subtypes of MAFLD including DM, obesity, chronic HBV infection, and chronic HCV infection., Results: A total of 21,885 participants (mean age 55.34 ± 10.31; 35.69% males) were included in the final analysis. Among them, 38.83% were diagnosed with MAFLD. The prevalence of MAFLD was 66.95% in DM patients, 65.07% in obese participants, 33.74% in chronic HBV patients, and 30.23% in chronic HCV patients. Logistic regression analysis showed that the subtypes of DM and chronic HCV infection were associated with an increased risk of advanced liver fibrosis in MAFLD patients. Additionally, the subtypes of DM and lean were associated with an increased risk of atherosclerosis, but a decreased risk of atherosclerosis in the subtype of chronic HBV infection., Conclusion: This population-based study proves the concept that subtypes of MAFLD can help risk stratification of clinical outcomes., Competing Interests: Declaration of competing interest All authors declare no conflict and interest., (Copyright © 2023 Formosan Medical Association. Published by Elsevier B.V. All rights reserved.)

Background: Soothing the liver and regulating qi is one of the core ideas of traditional Chinese medicine (TCM) in the treatment of fatty liver. Si-Ni-San (SNS) is a well-known herbal formula in TCM for liver soothing and qi regulation in fatty liver treatment. However, its efficacy lacks modern scientific evidence., Purpose: This study was aimed to investigate the impact of SNS on metabolic associated fatty liver disease (MAFLD) in mice and explore the underlying molecular mechanisms, particularly its effects on lipid metabolism in hepatocytes., Methods: The therapeutic effect of SNS was evaluated using in vivo and in vitro models of high-fat/high-cholesterol (HFHC) diet-induced mice and palmitic acid (PA)-induced hepatocytes, respectively. Molecular biological techniques such as RNA-sequencing (RNA-seq), co-immunoprecipitation (co-IP), and western blotting were employed to elucidate the molecular mechanism of SNS in regulating lipid metabolism in hepatocytes., Results: Our findings revealed that SNS effectively reduced lipid accumulation in the livers of HFHC diet-induced mice and PA-induced hepatocytes. RNA-seq analysis demonstrated that SNS significantly down-regulated the expression of fatty acid synthase (Fasn) in the livers of HFHC-fed mice. Mechanistically, SNS inhibited Fasn expression and lipid accumulation by activating adenosine monophosphate (AMP)-activated protein kinase (AMPK). Activation of AMPK suppressed the activity of the transcriptional coactivator p300 and modulated the protein stability of sterol regulatory element-binding protein-1c (SREBP-1c). Importantly, p300 was required for the inhibition of Fasn expression and lipid accumulation by SNS. Furthermore, SNS activated AMPK by decreasing adenosine triphosphate (ATP) production in hepatocytes., Conclusion: This study provided novel evidence on the regulatory mechanisms underlying the effects of SNS on Fasn expression. Our findings demonstrate, for the first time, that SNS exerts suppressive effects on Fasn expression through modulation of the AMPK/p300/SREBP-1c axis. Consequently, this regulatory pathway mitigates excessive lipid accumulation and ameliorates MAFLD in mice., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier GmbH. All rights reserved.)

Hepatoblastoma, a common extracranial malignant solid tumor in childhood, is often detected at an advanced stage and is difficult to treat surgically. Despite the availability of multiple comprehensive treatments that can be combined with surgery, hepatoblastoma treatment outcomes remain poor. Surgery is the main treatment strategy for hepatoblastoma, but it faces many challenges, including tumor attachment to surrounding tissues, tumor wrapping or invading of vital organs and tissues, the presence of giant or multiple tumors, distant metastasis, the formation of a tumor thrombus, and significant surgical trauma. In this review, we discuss recent research advances and propose potential strategies for overcoming these challenges. Such strategies may improve the rate of hepatoblastoma resection and local control in children, as well as reduce complications and trauma., (© 2024 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.)

