321 results on '"Svanella, A."'
Search Results
102. DETECTION OF QTLS CONTROLLING PEACH FRUIT ACIDITY AND SWEETNESS
- Author
-
A. Guye, Elisabeth Dirlewanger, R. Monet, Laurence Svanella, V. Pronier, Annick Moing, Christophe Rothan, Unité de recherches Espèces Fruitières et Vigne (UREFV), Institut National de la Recherche Agronomique (INRA), and Station de Physiologie végétale
- Subjects
0106 biological sciences ,Horticulture ,[SDV]Life Sciences [q-bio] ,0103 physical sciences ,Biology ,Sweetness ,010303 astronomy & astrophysics ,01 natural sciences ,ComputingMilieux_MISCELLANEOUS ,010606 plant biology & botany - Abstract
International audience
- Published
- 1998
- Full Text
- View/download PDF
103. Biological properties and partila molecular characterization of an apricot strain of CGRMV
- Author
-
LIBERTI, DANIELE, RAGOZZINO, ANTONIO, MARAIS A., SVANELLA DUMAS L., CANDRESSE T., GENTIT P., Liberti, Daniele, Ragozzino, Antonio, Marais, A., SVANELLA DUMAS, L., Candresse, T., and Gentit, P.
- Published
- 2004
104. Partial genome sequence of an apricot isolate of Cherry Green Mottle Virus (CGRMV)
- Author
-
LIBERTI, DANIELE, RAGOZZINO, ANTONIO, MARAIS A, SVANELLA DUMAS L, CANDRESSE T., Liberti, Daniele, Marais, A, SVANELLA DUMAS, L, Ragozzino, Antonio, and Candresse, T.
- Published
- 2004
105. Variability in Sorbitol : Sucrose Ratio in Mature Leaves of Different Prunus Species
- Author
-
Nathalie Langlois, Annick Moing, Jean-Pierre Gaudillère, Laurence Svanella, and Anne Zanetto
- Subjects
chemistry.chemical_compound ,Prunus ,Sucrose ,chemistry ,Botany ,Genetics ,Sorbitol ,Horticulture ,Biology - Abstract
Sorbitol is a sugar alcohol, present with sucrose in Rosaceae trees, which seems to have a role in plant response to environmental stress. The aim of this study was to investigate variability in sorbitol : sucrose ratio in source leaves of 53 species or hybrids of Prunus. The studied taxa, representing three subgenera and 11 sections of the Prunus genus, were chosen from the Prunus collection at the Institut National de la Recherche Agronomique, Bordeaux, France. Young mature leaves were sampled on three dates in spring and summer and were analyzed for neutral soluble sugars using high-performance liquid chromatography. There were differences in sorbitol : sucrose ratio according to sampling date and according to taxon. Sorbitol content increased and sucrose content decreased from May to July, leading to an increase in sorbitol : sucrose ratio. For each date, there was a high variability within botanical sections for sorbitol : sucrose ratio. The highest variability between species for sorbitol : sucrose ratio was in July, with P. cocomilia having the lowest ratio (1.15, w/w) and P. fremontii having the highest ratio (5.59, w/w). When species were pooled according to their geographical zone of origin, species originating from Japan showed the lowest sorbitol : sucrose ratio for all sampling dates. In July, species originating from Japan, Europe, and central to western North America had sorbitol : sucrose ratio significantly lower than that of species originating from Europe to western Asia, China to eastern Asia, and central to eastern North America. These results indicate that variability in sorbitol : sucrose ratio exists in the Prunus germplasm and seems to be related to the geographical origin of the species. Moreover, variability in sorbitol to sucrose ratio is high in the germplasm of different Prunus taxa.
