Search

A infecção pelo HIV continua sendo um problema de saúde em todo o mundo, bem como asIST’s, que continuam insidiosas na população LGBTQIAP+. Nesse contexto, ainda hoje há umaassociação entre a população LGBTQIAP+ e a AIDS, uma vez que esse segmento social foihistoricamente exposto à vulnerabilidade, sendo ao longo dos anos excluída do acesso àsaúde, principalmente no âmbito do Sistema Único de Saúde. É fato que a implementação daPrEP e de medidas preventivas na saúde pública brasileira trouxe muitos benefícios àspopulações chaves, inclusive a grupos pertencentes a comunidade LGBTQIAP+. Sendo acomunidade LGBTQIAP+ uma população em risco, dado o histórico social de preconceito emarginalização, esta pesquisa tem por objetivo determinar o grau de conhecimento dapopulação LGBTQIAP+ em relação a profilaxia pré-exposição ao HIV e as infecçõessexualmente transmissíveis. Trata-se de um estudo transversal descritivo prospectivo comindivíduos autodeclarados LGBTQIAP+, por meio de questionário virtual divulgado e aplicadoa nível nacional por meio de mídias sociais. Participaram da pesquisa 302 indivíduos queatendiam aos critérios de inclusão, destes 57,2% autodeclaram-se como gays. Sobre ospreservativos, 24,83% dos indivíduos informou pouco interesse, enquanto 71,52%declararam interesse em usar medicações após o sexo desprotegido e 67,54% informaramdisposição para testagem rápida após situação de risco. Embora os participantes tenhamapresentado conhecimento em relação às IST's, o mesmo não aconteceu quanto aoconhecimento sobre a profilaxia pré-exposição ao HIV. Os riscos do conhecimentoinsuficiente para a PrEP e o alto interesse por medidas após situação de risco demonstramfalhas no que diz respeito à comunicação e divulgação das medidas preventivas e seusbenefícios ao público mais vulnerável. Com base nos resultados encontrados, alerta-se paraos riscos a que a população LGBTQIAP+ está submetida, levantando reflexões sobre asconsequências da vulnerabilidade dessa comunidade e a não aderência dessas pessoas aosistema de saúde, assim como a falta de preparo do sistema para resolução dos problemasde saúde com olhar voltado a essa população, bem como a necessidade de mais estudos nosdiferentes contextos desta temática.

This work proposed to develop a milk fermented by Lactobacillus helveticus (LH) or associated with a culture of Streptococcus thermophilus (LHST) added with hibiscus extract and to evaluate the antioxidant activity and growth evolution of lactic cultures during storage under refrigeration at 4 ± 1ºC. Fermented milk received free form hibiscus extract (LHExL and LHSTExL) or encapsulated with PVP and Tween 80 (LHExE and LHSTexE). Antioxidant activity (DPPH and FRAP) was evaluated at 1, 15 and 30 days. The results showed that the titratable acidity content was lower after fermentation. The viability of the lactic acid bacteria was satisfactory, which met the legal requirements and remained stable up to 30 days of storage for both fermented milk (LH and LHST). The antioxidant activity against the DPPH radical was greater than 80%, but it did not show conclusive results regarding the interaction of lactic cultures and the different forms of application of the hibiscus extract. However, LH showed greater antioxidant activity by the FRAP method when associated with hibiscus extract encapsulated in the initial time. This analysis allowed to observe that the association of hibiscus extract regardless of the form conveyed to fermented milk increased the antioxidant activity by the FRAP method and this remained stable over the storage time. Therefore, the study allowed to conclude that the fermented milk associated with the hibiscus extract contributed to the increase in antioxidant activity and remained stable over the storage time. Este trabajo propuso desarrollar una leche fermentada por Lactobacillus helveticus (LH) o asociada a un cultivo de Streptococcus thermophilus (LHST) agregado con extracto de hibisco y evaluar la actividad antioxidante y evolución del crecimiento de cultivos lácticos durante el almacenamiento en refrigeración a 4 ± 1ºC. La leche fermentada recibió extracto de hibisco en forma libre (LHExL y LHSTexL) o encapsulada con PVP y Tween 80 (LHExE y LHSTexE). Se evaluó la actividad antioxidante (DPPH y FRAP) en tiempos de 1, 15 y 30 días. Los resultados mostraron que el contenido de acidez titulable fue menor después de la fermentación. La viabilidad de las bacterias del ácido láctico fue satisfactoria, que cumplió con los requisitos legales y se mantuvo estable durante los 30 días de almacenamiento de ambos os leche fermentada (LH y LHST). La actividad antioxidante frente al radical DPPH fue superior al 80%, pero no arrojó resultados concluyentes en cuanto a la interacción de cultivos lácticos y las diferentes formas de aplicación del extracto de hibisco. Sin embargo, la LH mostró una mayor actividad antioxidante por el método FRAP cuando se asoció con el extracto de hibisco encapsulado en el tiempo inicial. Este análisis nos permitió observar que la asociación de extracto de hibisco independientemente de la forma transportada a la leche fermentada aumentó la actividad antioxidante por el método FRAP y esta se mantuvo estable durante el tiempo de almacenamiento. Por lo tanto, el estudio nos permitió concluir que la leche fermentada asociada con el extracto de hibisco contribuyó al aumento de la actividad antioxidante y se mantuvo estable durante el tiempo de almacenamiento. Este trabalho propôs desenvolver um leite fermentado por Lactobacillus helveticus (LH) ou associada com cultura de Streptococcus thermophilus (LHST) adicionado de extrato de hibisco e avaliar a atividade antioxidante e evolução do crescimento das culturas láticas durante a estocagem sob refrigeração a 4 ± 1ºC. O leite fermentado recebeu extrato de hibisco na forma livre (LHExL e LHSTExL) ou encapsulado com PVP e Tween 80 (LHExE e LHSTExE). Avaliou-se a atividade antioxidante (DPPH e FRAP) nos tempos de 1, 15 e 30 dias. Os resultados demonstraram que o teor de acidez titulável foi inferior após a fermentação. A viabilidade das bactérias láticas foi satisfatória, as quais atenderam os requisitos legais e mantiveram estáveis até 30 dias de estocagem para ambas as caldas do leite fermentado (LH e LHST). A atividade antioxidante frente ao radical DPPH foi superior a 80%, porém não apresentou resultados conclusivos relativos à interação das culturas láticas e das diferentes formas de aplicação do extrato de hibisco. Porém, o LH apresentou maior atividade antioxidante pelo método FRAP quando associado ao extrato de hibisco encapsulado no tempo inicial. Esta análise permitiu observar que a associação do extrato de hibisco independente da forma veiculada ao leite fermentado aumentou a atividade antioxidante pelo método de FRAP e este manteve estável ao longo do tempo de estocagem. Portanto, o estudo permitiu concluir que o leite fermentado associado ao extrato de hibisco contribuiu com o aumento da atividade antioxidante e manteve estável ao longo do tempo de estocagem.