Since reef ecosystems can offer intricate habitats for various marine organisms, calcified reefs may contain valuable long-term environmental data. This study investigated stable isotopic composition of marine organisms from the Taoyuan and Linshanbi crustose coralline algae (CCA) reef ecosystems to understand sewage pollution. CCA samples from Taoyuan (Palaeo Xin A: ∼1000 years old and Palaeo G: ∼7000 years old) and Linshanbi (Palaeo L: ∼7000 years old and modern CCA) had significantly lower δ 15 N values (2.5-5.6 ‰) compared to modern CCA from Taoyuan (10.2 ± 1.2 ‰). Intertidal organisms from the Taoyuan CCA reef also showed higher δ 15 N values than those from Linshanbi CCA reef, indicating anthropogenic stress in both ecosystems. Long-term pollution monitoring and effective strategies to mitigate sewage pollution are recommended for these CCA reef ecosystems., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

While the worldwide distribution of geogenic arsenic (As)-affected groundwater is highly overlapped with the areas with abundant groundwater, utilization of As-contained groundwater is an inevitable compromise in those areas where surface water is not enough for irrigation. Since the occurrence of As in groundwater is often accompanied by high iron (Fe) contents, the facilitation of As and Fe precipitation without adding additional oxidizers and adsorbents is considered an environmental-friendly approach to removing As in groundwater. In the present study, the oxidation/filtration dual-process with sprinkling height of 25 cm and 120 kg filter media efficiently increased the dissolved oxygen (DO) concentration (0.36-1.52 mg/L) and oxidation-reduction potential (ORP) (24-63 mV), which facilitated the formation of Fe oxides and As co-precipitation. The correlation of As removal efficiencies with their respective flow rates indicated that a decrease in groundwater Fe and an increase of Fe in sands and gravels filters as the flow rate increased evidenced the rapid oxidation of Fe to form the Fe hydroxides. In a 40-hour continuous aeration/filtration operation, As and Fe concentrations in groundwater were reduced by 79.5% and 64.88% within 40 hrs, respectively. The ease of filter replacement and cost-effectiveness in operation can be the major attractions and innovations for future field practices.

Objectives: To explore the technical and clinical evaluation of ultrasound-derived fat fraction (UDFF) measurement in adult patients in whom fatty liver was suspected., Materials and Methods: In this prospective study, 41 participants were initially enrolled in our hospital between October 2022 and December 2022 and received UDFF assessment using Siemens ACUSON Sequoia system equipped with DAX transducer. UDFF measurement was performed three times to obtain UDFF values from each imaging location (V hepatic segment and VIII hepatic segment) per participant, and the depth (skin-to-capsule distance) was automatically measured. The echogenicity of liver tissue in B mode ultrasound (BMUS) was compared to the normal kidney tissue, and fatty liver was graded as mild (Grade 1), moderate (Grade 2), and severe (Grade 3). The median of the acquired overall median UDFF values was used for statistical analysis. All ultrasound examinations were performed by one of two radiologists (with 20 and 10 years of liver ultrasound imaging experience)., Results: Finally, UDFF measurement was successfully performed on 38 participants to obtain valid values, including 21 men with a median age of 40.0 years (interquartile range [IQR]: 23.0 - 58.5) and 17 women with a median age of 60.0 years (IQR: 29.5 - 67.0). Fatty liver was diagnosed by BMUS features in 47.4% (18/38) participants. Among all participants, the median UDFF value was 7.0% (IQR: 4.0 - 15.6). A significant difference in UDFF values was found between participants with fatty liver and without fatty liver (U = 7.0, P < 0.001), and UDFF values elevated as the grade of the fatty liver increased (P < 0.001). The median UDFF values from the three UDFF measurements obtained during each ultrasound examination showed excellent agreement (ICC = 0.882 [95% confidence interval: 0.833 - 0.919]). The Spearman correlation of UDFF values in different depths was moderate, with a rs value of 0.546 (P < 0.001). No significant differences in UDFF values were found between V hepatic segment and VIII hepatic segment (U = 684.5, P = 0.697)., Conclusions: UDFF provides a novel non-invasive imaging tool for hepatic steatosis assessment with excellent feasibility.