- Published
- 1997
- Full Text
- View/download PDF
106. Resistance mechanism against LMV in lettuce involving eIF4E, VPg and CI: beyond the tip of the iceberg
- Author
-
Sorel, Maud, Svanella-Dumas, Laurence, Roudet-Tavert, Genevieve, Bordat, Amandine, Acelin, G., Houvenaghel, Marie-Christine, Candresse, Thierry, German-Retana, Sylvie, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Université Sciences et Technologies - Bordeaux 1, and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2013
107. Contrasted patterns of phytoviral metagenomes in wild and agricultural environments
- Author
-
CANDRESSE, Thierry, MARAIS, Armelle, FAURE, Chantal, THEIL, Sébastien, SVANELLA-DUMAS, Laurence, CARRERE, Sebastien, BERGEY, Bernard, COUTURE, Carole, LAIZET, Yec'han, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Unité mixte de recherche interactions plantes-microorganismes, Institut National de la Recherche Agronomique (INRA)-Université Toulouse III - Paul Sabatier (UT3), and Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
International audience
- Published
- 2013
108. Update of the number and spread of alien plants in the French sub-Antarctic islands
- Author
-
Garnier, Alexia, Chapuis, Jean-Louis, Svanella-Dumas, L., Renault, D, Lebouvier, Marc, L'Institut polaire français Paul-Emile Victor (IPEV), Ministère de l'Education nationale, de l’Enseignement supérieur et de la Recherche (M.E.N.E.S.R.), Conservation des espèces, Restauration et Suivi des Populations (CERSP), Muséum national d'Histoire naturelle (MNHN)-Université Pierre et Marie Curie - Paris 6 (UPMC)-Centre National de la Recherche Scientifique (CNRS), Ecosystèmes, biodiversité, évolution [Rennes] (ECOBIO), Université de Rennes (UR)-Institut Ecologie et Environnement (INEE), Centre National de la Recherche Scientifique (CNRS)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Rennes (OSUR), Université de Rennes (UR)-Institut national des sciences de l'Univers (INSU - CNRS)-Université de Rennes 2 (UR2)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut national des sciences de l'Univers (INSU - CNRS)-Université de Rennes 2 (UR2)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Centre National de la Recherche Scientifique (CNRS), Centre d'Ecologie et des Sciences de la COnservation (CESCO), Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Rennes (OSUR)-Institut Ecologie et Environnement (INEE), Centre National de la Recherche Scientifique (CNRS)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES), and Briand, Valerie
- Subjects
[SDE.BE] Environmental Sciences/Biodiversity and Ecology ,[SDE.BE]Environmental Sciences/Biodiversity and Ecology ,ComputingMilieux_MISCELLANEOUS - Abstract
International audience
- Published
- 2013
109. Functional analysis of plant-potyvirus interactions
- Author
-
SOREL, Maud, SVANELLA-DUMAS, Laurence, ROUDET-TAVERT, Genevieve, ACELIN, G., HOUVENAGHEL, Marie-Christine, BORDAT, Amandine, CANDRESSE, Thierry, GERMAN-RETANA, Sylvie, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Université Sciences et Technologies - Bordeaux 1, and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
International audience
- Published
- 2013
110. Analysis of Amalgamaviridae diversity in the Kerguelen Islands ecosystem using two different strategies for metagenome analysis
- Author
-
Candresse, Thierry, Marais, Armelle, Faure, Chantal, Svanella-Dumas, Laurence, Carrere, Sebastien, Bergey, Bernard, Laizet, Yec'han, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Unité mixte de recherche interactions plantes-microorganismes, Institut National de la Recherche Agronomique (INRA)-Université Toulouse III - Paul Sabatier (UT3), and Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2013
111. Distribution and diversity of[i] Barley yellow dwarf virus[/i]-PAV in the sub-Antarctic Kerguelen Islands and characterization of two new[i] Luteovirus[/i] species