© 2022 European Academy of Neurology, Background and purpose: The development of high-quality clinical practice guidelines (CPGs) takes substantial time, effort, and resources. During the past years, the European Academy of Neurology (EAN) guideline production was significantly increased, so the need to develop clear, transparent, and methodologically solid criteria for prioritizing guideline topics became apparent. With this paper, we aim to define a set of criteria to be applied for prioritizing topics for future EAN guidelines, as well as the procedure for their implementation. Methods: After review of the literature, we identified a recent systematic review that reported on the main prioritization criteria used by health organizations. Based on these, we developed a list of 20 preliminary criteria, which were voted on through a Delphi consensus procedure, including 160 stakeholders. Finally, we established a working procedure on how to submit and select new guideline topic proposals within the EAN. This procedure was reviewed by the EAN Scientific Committee and the Board. Results: The first round, 61.3% of the participants voted, and 86% of them participated in the second round. Seven criteria were approved with this procedure. After the selection of the criteria, a prioritization procedure was launched, and the first 30 topics are reported in this paper. This bottom-up process that involved the whole EAN community was followed by a top-down process, using additional criteria for further selection by the EAN board members. Conclusions: We describe the development of prioritization criteria to be applied in the process of topic selection for future EAN CPGs. We will perform regular reviews and adjustments of the process.

Esta entrevista surge a propósito da tradução para português do livro mais emblemático de Daniel Bertaux — Le récit de vie — que o tornou reconhecido internacionalmente e que já vai na sua quarta reedição. A sua ligação a Portugal não é recente e tem-se refletido na participação em diversas conferências, inclusive no XI Congresso Português de Sociologia em 2021. Daniel Bertaux nasceu no ano em que foi declarada a II Guerra Mundial. Esta e outras guerras constituíram marcos importantes na sua...

In a context of a generalization of education and centralization of knowledge in today's societies, followed by the "intragenerationality" (Fernández Enguita, 2007) of change, individuals were required to be actively and continuously involved in new stages of education and learning. The right - and the duty - to a relationship with education has been affirmed - beyond initial education and school - which must take place throughout and wide life. The current "cosmopolitanization" of societies (Beck, 2016), underlines the importance of a transnational analysis, for the understanding of social phenomena. Recognizing the importance of a comparing analysis of adult education in Southern European countries, this article aims for the share of regularities and differences that are found in adult education, training, and learning [ALE] systems and in the relationship that adults in each of these countries have with lifelong education. Because we can only understand the adult’s relation with Lifelong Learning [LLL] by previously analyzing his social structure [ALE], firstly it will be presented the result of a documental analysis which compares adult education systems in Southern European countries [their history, educational contexts, public policies, provision, and promotors]. Subsequently, and through secondary analysis of data from the Adult Education Survey (2016), the relationship with lifelong learning in each of these countries, through participation and its main barriers, will be compared. These comparisons will allow improvement in the effectiveness by reaching the generalization of LLL in the so-called Southern European countries, allowing them to learn with each other’s, benchmarking good practices. info:eu-repo/semantics/publishedVersion

Complex hyperkinetic movement disorders are a rare complication of stroke, frequently involving posterolateral contralateral thalamic lesions. One of the proposed mechanisms for these presentations is proprioceptive impairment, hence not involving deregulation of the basal ganglia-thalamocortical circuits. We report a patient who presented with dystonic posturing and athetoid movements with onset 2 years after right frontoparietotemporal stroke. Brain MRI showed no thalamic lesion. Based on the phenomenology, a diagnosis of pseudochoreoathetosis was proposed. To our knowledge, this is the first case report of poststroke pseudochoreoathetosis without thalamic involvement.

A divisão dos conceitos e das noções teóricas por componentes disciplinares diferentes é um dos desafios no processo de ensino e aprendizagem nas escolas. Este trabalho explora uma abordagem interdisciplinar na implementação didática do estudo do processo de fotossíntese nas escolas ou nos cursos técnicos integrados ao ensino médio. A proposta deste estudo é demonstrar como a interdisciplinaridade pode ser incorporada na sequência didática nas aulas presenciais e também nas aulas do ensino remoto – este sem perda de dinâmica e eficácia no processo de ensino e aprendizagem. A sequência didática e a atividade de ensino remoto foram baseadas nos conceitos principais das teorias psicológicas de Ausubel, Moreira e Vygotsky e das teorias educacionais de Moreira e Lipman para construção de aprendizagem significativa crítica. Para organização e avaliação do processo de aprendizagem, foi selecionado e aplicado o mapa conceitual, de Novak. Os resultados obtidos mostram nível suficiente de aprendizagem dos conceitos estudados do processo de fotossíntese e também a adaptação dos alunos ao método de ensino e aprendizagem na perspectiva da interdisciplinaridade, bem como foi indicado a adesão positiva à ferramenta do mapa conceitual. Com esses resultados, espera-se que a abordagem apresentada nesta pesquisa seja útil para outros profissionais da área educacional, permitindo sua aplicação nos diferentes componentes disciplinares e distintos espaços da educação formal. The attribution of concepts and theoretical notions to different disciplinary areas is one of the challenges in the teaching and learning processes in schools. This work explores an interdisciplinary approach in the didactic implementation of the study of the photosynthesis process in high schools or in technical courses integrated with high schools. The purpose of this research is to demonstrate how interdisciplinarity can be incorporated into the didactic sequence for in-class teaching, as well as for remote teaching, without the loss of dynamics and efficiency in the teaching and learning process. The didactic sequence and the remote learning activity were based on the main concepts of the psychological theories of Ausubel, Moreira and Vygotsky as well as the educational theories of Moreira and Lipman proposed for the construction of critical meaningful learning. To organize and evaluate the learning process, Novak's conceptual map was selected and applied. The obtained results show a sufficient level of learning of the studied concepts of photosynthesis and also the students' adaptation to the teaching and learning method from the perspective of interdisciplinarity, as well as positive adherence to the conceptual map tool. With these results, it is expected that the approach presented in this research will be useful for other professionals of education, allowing for its application in different disciplinary areas and distinct spaces of formal education.