Introduction: Peripheral neuropathy (PN), one of the commonest neurological complications of chronic kidney disease (CKD), was associated with physical limitation. Studies showed that a decrease in physical capability in patients with CKD is related with an increased risk of mortality. The objective of our research was to directly explore the relationship between PN and risk of mortality in patients with CKD., Method: 1,836 participants with CKD and 6,036 participants without CKD, which were classified by PN based on monofilament examination in National Health and Nutrition Examination Survey (NHANES), were collected from the 1999 to 2004 National Health and Nutrition Examination Surveys. Multivariable Cox proportional hazard models were conducted to assess the relationships of PN and deaths in patients with CKD and non-CKD., Results: During 14 years of a median follow-up from 1999 to 2015 and 2004 to 2015, 1,072 (58.4%) and 1,389 (23.0%) deaths were recorded in participants with CKD and without CKD, respectively. PN was related with increased all-cause mortality even after adjusting possible confounding factors in population with CKD (hazard ratio [HR] 1.34, 95% confidence interval [CI] 1.17-1.53) and without CKD (HR 1.27, 95% CI 1.12-1.43). And the adjusted HRs (95% CI) for cardiovascular mortality of the people with CKD and without CKD who suffered from PN were 1.42 (1.07, 1.90) and 1.23 (0.91, 1.67), respectively, versus those without PN., Conclusion: PN was related with a higher risk of all-cause and cardiovascular death in people with CKD, which clinically suggests that the adverse prognostic impact of PN in the CKD population deserves attention and is an important target for intervention., Competing Interests: All authors declare no conflict of interest., (© 2023 The Author(s). Published by S. Karger AG, Basel.)

Background: Accurate estimation of perioperative blood transfusion risk in lumbar posterior interbody fusion is essential to reduce the number, cost, and complications associated with blood transfusions. Machine learning algorithms have the potential to outperform traditional prediction methods in predicting perioperative blood transfusion. This study aimed to construct a machine learning-based perioperative transfusion risk prediction model for lumbar posterior interbody fusion in order to improve the efficacy of surgical decision-making. Methods: We retrospectively collected clinical data on 1905 patients who underwent lumbar posterior interbody fusion surgery at the Second Hospital of Shanxi Medical University between January 2021 and March 2023. All the data was randomly divided into a training set and a validation set, and the "feature&#95;importances" method provided by eXtreme Gradient Boosting (XGBoost) algorithm was applied to select statistically significant features on the training set to establish five machine learning prediction models. The optimal model was identified by utilizing the area under the curve (AUC) and the probability calibration curve on the validation set. Shapley additive explanations (SHAP) and local interpretable model-agnostic explanations (LIME) were employed for interpretable analysis of the optimal model. Results: In the postoperative outcomes of patients, the number of hospital days in the transfusion group was longer than that in the non-transfusion group. Additionally, the transfusion group experienced higher total hospital costs, 90-day readmission rates, and complication rates within 90 days after surgery than the non-transfusion group. A total of 9 features were selected for the models. The XGBoost model performed best with an AUC value of 0.958. The SHAP values showed that intraoperative blood loss, intraoperative fluid infusion, and number of fused segments were the top 3 most important features affecting perioperative blood transfusion in lumbar posterior interbody fusion. The LIME algorithm was used to interpret the individualized prediction. Conclusion: Surgery, ASA class, levels fused, total intraoperative blood loss, operative time, and preoperative Hb are viable predictors of perioperative blood transfusion in lumbar posterior interbody fusion. The XGBoost model has demonstrated superior predictive efficacy compared to the traditional logistic regression model, making it a more effective decision-making tool for perioperative blood transfusion., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Lang, Liu and Wang.)

Hepatocellular carcinoma (HCC) is the most common form of liver cancer, with the second highest mortality rate in all cancer. Energy reprogramming is one of the hallmarks of cancer, and emerging evidence showed that targeting glycolysis is a promising strategy for HCC treatment. Cryptocaryone has been shown to display promising anti-cancer activity against numerous types of cancer. Previous study also indicated that cryptocaryone induces cytotoxicity by inhibiting glucose transport in cancer cells, but the detailed mechanism still needs to be elucidated. Therefore, this study aimed to investigate the relationship between the anti-cancer effect and glycolytic metabolism of cryptocaryone in human HCC cells. In this study, we found that cryptocaryone potently induced growth inhibition by apoptotic cell death in HCC cells. Cryptocaryone also suppressed the ATP synthesis, lactate production and glycolytic capacity of HCC cells. Mechanistic investigations showed that phosphorylation of Akt and c-Src, as well as the expression of HK1 were impeded by cryptocaryone. Moreover, cryptocaryone markedly increased the expression level of transcription factor FoxO1. Importantly, clinical database analysis confirmed the negative correlation between HK1 and FoxO1. High expression levels of HK-1 were positively correlated with poorer survival in patients with HCCs. These results suggest that cryptocaryone may promote cell apoptosis by inhibiting FoxO1-mediated aerobic glycolysis through Akt and c-Src signaling cascades in human HCC cells. This is the first study to indicate that cryptocaryone exerts anti-cancer property against human HCC cells. Cryptocaryone is a potential natural product worthy of further development into a promising candidate for HCC treatment.