- Author
-
SVANELLA-DUMAS, Laurence, CANDRESSE, Thierry, HULLÉ, Maurice, MARAIS-COLOMBEL, Armelle, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1 (UB), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST, Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, AGROCAMPUS OUEST-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National de la Recherche Agronomique (INRA), Institut National de la Recherche Agronomique (INRA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), and ProdInra, Archive Ouverte
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] - Abstract
absent
- Published
- 2013
112. Keys mutations in the Cylindrical Inclusion of Lettuce mosaic virus (LMV) are involved in the breakdown of elF4E-mediated resistance
- Author
-
Sorel, Maud, Abdul Razzak, Anas, Svanella-Dumas, Laurence, Acelin, G., Houvenaghel, Marie-Christine, Candresse, Thierry, German-Retana, Sylvie, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Université Sciences et Technologies - Bordeaux 1, and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2013
113. Virus de la mosaïque de la laitue vs résistance 'eIF4E' de la laitue : un combat à deux contre un
- Author
-
Sorel, Maud, Svanella-Dumas, Laurence, Acelin, G., Houvenaghel, Marie-Christine, Candresse, Thierry, German-Retana, Sylvie, ProdInra, Migration, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, and Université Sciences et Technologies - Bordeaux 1
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2013
114. Partial sequence of a new Partitivirus-infecting Podosphaera tridactyla, the Prunus powdery mildew agent
- Author
-
Thierry Candresse, Armelle Marais, Chantal Faure, Salma Arous, Laurence Svanella-Dumas, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, and Université of Tunis
- Subjects
0106 biological sciences ,Sequence analysis ,Molecular Sequence Data ,Sequence Homology ,Biology ,01 natural sciences ,03 medical and health sciences ,Prunus ,Viral genetics ,Viral sequence ,Ascomycota ,Virology ,Botany ,Genetics ,Cluster Analysis ,RNA Viruses ,Molecular Biology ,Phylogeny ,ComputingMilieux_MISCELLANEOUS ,Plant Diseases ,030304 developmental biology ,Sequence (medicine) ,0303 health sciences ,Podosphaera tridactyla ,Sequence Analysis, DNA ,General Medicine ,RNA-Dependent RNA Polymerase ,biology.organism_classification ,3. Good health ,[SDV.BV.PEP]Life Sciences [q-bio]/Vegetal Biology/Phytopathology and phytopharmacy ,Sequence homology ,RNA, Viral ,Powdery mildew ,010606 plant biology & botany - Abstract
International audience
- Published
- 2013
- Full Text
- View/download PDF
115. Distribution of Barley yellow dwarf virus-PAV in the Sub-Antarctic Kerguelen Islands and characterization of two new [i]Luteovirus[/i] species
- Author
-
Armelle Marais, Maurice Hullé, Laurence Svanella-Dumas, Thierry Candresse, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), AGROCAMPUS OUEST-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National de la Recherche Agronomique (INRA), Université Sciences et Technologies - Bordeaux 1-Institut National de la Recherche Agronomique (INRA)-Université Bordeaux Segalen - Bordeaux 2, Institut National de la Recherche Agronomique (INRA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1 (UB), and Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST
- Subjects