Objetivou-se relatar as atividades desenvolvidas por um Centro Acadêmico de Fisioterapia no período de 2016 a 2018 enquanto discente gestor e relacioná-las com a formação em Fisioterapia na perspectiva das competências e habilidades gerais e específicas das Diretrizes Curriculares Nacionais dos Cursos de Graduação em Fisioterapia. Trata-se de um estudo descritivo, do tipo relato de experiência, estruturado nas seguintes seções: apresentação do contexto do Centro Acadêmico; diálogos com o controle social e com a extensão universitária e a formação em Fisioterapia. Relatou-se sobre a participação do Centro Acadêmico enquanto controle social formal no contexto universitário e em ações de movimentos sociais externos, além disso, descreveu-se sobre as ações extensionistas protagonizadas pelo Centro e aquelas nas quais participou como ouvinte, na comissão organizadora ou na mediação de debates. A participação no Centro Acadêmico de Fisioterapia enquanto discente gestor favoreceu o desenvolvimento de todas as competências e habilidades gerais previstas nas Diretrizes Curriculares Nacionais, assim como quase que a totalidade das competências e habilidades específicas.

O objetivo do estudo foi avaliar a integralidade do cuidado segundo a percepção do idoso usuário da Atenção Primária à Saúde e sua associação com o uso dos serviços de saúde. Foi desenvolvido estudo transversal no município de Alfenas – Minas Gerais. A integralidade foi avaliada pelo questionário PCATool. As análises bruta e ajustada foram realizadas por regressão de Poisson. A amostra contemplou 166 idosos. A análise das medianas do número de respostas evidenciou elevado número de avaliações positivas; 57% da amostra relatou receber orientações sobre mudanças que ocorrem com o envelhecimento, mas apenas 13% relatou receber “orientações sobre incapacidade”. As medianas também apresentaram comportamento semelhante em todos os serviços. Conclui-se que idosos que usam mais os serviços não o percebem como mais integral, embora tenha sido evidenciada uma percepção positiva da oferta de ações pelos serviços avaliados.

In this letter-to-the-editor the Task Force on Gender and Diversity issues in Neurology founded under the auspices of the European Academy of Neurology (EAN) addresses various gender issues that are arising during the COVID-19 pandemic. These issues concern different aspects, spanning from gender disparities in health care workforce to gender differences amongst patients suffering from COVID-19, risk factors, occurrence of neurological complications and (outcomes of) management. Due to the continuous flow of COVID-19 related papers this review cannot be comprehensive. We attempted to select the most relevant literature on this topic.

Background and ObjectivesTo investigate the prevalence of burnout profiles and their contributing factors in European neurology residents, junior neurologists, and research fellows.MethodsThe members of the Resident and Research Fellow Section (RRFS) of the European Academy of Neurology were surveyed using standardized instruments for burnout, job satisfaction, social support, depression, work-related fatigue, work-life integration, and impact of life events, from September 1, 2020, to January 6, 2021.ResultsThe response rate was 23.1% (332 responders of 1,439 contacted RRFS members); the median age of participants 30 years, with 61.5% being female. Our analysis revealed that 73.9% of the responders showed a perturbation in the Maslach Burnout Inventory dimensions, thus fulfilling the criteria for a dysfunctional phenotype within the burnout spectrum: burnout (22.6%), overextended (26.1%), ineffective (21.0%), and disengaged (4.1%). Multivariate logistic regression analysis indicated that elevated number of night shifts per month, work-related fatigue, and low professional satisfaction are independent risk factors for burnout. Being a certified neurologist, working in an academic environment, and a higher job satisfaction are associated with the engaged profile, a productive state characterized by high energy, strong involvement, and a sense of efficacy.DiscussionBurnout experience is highly prevalent among neurology residents, junior neurologists, and research fellows in Europe. The profile-based approach in this survey captures the multifaceted nature of burnout experience, therefore highlighting mitigating strategies that can be tailored to the distinct dysfunctional burnout profile.

The 45S rDNA is considered the most useful chromosomal marker for cytogenetic analysis of Passiflora. Amplification of 45S rDNA sequence via PCR are more advantageous than sequence maintenance in vectors for chromosomal hybridization via FISH. We aimed both to identify 45S rDNA by sequencing data for chromosomal localization and to verify the relationship between GC content and CMALow-coverage sequencing of Passiflora alata, P. cincinnata, and P. edulis was performed, and 45S rDNA units were identified using RepeatExplorer. The 45S rDNA units were used to construct a neighbor-joining tree to verify the similarities between the three species' 18S and 26S rDNA sequences. Clusters (CL)116 (P. alata), CL71 (P. cincinnata), and CL116 (P. edulis) were remarkably similar among the three species, and the 26S rDNA sequences of the clusters were similar to those of Populus tremuloides, Salix interior, and Averrhoa carambola (98% identity). The 26S rDNA was cytologically localized in the chromosomes of P. edulis, P. bahiensis, and the backcrossed hybrid (P. sublanceolata vs. HD13). The hybridization transfer capacity was evaluated in Citrus sunki and Cucumis melo. Finally, a chromosomal pair with a heteromorphic 26S rDNA site was observed in P. edulis, which was the same to that observed for CMAThe amplification of the 26S rDNA in Passiflora via PCR and the chromosomal localization in Passiflora and other plant species was successfully achieved. The CMA