Coronavirus disease 2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to be a major public health concern. Nucleocapsid (N) protein is the most abundant structural protein on SARS-CoV-2 virions and induces the production of antibodies at the early stage of infection. Large-scale preparation of N protein is essential for the development of immunoassays to detect antibodies to SARS-CoV-2 and the control of virus transmission. In this study, expression of water-soluble N protein was achieved through inducing protein expression at 25°C with 0.5 mM IPTG for 12 h. Western blot and ELISA showed that recombinant N protein could be recognized by sera collected from subjects immunized with Sinovac inactivated SARS-CoV-2 vaccine. Four monoclonal antibodies namely 2B1B1, 4D3A3, 5G1F8, and 7C6F5 were produced using hybridoma technology. Titers of all four monoclonal antibodies in ELISA reached more than 1.28×10 6.0. Moreover, all monoclonal antibodies could react specifically with N protein expressed by transfection of pcDNA3.1-N into BHK-21 cells in IPMA and IFA. These results indicated that water-soluble N protein retained high immunogenicity and possessed the same epitopes as that of native N protein on virions. In addition, the preparation of water-soluble N protein and its monoclonal antibodies laid the basis for the development of immunoassays for COVID-19 detection.

Since the outbreak of Severe Acute Respiratory Syndrome Virus-2 (SARS-CoV-2) in 2019, more than 15 million spike protein sequences have been identified, raising a new challenge for the development of a broadly protective vaccine against the various emerging variants. We found that the virus, like most other human viruses, depends on host-made glycans to shield the conserved epitopes on spike protein from immune response and demonstrated that deletion of the glycan shields exposed highly conserved epitopes and elicited broadly protective immune responses. In this study, we identified 17 conserved epitopes from 14 million spike protein sequences and 11 of the conserved epitopes are in the S2 domain, including the six most conserved epitopes in the stem region. We also demonstrated that deletion of the glycosites in the spike messenger RNA (mRNA) S2 domain or the stem region exposed the highly conserved epitopes and elicited broadly protective immune responses, particularly CD-8 + T cell response against various SARS-CoV-2 variants, and other human coronaviruses including MERS, SARS viruses, and those causing common cold., Competing Interests: Competing interests statement:C.-H.W. serves on the Scientific Advisory Board of Rock BioMedical, Inc. C.-Y.W. and S.-W.W. were postdoctoral fellows at Academia Sinica while this research was conducted. They are now employees of Rock BioMedical, Inc. C.-W.C., C.-Y.W., S.-W.W., K.-S.L., and C.-H.W. received unlisted stocks of Rock BioMedical, Inc. from Academia Sinica as a result of technology transfer. The findings in this publication were filed for patent application.