0106 biological sciences ,RNA viruses ,lcsh:Medicine ,Plant Science ,01 natural sciences ,Polymerase Chain Reaction ,antarctique ,Viral classification ,santé des plantes ,Emerging Viral Diseases ,Ecological Remediation ,lcsh:Science ,pathologie végétale ,bydv pav ,Phylogeny ,Genetics ,0303 health sciences ,Multidisciplinary ,biology ,Phylogenetic tree ,Ecology ,Biodiversity ,Community Ecology ,barley yellow dwarf virus ,Barley yellow dwarf ,virologie végétale ,iles kerguelen ,Autre (Sciences du Vivant) ,Research Article ,Species complex ,[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,Luteovirus ,Plant Pathogens ,Antarctic Regions ,Microbiology ,Viral Evolution ,Microbial Ecology ,03 medical and health sciences ,Species Specificity ,Rhopalosiphum padi ,Virology ,Genetic variation ,lutéovirus ,Biology ,030304 developmental biology ,virus phytopathogène ,subantarctique ,Genetic diversity ,lcsh:R ,Genetic Variation ,Plant Pathology ,biology.organism_classification ,Viral Disease Diagnosis ,Poa cookii ,lcsh:Q ,010606 plant biology & botany - Abstract
International audience; A systematic search for viral infection was performed in the isolated Kerguelen Islands, using a range of polyvalent genus-specific PCR assays. Barley yellow dwarf virus (BYDV) was detected in both introduced and native grasses such as Poa cookii. The geographical distribution of BYDV and its prevalence in P. cookii were analyzed using samples collected from various sites of the archipelago. We estimate the average prevalence of BYDV to be 24.9% in P. cookii, with significant variability between sites. BYDV genetic diversity was assessed using sequence information from two genomic regions: the P3 open reading frame (ORF) (encoding the coat protein) and the hypervariable P6 ORF region. The phylogenetic analysis in the P3 region showed that BYDV sequences segregate into three major lineages, the most frequent of which (Ker-I cluster) showed close homology with BYDV-PAV-I isolates and had very low intra-lineage diversity (0.6%). A similarly low diversity was also recorded in the hypervariable P6 region, suggesting that Ker-I isolates derive from the recent introduction of BYDV-PAV-I. Divergence time estimation suggests that BYDV-PAV-I was likely introduced in the Kerguelen environment at the same time frame as its aphid vector, Rhopalosiphum padi, whose distribution shows good overlap with that of BYDV-Ker-I. The two other lineages show more than 22% amino acid divergence in the P3 region with other known species in the BYDV species complex, indicating that they represent distinct BYDV species. Using species-specific amplification primers, the distribution of these novel species was analyzed. The high prevalence of BYDV on native Poaceae and the presence of the vector R. padi, raises the question of its impact on the vulnerable plant communities of this remote ecosystem.
- Published
- 2013
- Full Text
- View/download PDF
116. Analysis of key mutations in the VPg of Lettuce mosaic virus involved in elF4E-resistance breaking
- Author
-
Tavert-Roudet, Genevieve, Svanella-Dumas, Laurence, Candresse, Thierry, German-Retana, Sylvie, ProdInra, Migration, Biologie du fruit et pathologie (BFP), and Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2013
117. First report of Barley yellow dwarf virus and Cereal yellow dwarf virus affecting cereal crops in Azerbaijan
- Author
-
Laurence Svanella-Dumas, Safaa G. Kumari, Z. I. Akparov, Eldar Mustafayev, Thierry Candresse, Azerbaijan National Academy of Sciences (ANAS), Biologie du fruit et pathologie (BFP), Université Sciences et Technologies - Bordeaux 1-Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), and International Center for Agricultural Research in the Dry Areas [Syrie] (ICARDA)
- Subjects
0106 biological sciences ,2. Zero hunger ,0303 health sciences ,Veterinary medicine ,[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,Barley stripe mosaic virus ,biology ,food and beverages ,Plant Science ,biology.organism_classification ,01 natural sciences ,03 medical and health sciences ,Barley yellow mosaic virus ,Barley yellow dwarf ,Plant virus ,Barley yellow striate mosaic virus ,Botany ,Wheat dwarf virus ,Maize streak virus ,Agronomy and Crop Science ,Wheat streak mosaic virus ,030304 developmental biology ,010606 plant biology & botany - Abstract
A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.