Ticks are significant parasites of dogs in the tropics, where tick-borne pathogens are highly prevalent, especially in areas where tick control measures are frequently neglected. This study investigated the seroprevalence and hematological abnormalities associated with Ehrlichia canis in dogs referred to a veterinary teaching hospital in Central-western Brazil. Out of 264 dogs tested for anti-Ehrlichia canis antibodies by an indirect immunofluorescence assay (IFA), 59.1% (156/264) were positive. Seropositivity was significantly associated to anemia and thrombocytopenia, alone or in combination, and to leukopenia. Conversely, there were no differences in terms of seroprevalence according to sex, breed and age. This study demonstrated that dogs referred to a veterinary teaching hospital in Central-western Brazil are highly exposed to E. canis and that seropositive dogs are more likely to present hematological abnormalities, particularly anemia, thrombocytopenia and leukopenia. To our knowledge, this is the first study on detection of anti-E. canis antibodies by means of IFA among dogs in the state of Goiás. These findings highlighted the need for increasing awareness among dog owners regarding tick control measures in Central-western Brazil, ultimately to reduce the risk of exposure to E. canis and other tick-borne pathogens. RESUMO: Carrapatos são importantes parasitos de cães nos trópicos, onde patógenos transmitidos por carrapatos são altamente prevalentes, especialmente em áreas onde as medidas de controle de carrapatos são frequentemente negligenciadas. O estudo investigou a soroprevalência e as anormalidades hematológicas associadas à Ehrlichia canis em cães encaminhados para um hospital veterinário-escola no Centro-oeste do Brasil. Dos 264 cães testados para anticorpos anti-Ehrlichia canis por meio da reação de imunofluorescência indireta (RIFI), 59.1% (156/264) foram positivos. A soropositividade foi associada significativamente à anemia e trombocitopenia, isoladamente ou em combinação, e à leucopenia. Por outro lado, não houve diferenças quanto à soroprevalência segundo sexo, raça e idade. Este estudo demonstrou que cães encaminhados a um hospital veterinário-escola na região Centro-oeste do Brasil são altamente expostos à E. canis, e que cães soropositivos têm maior probabilidade de apresentar alterações hematológicas, principalmente anemia, trombocitopenia e leucopenia. Para o nosso conhecimento, este é o primeiro estudo sobre a detecção de anticorpos anti-E. canis por meio da RIFI em cães do estado de Goiás. Essas descobertas destacam a necessidade de aumentar a conscientização entre os proprietários de cães em relação às medidas de controle do carrapato no Centro-oeste do Brasil, em última análise, para reduzir o risco de exposição ao E. canis e outros patógenos transmitidos por carrapatos.

Tese (doutorado)—Universidade de Brasília, Faculdade de Administração, Contabilidade, Economia e Gestão de Políticas Públicas, Departamento de Economia, Brasília, 2021. Essa tese é composta por dois ensaios. O Ensaio 1 analisa o impacto do Programa Portal Único de Comércio Exterior sobre o desempenho de empresas exportadoras. O programa utiliza a abordagem de single window, preconizada pela Organização Mundial do Comércio (OMC) como uma das principais medidas de desburocratização do processo de exportação a serem adotadas pelos países. O artigo explora uma nova base de microdados administrativos de 2017 a 2019 composta por mais de 20.000 empresas exportadoras. Explora-se a implementação escalonada da política em 2018 como estratégia de identificação para a criação de grupos de controle para as empresas submetidas ao tratamento, qual seja, exportar por meio do Portal Único. Por meio de um desenho de event study com variação no momento de tratamento entre as unidades, encontra-se que o programa teve impacto de 20,7% no volume das exportações, contribuindo para o aumento da competitividade das empresas brasileiras no mercado internacional. O Ensaio 2 investiga o efeito de política de incentivo as exportações sobre o desempenho exportador de empresas industriais brasileiras de 2017 a 2019. O programa, intitulado de drawback, suspende os tributos incidentes sobre insumos utilizados na produção de bens a serem exportados, com o objetivo de aumentar a competividade das exportações. A partir de base de dados administrativa que possibilita identificar operações amparadas pelo mecanismo, estimam-se os efeitos do programa ao nível da empresa por meio de modelo de diferenças em diferenças robusto a heterogeneidade dos efeitos de tratamento. Os resultados mostram que em 2018 o instrumento de drawback aumentou o volume exportado em 47,6% e de 8,2% e 10,4% sobre o número de produtos exportados e países de destino, respectivamente. O uso contínuo do drawback manteve seus efeitos positivos para períodos mais longos, indicando ganhos de longo prazo na utilização do mecanismo. This thesis is composed by two essays. The first essay analyzes the impact of the Portal Único program on the performance of exporting companies. Adopted by companies since 2018, the program uses single window approach, recommended by the World Trade Organization (WTO) as one of the main measures that countries can pursue to reduce trade costs in the export process. This article explores a new administrative dataset from 2017 to 2019 composed of over 20,000 exporting companies. The staggered adoption of the policy in 2018 is explored as the identification strategy for the creation of control groups for companies undergoing treatment, that is, exporting using Portal Único. This article constructs an event study design with variation in the timing of treatment. The program had an impact of 20.7% on the volume of exports, contributing to improve export competitiveness of Brazilian companies at the global market. The second essay investigates the impact of a promotion policy on the export performance of Brazilian industrial companies from 2017 to 2019. The policy in question, known as duty drawback scheme, suspends taxes on inputs used in the production of exported goods, which aims to increase the competitiveness of exports. Using an administrative database that makes it possible to identify operations supported by the duty drawback program, the effects of the program at firm level are estimated through a difference-in-differences model, robust to the heterogeneity of treatment effects. The drawback scheme increased exports by 47.6% in 2018. It also increased the number of exported products and destinations countries by 8.2% and 10.4%, respectively. The continuous use of drawback maintained its positive effects for longer periods, indicating long-term gains in the use of the mechanism.

BACKGROUND: Leadless pacemakers have been designed as an alternative to transvenous systems which avoid some of the complications associated with transvenous devices. We aim to perform a systematic review of the literature to report the safety and efficacy findings of leadless pacemakers. METHODS: We searched MEDLINE and EMBASE to identify studies reporting the safety, efficacy and outcomes of patients implanted with a leadless pacemaker. The pooled rate of adverse events was determined and random-effects meta-analysis was performed to compare rates of adverse outcomes for leadless compared to transvenous pacemakers. RESULTS: A total of 18 studies were included with 2496 patients implanted with a leadless pacemaker and success rates range between 95.5-100%. The device or procedure related death rate was 0.3% while any complication and pericardial tamponade occurred in 3.1% and 1.4% of patients, respectively. Other complications such as pericardial effusion, device dislodgement, device revision, device malfunction, access site complications and infection occurred in less than 1% of patients. Meta-analysis of four studies suggests that there was no difference in hematoma (RR 0.67 95%CI 0.21-2.18, 3 studies), pericardial effusion (RR 0.59 95%CI 0.15-2.25, 3 studies), device dislocation (RR 0.33 95%CI 0.06-1.74, 3 studies), any complication (RR 0.44 95%CI 0.17-1.09, 4 studies) and death (RR 0.45 95%CI 0.15-1.35, 2 studies) comparing patients who received leadless and transvenous pacemakers. CONCLUSION: Leadless pacemakers are safe and effective for patients who have an indication for single chamber ventricular pacing and the findings appear to be comparable to transvenous pacemakers.