Osteosarcoma is a malignant tumor with high metastatic potential, such that the overall 5-year survival rate of patients with metastatic osteosarcoma is only 20%. Therefore, it is necessary to unravel the mechanisms of osteosarcoma metastasis to identify predictors of metastasis by which to develop new therapies. Fibroblast growth factor 2 (FGF2) is a growth factor involved in embryonic development, cell migration, and proliferation. The overexpression of FGF2 and FGF receptors (FGFRs) has been shown to enhance cancer cell proliferation in lung, breast, gastric, and prostate cancers as well as melanoma. Nonetheless, the roles of FGF2 and FGFRs in human osteosarcoma cells remain unknown. In the present study, we found that FGF2 was overexpressed in human osteosarcoma sections and correlated with lung metastasis. Treatment of FGF2 induced migration activity, invasion activity, and intercellular adhesion molecule (ICAM)-1 expression in osteosarcoma cells. In particular, the downregulation or antagonism of FGFR1-4 suppressed FGF2-induced ICAM-1 expression and cancer cell migration. Furthermore, FGFR1, FGFR2, FGFR3, and FGFR4 were involved in FGF2-induced the phospholipase Cβ/protein kinase Cα/proto-oncogene c-Src signaling pathway and triggered c-Jun nuclear translocation. Subsequent c-Jun upregulation of activator protein-1 transcription activity on the ICAM-1 promoter led to an increased migration of osteosarcoma cells. Moreover, the knockdown of endogenous FGF2 suppressed ICAM-1 expression and migration of osteosarcoma cells. These findings suggest that FGF2/FGFR1-4 signaling promotes metastasis via its direct downstream target gene ICAM-1, revealing a novel potential therapeutic target for osteosarcoma., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Background: Protection against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) reinfection relies on immunity generated after primary infection. However, humoral immunity following primary infection with the Omicron variant is not well understood., Methods: We prospectively recruited children <19 years with virologically-confirmed SARS-CoV-2 infection at National Cheng Kung University Hospital from February 2022 to September 2022 during the first wave of Omicron BA.2 outbreak in Taiwan. Serum samples were collected one month after acute infection to measure anti-spike protein receptor binding domain antibody levels and surrogate virus neutralizing antibody (NAb) levels against wild type disease and variants., Results: Of the 164 patients enrolled, most were under 5 years (65.2%) with a diagnosis of upper respiratory tract infection. Children under 6 months with maternal coronavirus disease 2019 (COVID-19) vaccination had higher levels of both anti-SARS-CoV-2 spike antibody (119.0 vs 27.4 U/ml, p < 0.05) and anti-wild type NAb (56.9% vs 27.6% inhibition, p = 0.001) than those without. Children aged 5-12 years with prior vaccination had higher anti-spike antibody, anti-wild type, and anti-Omicron BA.2 NAb levels than those without (all p < 0.05). In previously naïve children without maternal or self-vaccination, those 6 months to 2 years had the highest antibody levels. Multivariable linear regression analysis showed age was the only independent factor associated with antibody level., Conclusions: In our study, children aged 6 months to 2 years have the highest antibody responses to SARS-CoV-2 Omicron variant infection. Age and prior vaccination are the main factors influencing the immunogenicity of SARS-CoV-2 infection., Competing Interests: Declaration of competing interest None., (Copyright © 2023. Published by Elsevier B.V.)

Background: Endophytic fungi have proven to be a rich source of novel natural products with a wide-array of biological activities and higher levels of structural diversity., Results: Chemical investigation on the liquid- and solid-state fermented products of Chaetomium globosum Km1226 isolated from the littoral medicinal herb Atriplex maximowicziana Makino resulted in the isolation of compounds 1-14. Their structures were determined by spectroscopic analysis as three previously undescribed C 13 -polyketides, namely aureonitol C (1), mollipilins G (2), and H (3), along with eleven known compounds 4-14. Among these, mollipilin A (5) exhibited significant nitric oxide production inhibitory activity in LPS-induced BV-2 microglial cells with an IC 50 value of 0.7 ± 0.1 µM, and chaetoglobosin D (10) displayed potent anti-angiogenesis property in human endothelial progenitor cells (EPCs) with an IC 50 value of 0.8 ± 0.3 µM., Conclusions: Three previously unreported compounds 1-3 were isolated and identified. Mollipilin A (5) and chaetoglobosin D (10) could possibly be developed as anti-inflammatory and anti-angiogenic lead drugs, respectively., (© 2023. The Author(s).)