- Published
- 2013
- Full Text
- View/download PDF
118. Progrès et contraintes pour le développement de la métagénomique phytovirale
- Author
-
CANDRESSE, Thierry, MARAIS, Armelle, FAURE, Chantal, SVANELLA-DUMAS, Laurence, CARRERE, Sebastien, BERGEY, Bernard, LAIZET, Yec'han, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Unité mixte de recherche interactions plantes-microorganismes, Institut National de la Recherche Agronomique (INRA)-Université Toulouse III - Paul Sabatier (UT3), and Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Centre National de la Recherche Scientifique (CNRS)
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2012
119. Mutations in the Cylindrical Inclusion of Lettuce mosaic virus are associated with evolution towards resistance-breaking of eIF4E-mediated resistance in lettuce
- Author
-
SOREL, Maud, SVANELLA-DUMAS, Laurence, ACELIN, Guillaume, HOUVENAGHEL, Marie-Christine, LE GALL, Olivier, CANDRESSE, Thierry, GERMAN-RETANA, Sylvie, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2012
120. Deep sequencing and the identification without prior knowledge of phytoviruses: applications to plant diseases etiology and to metagenomics
- Author
-
Candresse, Thierry, Marais, Armelle, Faure, Chantal, Svanella-Dumas, Laurence, Bergey, Bernard, Laizet, Yec'han, Cambra, M., OLMOS, A., Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Instituto Valenciano de Investigaciones Agrarias - Institut Valencià d'Investigacions Agraries - Valencian Institute for agricultural Research (IVIA), and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
International audience
- Published
- 2012
121. Evolution of Lettuce mosaic virus towards resistance-breaking in lettuce: involvement of the viral Cylindrical Inclusion
- Author
-
Sorel, Maud, Svanella-Dumas, Laurence, Roudet-Tavert, Genevieve, Candresse, Thierry, German-Retana, Sylvie, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Réseau d'Evolution Virale. FRA., and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,potyvirus ,Evolution ,eIF4E ,resistance-breaking ,LMV ,Cylindrical inclusion ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2012
122. Development of a mini-oligo array for the analysis of Plum pox virus variability
- Author
-
Olmos, A., Ancillo, G., Svanella-Dumas, Laurence, Vidal, E., Petit, Johann, Cambra, M., Candresse, Thierry, Instituto Valenciano de Investigaciones Agrarias - Institut Valencià d'Investigacions Agraries - Valencian Institute for agricultural Research (IVIA), Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
International audience
- Published
- 2012
123. Key mutations in the cylindrical inclusion of Lettuce mosaic virus (LMV) are involved in the breakdown of the eIF4E-mediated resistance
- Author
-
SOREL, Maud, ABDUL RAZZAK, Anas, SVANELLA-DUMAS, Laurence, ACELIN, Guillaume, HOUVENAGHEL, Marie-Christine, CANDRESSE, Thierry, GERMAN-RETANA, Sylvie, ProdInra, Migration, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, and Societe Francaise de Phytopathologie (SFP). FRA.
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2012
124. Vers une vision globale de la diversité biologique et moléculaire du Lettuce mosaic virus (LMV)
- Author
-
Svanella-Dumas, Laurence, Le Gall, Olivier, German-Retana, Sylvie, Candresse, Thierry, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Societe Francaise de Phytopathologie (SFP). FRA., and ProdInra, Migration
- Subjects
[SDV.OT]Life Sciences [q-bio]/Other [q-bio.OT] ,[SDV.OT] Life Sciences [q-bio]/Other [q-bio.OT] ,ComputingMilieux_MISCELLANEOUS - Abstract
National audience
- Published