O tremor é o movimento involuntário mais frequente. O diagnóstico diferencial é vasto e por vezes representa um desafio até para neurologistas experientes. No entanto, muitos tremores têm etiologia e curso clinico relativamente benigno e, em muitos casos, os médicos não neurologistas têm possibilidade de fazer a gestão clínica destas situações. Este artigo faz uma abordagem sucinta sobre os diferentes tipos de tremor, o diagnóstico, os principais diagnósticos diferenciais, e as opções terapêuticas das entidades patológicas mais importantes na prática clínica.

It is not uncommon to link evasion to failure. In order to investigate this point of view, we have built a theoretical framework that, based on the sociology of education, allows us to understand the quest for excellence in undergraduate courses. We performed a statistical analysis of data collected from the Physics course at UniX and supplemented it with student testimonials. The analysis showed that socially vulnerable students are generally less successful in the course; however, among those who intend to leave, we find students with various degrees of success. When interviewed, students point out that faillure on disciplines contribute to the lack of social integration of peers and that the need to anticipate future content undermines their basic education. Finally, even though dropout has no statistically significant relationship to success in the course, quest for excellence structures students' experiences in a variety of ways that need to be understood with a critical eye. No es raro vincular la evasión al fracaso. Para investigar este punto de vista, construimos un referencial teórico que, basado en lecturas de sociología de la educación, nos permite comprender la búsqueda por excelencia en los cursos de graduación. Realizamos un análisis estadístico de datos recolectados del curso de Física de la UniversidadX y la complementamos con testimonios de los estudiantes. El análisis mostró que los estudiantes socialmente vulnerables son generalmente menos acertados en el curso; sin embargo, entre los que pretenden evadir, encontramos alumnos con diversos grados de éxito. Al ser entrevistados, los estudiantes apuntan que las reprobaciones contribuyen a la falta de integración social de los colegas y que la necesidad de anticipar contenidos futuros perjudica su formación básica. En fin, aunque la evasión no guarde relación estadísticamente significativa con el éxito en el curso, la búsqueda por excelencia estructura las experiencias de los estudiantes de diversas maneras que necesitan ser comprendidas con una mirada crítica y atenta. Em que medida a evasão e as experiências discentes nos cursos de graduação em Física estão relacionadas à pressão por excelência acadêmica? Baseados em leituras da sociologia da educação, realizamos uma análise de dados coletados no curso de Física de uma universidade brasileira. As evidências indicam que estudantes de famílias privilegiadas tendem a abandonar o curso, mas os que permanecem costumam ser bem-sucedidos. Ao mesmo tempo, a evasão não se relaciona com o desempenho acadêmico: há estudantes excelentes que desejam sair, bem como estudantes de baixo desempenho que desejam permanecer. A austeridade da organização curricular contribui para que os estudantes tenham lacunas em sua formação. Com algumas exceções, os professores são descritos como figuras opressoras, exigentes e sem empatia. Por outro lado, relações competitivas são percebidas entre os próprios estudantes. Enfim, ainda que a evasão não tenha relação com o desempenho acadêmico, a busca por excelência estrutura as experiências dos estudantes no curso. To what extent are dropout and students’ experiences in undergraduate Physics courses related to pressure for academic excellence? Drawing on sociology of education, we performed an analysis of data collected from the Physics course at a Brazilian public university. Evidence indicates that students from privileged families tend to drop out, but those who remain tend to be successful. At the same time, dropout is not related to academic performance: there are excellent students who want to leave, as well as underperforming students who want to stay. Curricular austerity contributes to students having gaps in their education. With few exceptions, teachers are described as oppressive, demanding, and merciless figures. On the other hand, competitive relationships are perceived among the students themselves. Finally, even though dropout is not related to academic performance, the urge for excellence structures students’ experiences in the course.

Background Androgen deprivation therapy (ADT) combined with apalutamide, abiraterone acetate plus prednisone, enzalutamide, or docetaxel are the standard treatments for advanced castration-sensitive prostate cancer (CSPC). We investigated ADT-free alternatives for advanced CSPC. Patients and methods LACOG 0415 is a phase 2, open-label, non-comparative, randomized trial. Patients with advanced CSPC were randomized (1:1:1) to receive goserelin plus abiraterone acetate and prednisone (ADT plus AAP arm), apalutamide (APA arm), or apalutamide plus abiraterone acetate and prednisone (APA plus AAP arm). The primary endpoint was the proportion of patients with PSA of ≤0.2 ng/mL at week 25 in the modified intention-to-treat population. Safety analyses were performed in all patients with at least one dose of the study drug. Results Of 128 randomized patients, 120 patients were evaluable for PSA response at week 25; 17.2% had a high-risk biochemical recurrence, 8.6% had locally advanced disease, and 74.2% had distant metastases. At week 25, PSA of ≤0.2 ng/mL was observed in 75.6% (95%CI 59.7%–87.6%), 60.0% (95%CI 43.3%–75.1%), and 79.5% (95%CI 63.5%–90.7%) of patients in ADT plus AAP, APA, and APA plus AAP arms, respectively. PSA decline of ≥80% was observed in 100%, 90.0%, and 97.4%, respectively. Grade 3–4 AEs were observed in 31.0%, 21.4% and 36.4%, respectively. Testosterone levels increased significantly in the APA arm and decreased significantly in ADT plus AAP and APA plus AAP arms. Conclusions ADT-free alternatives provide a high PSA response in advanced CSPC, although the APA arm did not reach the expected rate of PSA of ≤0.2 ng/mL at week 25. These results warrant further investigation of ADT-free treatments as alternatives in advanced CSPC. Source study registration ClinicalTrials.gov NCT02867020 .