With the significant increase in the global prevalence of diabetes mellitus (DM), the occurrence of diabetic peripheral neuropathy (DPN) has become increasingly common complication associated with DM. It is particularly in the peripheral nerves of the hands, legs, and feet. DPN can lead to various adverse consequences that greatly affect the quality of life for individuals with DM. Despite the profound impact of DPN, the specific mechanisms underlying its development and progression are still not well understood. Advancements in magnetic resonance imaging (MRI) technology have provided valuable tools for investigating the central mechanisms involved in DPN. Structural and functional MRI techniques have emerged as important methods for studying the brain structures and functions associated with DPN. Voxel-based morphometry allows researchers to assess changes in the volume and density of different brain regions, providing insights into potential structural alterations related to DPN. Functional MRI investigates brain activity patterns, helping elucidate the neural networks engaged during sensory processing and pain perception in DPN patients. Lastly, magnetic resonance spectroscopy provides information about the neurochemical composition of specific brain regions, shedding light on potential metabolic changes associated with DPN. By synthesizing available literature employing these MRI techniques, this study aims to enhance our understanding of the neural mechanisms underlying DPN and contribute to the improvement of clinical diagnosis., Competing Interests: JY and Q-hZ were employed by Shenzhen Frontiers in Chinese Medicine Research Co., Ltd. AL was employed by Servier (Beijing) Pharmaceutical Research & Development Co. Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Wang, Yue, Gao, Cao, Li, Peng, Liu, Han, Li and Zhang.)

To look in-depth into the phytochemical and pharmacological properties of Taiwan juniper, this study investigated the chemical profiles and anti-lymphangiogenic activity of Juniperus chinensis var. tsukusiensis . In this study, four new sesquiterpenes, 12-acetoxywiddrol ( 1 ), cedrol-13-al ( 2 ), α-corocalen-15-oic acid ( 3 ), 1,3,5-bisaoltrien-10-hydroperoxy-11-ol ( 4 ), one new diterpene, 1β,2β-epoxy-9α-hydroxy-8(14),11-totaradiene-3,13-dione ( 5 ), and thirty-three known terpenoids were successfully isolated from the heartwood of J. chinensis var. tsukusiensis . The structures of all isolates were determined through the analysis of physical data (including appearance, UV, IR, and optical rotation) and spectroscopic data (including 1D, 2D NMR, and HRESIMS). Thirty-four compounds were evaluated for their anti-lymphangiogenic effects in human lymphatic endothelial cells (LECs). Among them, totarolone ( 6 ) displayed the most potent anti-lymphangiogenic activity by suppressing cell growth (IC 50 = 6 ± 1 µM) of LECs. Moreover, 3β-hydroxytotarol ( 7 ), 7-oxototarol ( 8 ), and 1-oxo-3β-hydroxytotarol ( 9 ) showed moderate growth-inhibitory effects on LECs with IC 50 values of 29 ± 1, 28 ± 1, and 45 ± 2 µM, respectively. Totarolone ( 6 ) also induced a significant concentration-dependent inhibition of LEC tube formation (IC 50 = 9.3 ± 2.5 µM) without cytotoxicity. The structure-activity relationship discussion of aromatic totarane-type diterpenes against lymphangiogenesis of LECs is also included in this study. Altogether, our findings unveiled the promising potential of J. chinensis var. tsukusiensis in developing therapeutics targeting tumor lymphangiogenesis.

Background: Translating aging rejuvenation strategies into clinical practice has the potential to address the unmet needs of the global aging population. However, to successfully do so requires precise quantification of aging and its reversal in a way that encompasses the complexity and variation of aging., Methods: Here, in a cohort of 113 healthy women, tiled in age from young to old, we identified a repertoire of known and previously unknown markers associated with age based on multimodal measurements, including transcripts, proteins, metabolites, microbes, and clinical laboratory values, based on which an integrative aging clock and a suite of customized aging clocks were developed., Findings: A unified analysis of aging-associated traits defined four aging modalities with distinct biological functions (chronic inflammation, lipid metabolism, hormone regulation, and tissue fitness), and depicted waves of changes in distinct biological pathways peak around the third and fifth decades of life. We also demonstrated that the developed aging clocks could measure biological age and assess partial aging deceleration by hormone replacement therapy, a prevalent treatment designed to correct hormonal imbalances., Conclusions: We established aging metrics that capture systemic physiological dysregulation, a valuable framework for monitoring the aging process and informing clinical development of aging rejuvenation strategies., Funding: This work was supported by the National Natural Science Foundation of China (32121001), the National Key Research and Development Program of China (2022YFA1103700 and 2020YFA0804000), the National Natural Science Foundation of China (81502304), and the Quzhou Technology Projects (2022K46)., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2023 Elsevier Inc. All rights reserved.)