- 2012
125. Etude de la prévalence et de la diversité moléculaire du Barley yellow dwarf virus dans les îles sub-Antarctiques Kerguelen
- Author
-
Svanella-Dumas, Laurence, Marais, Armelle, Hulle, Maurice, Candresse, Thierry, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Institut National de la Recherche Agronomique (INRA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1 (UB), and Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST
- Subjects
ComputingMilieux_MISCELLANEOUS ,[SDV.BV.PEP]Life Sciences [q-bio]/Vegetal Biology/Phytopathology and phytopharmacy - Abstract
National audience
- Published
- 2011
126. Asian prunus viruses
- Author
-
Thierry Candresse, Armelle Marais, Laurence Svanella-Dumas, Gentit, P., Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Lanxade, Centre Technique Interprofessionnel des Fruits et Légumes (CTIFL), Ahmed Hadidi (Editeur), Marina Barba (Editeur), Thierry Candresse (Editeur), Wilhelm Jelkmann (Editeur), and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,[SDV]Life Sciences [q-bio] ,ASIAN PRUNUS VIRUS ,RT-PCR ,GEOGRAPHIE ,BIOLOGIE MOLECULAIRE ,CONTROLE ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2011
127. Cherry virus A
- Author
-
Armelle Marais, Thierry Candresse, Laurence Svanella-Dumas, Jelkmann, W., Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Julius Kühn-Institut (JKI), Ahmed Hadidi (Editeur), Marina Barba (Editeur), Thierry Candresse (Editeur), Wilhelm Jelkmann (Editeur), and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,CVA ,SYMPTOME DE LA MALADIE ,[SDV]Life Sciences [q-bio] ,GEOGRAPHIE ,BIOLOGIE MOLECULAIRE ,CONTROLE ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2011
128. CHAPTER 39: Stocky prune virus
- Author
-
L. Svanella-Dumas, T. Candresse, and Pascal Gentit
- Subjects
Stocky prune virus ,Biology ,Virology - Published
- 2011
- Full Text
- View/download PDF
129. Métagénome phytoviral des Iles Kerguelen, vers un inventaire exhaustif des phytovirus dans un écosystème simplifié
- Author
-
Marais, Armelle, Faure, Chantal, Laizet, Yec'Han, Svanella-Dumas, Laurence, Arous, Salma, Hulle, Maurice, Candresse, Thierry, Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Institut National de la Recherche Agronomique (INRA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1 (UB), and Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST
- Subjects
virus phytopathogène ,Phytopathology and phytopharmacy ,Phytopathologie et phytopharmacie ,pyroséquençage ,[SDV.BV.PEP]Life Sciences [q-bio]/Vegetal Biology/Phytopathology and phytopharmacy ,métagénome viral ,santé des plantes ,séquençage ,écosystème simple ,virologie végétale ,iles kerguelen ,pathologie végétale ,ComputingMilieux_MISCELLANEOUS ,diversité - Abstract
National audience
- Published
- 2011
130. Stocky prune virus
- Author
-
Thierry Candresse, Laurence Svanella-Dumas, Gentit, P., Biologie du fruit et pathologie (BFP), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)-Université Sciences et Technologies - Bordeaux 1, Centre Technique Interprofessionnel des Fruits et Légumes (CTIFL), Ahmed Hadidi (Editeur), Marina Barba (Editeur), Thierry Candresse (Editeur), Wilhelm Jelkmann (Editeur), and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,[SDV]Life Sciences [q-bio] ,STPV ,STOCKY PRUNE VIRUS ,GEOGRAPHIE ,CHERAVIRUS ,CONTROLE ,ComputingMilieux_MISCELLANEOUS - Abstract
International audience
- Published
- 2011
131. CHAPTER 29: Cherry virus A
- Author
-
Thierry Candresse, Armelle Marais, Laurence Svanella-Dumas, and W. Jelkmann
- Subjects
Biology ,Virology ,Virus - Published
- 2011
- Full Text