Background: Movement disorders affecting the trunk remain a diagnostic challenge even for experienced clinicians. However, despite being common and debilitating, truncal movement disorders are rarely discussed and poorly reviewed in the medical literature. // Objectives: To review common movement disorders affecting the trunk and provide an approach for clinicians based on the truncal region involved (shoulder, chest, diaphragm, abdomen, pelvis, and axial disorders). For each disorder, clinical presentation, aetiologic differential diagnosis, and ‘clinical clues’ are discussed. // Conclusion: This review provides a clinically-focused, practical approach to truncal movement disorders, which will be helpful for physicians in everyday practice.

We read with great interest the recent guidelines by Mancuso et al. concerning the diagnosis and treatment of monogenic small-vessel disease(1). These guidelines arise at a time of rapidly growing knowledge concerning the genetic causes of small vessel disease, which has caused a huge impact on the approach of this disorders by neurologists in everyday practice.

INTRODUCAO: Recentemente, pesquisas sobre os Inibidores do Cotransportador de Sodio-Glicose 2, antes utilizados apenas no tratamento de Diabetes Mellitus do tipo 2, evidenciaram resultados positivos para o tratamento da Insuficiencia Cardiaca. METODOLOGIA: Trata-se de uma revisao de literatura, com busca de estudos nas bases de dados PUBMED, UPTODATE, SCIENCE DIRECT E MEDLINE. Os descritores usados foram “heart failure”, “heart failure redution ejection fraction”, “sodium-glucose transporter 2 inhibitors”, “sodium-glucose linked co-transporter 2 inhibitor”, “dapagliflozin”. Foram incluidos artigos cientificos completos, em ingles, publicados entre 2016 e 2020. RESULTADOS: Os artigos analisados concordam que existem beneficios no uso dos inibidores de SGLT2 no tratamento da IC. DISCUSSAO: A descoberta dos beneficios terapeuticos de alguns hipoglicemiantes em pacientes co-portadores de DM2 e IC iniciou a investigacao sobre a ampliacao do uso desses medicamentos em pacientes nao diabeticos com IC. Os inibidores de SGLT2 se mostraram a classe de hipoglicemiantes mais eficaz e segura para esse fim. CONCLUSAO: A prevalencia de IC vem aumentando mundialmente, devido a transicao demografica. Embora a IC seja uma condicao distinta, quando comparada a DM2, a mesma demonstrou sofrer impactos relevantes com relacao aos farmacos que visam diminuir a glicose. Mais estudos devem ser realizados sobre a tematica.

Submitted by Aline de Fátima Frutuoso (aline.frutuoso@ifpb.edu.br) on 2021-06-23T13:24:07Z No. of bitstreams: 1 CONCEPÇÃO DE DOCENTES ACERCA DA INCLUSÃO DO ALUNO SURDO EM UMA ESCOLA REGULAR DE ENSINO NO MUNICÍPIO DE GUARABIRA-PB-Vanessa Carvalho da Silva Souza.pdf: 1724819 bytes, checksum: ce4ec22a21f0f1cdc056ef38d737cda6 (MD5) Approved for entry into archive by Thiago Oliveira (thiago.oliveira@ifpb.edu.br) on 2021-06-28T18:20:28Z (GMT) No. of bitstreams: 1 CONCEPÇÃO DE DOCENTES ACERCA DA INCLUSÃO DO ALUNO SURDO EM UMA ESCOLA REGULAR DE ENSINO NO MUNICÍPIO DE GUARABIRA-PB-Vanessa Carvalho da Silva Souza.pdf: 1724819 bytes, checksum: ce4ec22a21f0f1cdc056ef38d737cda6 (MD5) Made available in DSpace on 2021-06-28T18:20:28Z (GMT). No. of bitstreams: 1 CONCEPÇÃO DE DOCENTES ACERCA DA INCLUSÃO DO ALUNO SURDO EM UMA ESCOLA REGULAR DE ENSINO NO MUNICÍPIO DE GUARABIRA-PB-Vanessa Carvalho da Silva Souza.pdf: 1724819 bytes, checksum: ce4ec22a21f0f1cdc056ef38d737cda6 (MD5) Previous issue date: 2021-02-19 A pesquisa tem por objetivo investigar quais as concepções dos docentes acerca da inclusão de alunos surdos em uma escola regular no município de Guarabira/PB. A fundamentação teórica teve como base as principais legislações brasileiras que tratam sobre a educação especial como um todo, e especialmente a educação de pessoas surdas (BRASIL, 1988; 2005; 2009; 2015). Trata-se de uma pesquisa qualitativa do tipo exploratória que contou com a participação de duas docentes que têm experiência com alunos surdos no sistema regular de ensino: uma professora de LIBRAS que atua junto à equipe de Atendimento Educacional Especializado, ministrando curso de LIBRAS, quando este é ofertado na grade curricular da escola; e, uma professora docente que atua em sala de aula comum, mas que também exerce a função de intérprete, em um outro horário. As docentes responderam um questionário composto por 10 questões acerca da inclusão escolar de alunos surdos no ensino regular. Dentre os principais resultados, destacam-se os obstáculos que ainda perduram a inclusão de pessoas surdas no sistema regular de ensino, que são ocasionados quase que exclusivamente pela falta de domínio da LIBRAS pelos profissionais que compõem a escola. Há uma centralização na figura do profissional intérprete, que acaba por se responsabilizar por toda interação social deste aluno surdo, com os professores e com os demais alunos. Ao final do estudo, conclui-se, a necessidade de uma maior compreensão da cultura surda, bem como a concretização de uma proposta de ensino bilíngue, para que assim haja possibilidade de efetivar, de forma mais precisa, aquilo que está disposto em Lei, e que implica a inclusão social de surdos no âmbito escolar.

Transthyretin-related familial amyloid polyneuropathy (ATTR-FAP) is a multisystemic disorder inherited as an autosomal dominant trait. Transitory events in ATTR-FAP patients are a feature of this disorder and remain poorly depicted in the literature. We aimed to describe a case series of ATTR-FAP patients who presented to our department with transitory events and document the clinical, neuroimaging and neurophysiological characteristics of the events. We collected data from eight patients carrying the Val30Met ATTR-FAP variant. We registered a total of 23 events. Of the eight patients, seven had been submitted to hepatic transplant. The events were either TIA-like or seizures, often followed by prolonged language, motor or sensory impairment. In 9 (39%) of the events, the patients presented with fever, but an infection was only found in 5 (21%). Cerebrospinal fluid analysis was performed in 5 patients. EEG was abnormal in at least 1 event in 7 of the 8 patients. Brain MRI was performed in 3 patients during the acute stage and showed no acute lesions. Although the etiology of these events remains unclear, brain MRI performed in the acute phase of acute TIA-like events and the EEG abnormalities, argues in favor of regional brain dysfunction due to amyloid deposition. Focal neurological episodes should be considered in long-term duration Val30Met ATTR-FAP patients, who present with acute neurological deficits or seizures.

Microsporidia are naturally occurring fungal-related parasites that can infect nearly all animal hosts, but their biocontrol potential of insect pests is routinely overlooked in agriculture and forestry. This research brings the first report describing the natural occurrence of a microsporidium causing disease in field-collected populations of the invasive eucalyptus snout beetle, Gonipterus platensis (Coleoptera: Curculionidae), a major destructive pest of eucalyptus plantations in Brazil. Adult beetles were collected during field surveys in commercial eucalyptus plantations in southern Brazil to be examined and dissected with typical symptoms to verify presence of microsporidian spores in haemolymph. From 14 plantations in different sites, the natural infection occurrence in these populations ranged from 0 to 65%, while a lab colony exhibited an infection incidence of 70%. Spore density in haemolymph of symptomatic insects averaged 2.1(±0.4) × 107 spores/mL. Symptoms in infected adults were identified by abnormal abdomen with malformation of the second pair of wings, impairing their flight activity. Electron transmission microscopy of the pathogen showed morphological features similar to species belonging to the genus Nosema or Vairimorpha. Phylogenetic analysis of the full-length small subunit ribosomal RNA gene suggests this pathogen’s placement in the genus Vairimorpha, but with a sequence identity of ~94% with the nearest neighbours. The low level of sequence identity suggests this pathogen may represent a novel taxon in the genus and further requires whole genome sequencing for definitive taxonomic resolution. These findings provide insights on the natural occurrence of this novel pathogen for potential use in biocontrol of this invasive pest in Eucalyptus plantations in Brazil, and prompts the design of conservative or augmentative strategies for the establishment of this microsporidium in field populations for sustainable management of eucalyptus snout beetles.

© 2021 European Academy of Neurology., Clinical guidelines are “statements that include recommendations, intended to optimize patient care, that are informed by a systematic review of evidence and an assessment of the benefits and harms of alternative care options”. Clinical guidelines are increasingly becoming a part of neurology clinical practice, most probably because they may improve patient clinical outcomes. Methods and strategies intended to increase guideline availability include electronic and computable guidelines integrated into process-oriented information systems with clinical decision support tools. The increased availability and the possibility of continuous update (living guidelines) will likely contribute to promoting compliance with guideline recommendations and to the overarching success of guidelines in improving the quality of care in the near future.

AAA+ proteases are degradation machines that use ATP hydrolysis to unfold protein substrates and translocate them through a central pore toward a degradation chamber. FtsH, a bacterial membrane-anchored AAA+ protease, plays a vital role in membrane protein quality control. How substrates reach the FtsH central pore is an open key question that is not resolved by the available atomic structures of cytoplasmic and periplasmic domains. In this work, we used both negative stain TEM and cryo-EM to determine 3D maps of the full-length Aquifex aeolicus FtsH protease. Unexpectedly, we observed that detergent solubilization induces the formation of fully active FtsH dodecamers, which consist of two FtsH hexamers in a single detergent micelle. The striking tilted conformation of the cytosolic domain in the FtsH dodecamer visualized by negative stain TEM suggests a lateral substrate entrance between the membrane and cytosolic domain. Such a substrate path was then resolved in the cryo-EM structure of the FtsH hexamer. By mapping the available structural information and structure predictions for the transmembrane helices to the amino acid sequence we identified a linker of ~20 residues between the second transmembrane helix and the cytosolic domain. This unique polypeptide appears to be highly flexible and turned out to be essential for proper functioning of FtsH as its deletion fully eliminated the proteolytic activity of FtsH.

Background and purpose The COVID-19 (SARS-CoV-2) outbreak has disrupted residency programmes due to university and hospitals' priorities to face this emergency at all cost. Most research projects and clinical trials were temporarily stopped or postponed. The Resident and Research Fellow Section (RRFS) of the European Academy of Neurology (EAN) has decided to assess the impact of the COVID-19 pandemic on neurology training. Methods All EAN RRFS members were invited to fill out an online questionnaire of 40 items concerning their clinical involvement during the COVID-19 emergency, and the impact of the pandemic on their training (Appendix S1). Results Of the 227 RRFS members who completed the questionnaire, 222 were from Europe, and of those 111 were from Portugal, Italy or France. Responders highlighted that severe restrictions have been imposed to face this pandemic, including reduction of inpatient beds, prohibition of in-person visits and limitation to hospital access for patients' relatives. This was accompanied by an increase in email correspondence and phone calls with 50% of countries allowing telemedicine to reach outpatients. Seventy-nine per cent of the respondents felt that the pandemic will probably have a serious impact on their training and career. Conclusion The pandemic led to a disruption of neurology activities, including medical training and research. The long-run impact of these changes remains unknown, but it will probably change the way neurology practice and training will be organized for future generations.

A celeridade dos ritmos das transformações são marcos das sociedades contemporâneas. As sucessivas análises sobre a mudança/ metamorfose social anuíram no reconhecimento do papel do conhecimento, das qualificações e das competências enquanto recursos relevantes para a ação (Bell, 1999; Beck, 2016). Analisando a sua distribuição concluiu-se que se trata de recursos com impactos significativos na estrutura das sociedades atuais, cujos efeitos se repercutem na multiplicidade das suas dimensões: da vida social e política, às estruturas económicas (Ávila, 2008). Esta centralidade do conhecimento e da escolaridade nas sociedades atuais tem contribuído para a emergência de uma sociedade aprendente (Jarvis, 2004), na qual os sujeitos têm sido chamados a adaptarem-se permanentemente (Enguita, 2007). A investigação neste domínio tem permitido conhecer a(s) nova(s) relação(s) que estas sociedades, e os indivíduos, têm estabelecido com o conhecimento e com a aprendizagem ao longo da vida (ALV), chamando a atenção para as desigualdades sociais que nela emergem (Ávila, 2008; Costa, 2012). Os efeitos para os segmentos da população que ficam de fora das dinâmicas da ALV, em múltiplas vertentes, têm sido amplamente reportados em estudos nacionais e internacionais, sublinhando-se os riscos de exclusão social, desemprego, pobreza, vulnerabilidade na saúde, menor participação cívica, etc. Mas, como alerta Field (2006), pouco se sabe, do ponto de vista sociológico, sobre a população que tem sido deixada para trás, num quadro de generalização da ALV. Este artigo tem como objetivo apresentar os primeiros resultados de uma pesquisa de terreno, em que já se recolheram cerca de duas dezenas de relatos de vida. Incidindo sobre as trajetórias, as redes de sociabilidade e as representações sobre a escola, dos adultos pouco escolarizados que não retomaram a educação formal, espera-se conseguir avançar na identificação do(s) património(s) disposicional(s) destes adultos que têm ficado à margem da sociedade educativa em Portugal. info:eu-repo/semantics/publishedVersion

A pesquisa debruça-se em investigar a educação como um serviço essencial para seus estudantes, capaz de lhes tornar cidadãos com identidade, conhecedores de se, fazer parte de um espaço e eliminar barreiras que lhes impeçam de ser construtores do seu desenvolvimento pessoal e social na sociedade, em especifico no âmbito educacional, de modo que ela seja para todos, com metodologias, instrumentos, profissionais e a Língua Brasileira de Sinais - Libras na promoção da inclusão, equidade e qualidade do ensino a alunos surdos na rede regular do municipal de Tutóia – MA. O artigo mostra a realidade ou utopia do intérprete da língua de sinais na escola com surdos. O trabalho desenvolveu-se com uma investigação exploratória descritiva a partir de relatos de experiências em três escolas municipais no ano de 2021, com abordagem qualitativa. Para certificar o estudo, utilizaram-se as plataformas do Google Scholar, Scielo e literaturas em geral. Deste modo, a revisão literária e observações nas escolas, constataram a ausência do intérprete de Libras. Os professores atuantes sabem da existência da língua sinalizada, mas não possuem conhecimentos práticos que favoreçam o processo de ensino nos dois idiomas assegurados no Brasil: a Libras e o Português. Além, do professor responsável pela turma, a rede de ensino precisa ofertar, a esses profissionais, formação inicial e continuada sobre o ensino para surdos e sua língua, capazes de proporcionar condições estruturais e pedagógicas às particularidades de aprender do aluno surdo, sem lhe tirar o direito de ser cidadão.

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel's Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianopolis region (16°56'60.0"S 48°29'16.0"W), Goias state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at Sao Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel's Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel's Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

Neurological disorders are the third most common cause of disability and premature death in Europe and their prevalence and burden will likely increase with the progressive ageing of the European population (1). Almost one in three people worldwide has a neurological disorder at some point in their lifetime (2) with the most common neurological causes of disability being stroke, migraine, and Alzheimer's disease and other dementias (2).

Objective: to learn about the social representation of nursing students about the sexuality of elders with dementia.Methods: qualitative study, based on the Theory of Social Representations, developed with 20 Nursing Graduation students from a Brazilian higher education institution. Data was collected through a focal group, processed in the software IRAMUTEQ and analyzed using a Descending Hierarchical Classification. Results: four semantic classes emerged: Sexuality as a right, The theme was insufficient in graduation, Meanings attributed to sexuality, and Care from the perspective of students. Conclusion: the study showed that the nursing students investigated had polysemic representations about the sexuality of elders with dementia, among which discriminatory and stigmatizing conceptions stood out, socially constructed and anchored in common sense. Objetivo: apreender as representações sociais de estudan-tes de enfermagem acerca da sexualidade de idosos com demência. Métodos: estudo qualitativo, fundamentado na Teoria das Representações Sociais, desenvolvido com 20 es-tudantes de Graduação em Enfermagem de uma instituição de ensino superior brasileira. Os dados foram coletados por meio de grupo focal, processados no software IRAMUTEQ e analisados por Classificação Hierárquica Descendente. Re-sultados: emergiram quatros classes semânticas: A sexuali-dade como um direito, Temática insuficiente na graduação, Significados atribuídos à sexualidade e O cuidado na pers-pectiva de estudantes. Conclusão: o estudo demonstrou que os estudantes de enfermagem investigados possuíam representações polissêmicas sobre a sexualidade de idosos demenciados, em que se destacaram concepções discrimi-natórias e estigmatizantes, ancoradas no senso comum e construídas socialmente.

Submitted by Ana Moreira (anadsmoreira@ufp.pt) on 2021-01-26T12:20:58Z No. of bitstreams: 1 PPG_33700.pdf: 253911 bytes, checksum: 3b6c2f49d063b03acd300159e1c484cf (MD5) Approved for entry into archive by azevedo@ufp.pt (azevedo@ufp.pt) on 2021-01-26T12:52:48Z (GMT) No. of bitstreams: 1 PPG_33700.pdf: 253911 bytes, checksum: 3b6c2f49d063b03acd300159e1c484cf (MD5) Made available in DSpace on 2021-01-26T12:52:48Z (GMT). No. of bitstreams: 1 PPG_33700.pdf: 253911 bytes, checksum: 3b6c2f49d063b03acd300159e1c484cf (MD5) Previous issue date: 2020-06-18

Made available in DSpace on 2021-06-25T10:17:19Z (GMT). No. of bitstreams: 0 Previous issue date: 2020-06-01 Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Urban afforestation is a practice used in urban centers. Of the plant species used, Brunfelsia pilosa and B. uniflora are used in most cities. The main pest for B. pilosa and B. uniflora is the lepidopteran Methona themisto which can feed on the leaves of the plant and cause its death. As a solution, biological control with parasitoid insects can be an alternative to chemical means. The present study aimed to investigate if M. themisto can be parasitized by Tichospilus diatraeae. Six pupae of M. themisto were offered to T. diatraeae and exposed to parasitism for 72 hours. The observed parasitism was 66% with 90% of the emergence of adult parasitoids. The parasitoid egg-to-adult life cycle was 18 ± 1 days and an average of 510 ± 91.21 insects emerged per pupa. Each parasitoid consumed an average of 1.13 ± 0.16 mg of pupal content to compete its cycle. The results record for the first time in the literature that M. themisto may be a host of T. diatraeae and consequently applied in biological control programs of this pest. São Paulo State University (UNESP) Faculty of Agronomic Sciences (FCA) Fazenda Experimental Lageado São Paulo State University (UNESP) Faculty of Agronomic Sciences (FCA) Fazenda Experimental Lageado CAPES: 001