- View/download PDF
132. Assessing the status of amphibian breeding sites in Italy: a national survey
- Author
-
Salvidio, Sebastian, Andreone, Franco, Angelini, Jacopo, Bassu, Lara, Bennati, R., Bernini, Franco, Bettiol, Katia, Biancardi, Biggi, Emanuele, Bionda, Radames, Bocca, Massimo, Bonato, Lucio, Buzzetti, Filippo Maria, Carafa, Marco, Carletti, Silvia, Cassol, Michele, Casu, Viviana, Cavalieri, C., Cornetti, Luca, Corti, Claudia, Dal Lago, Antonio, Damico, Maurizio, Delisio, Lorenzo, Delmastro, Giovanni Battista, Di Cerbo, Anna Rita, Di Francesco, N., Di Tizio, Luciano, Donelli, O., Doria, Giuliano, Emiliani, Davide, Eusebio, Bergo Paolo, Evangelista, Massimo, Faraone, Francesco Paolo, Fattizzo, Tiziano, Ferri, Vincenzo, Ferro, M., Fiacchini, David, Ficetola, Francesco, Foglia, Gessica, Fulco, Egidio, Giacalone, G., Giberti, P., Gola, Grieco, Cristina, Guarino, Fabio Maria, Iannelli, A., Iantorno, A., Incao, Jimenez, Gonzales Pilar, Lamagni, Luca, Lillo, Francesco, Lo Valvo, Mario, Manca, J., Marchesi, M., Mazzotti, Stefano, Menegon, Michele, Mezzasalma, Marcello, Miserocchi, Danio, Montioni, Francesca, Mosini, Andrea, Nistri, Anna Maria, Nitti, Nicola, Novaga, R., Odierna, Gaetano, Oneto, Fabrizio, Ottonello, Dario, Parolin, Enrico, Pedrini, Paolo, Pellegrini, Mario, Pellitteri-Rosa, Daniele, Penazzi, Rocco, Petruzzi, F., Piazzini, Sandro, Picariello, Orfeo, Poggiani, Luciano, Polio, R., Pupin, Fabio, Razzetti, Edoardo, Richard, Jacopo, Riservato, Elisa, Romanazzi, Enrico, Romano, Antonio, Romano, Antonio Vito, Rossini, Marco, Sacchi, Roberto, Sala, Luigi, Sassi, A., Scali, Stefano, Scirocco, T., Seglie, Daniele, Semenzato, Massimo, Silvano, Fabrizio, Sindaco, Roberto, Sommacal, Monica, Spada, Arianna, Emilio Sperone, Spilinga, Cristiano, Svanella, Abbondio, Tormen, Fausto, Tormen, Giuseppe, Tripepi, Sandro, Vaccaro, Angelo, Vanni, Stefano, Ventrella, Pasquale, Nulchis, Valentina, Zampogno, Elena, and Zuffi, Marco A. L.
- Subjects
Amphibian breeding sites ,Italian amphibian survey ,conservation ,freshwater habitat loss ,scientific monitoring ,volunteers - Published
- 2011
133. CHAPTER 21: Asian Prunus Viruses
- Author
-
L. Svanella-Dumas, Armelle Marais, Pascal Gentit, and T. Candresse
- Subjects
Prunus ,Botany ,Biology - Published
- 2011
- Full Text
- View/download PDF
134. Complete Nucleotide Sequence of Artichoke latent virus Shows it to be a Member of the Genus Macluravirus in the Family Potyviridae
- Author
-
Minutillo, S. A., primary, Marais, A., additional, Mascia, T., additional, Faure, C., additional, Svanella-Dumas, L., additional, Theil, S., additional, Payet, A., additional, Perennec, S., additional, Schoen, L., additional, Gallitelli, D., additional, and Candresse, T., additional
- Published
- 2015
- Full Text
- View/download PDF
135. A new potyvirus virulence determinant: the CI C-terminus modulates pathogenicity of Lettuce mosaic virus in lettuce
- Author
-
Abdul Razzak, Anas, Svanella, Laurence, Roudet-Tavert, Genevieve, Houvenaghel, Marie-Christine, Walter, Jocelyne, Michon, Thierry, Le Gall, Olivier, Candresse, Thierry, German-Retana, Sylvie, Génomique, développement et pouvoir pathogène (GD2P), and Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)
- Subjects
POUVOIR PATHOGENE ,[SDV]Life Sciences [q-bio] ,CI ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2010
136. Recherche non ciblée de virus de plantes par une approche métagénomique : l'exemple des îles subantarctiques françaises
- Author
-
Marais, Armelle, Faure, Chantal, Arous, Salma, Svanella-Dumas, Laurence, Couture, Carole, Hullé, Maurice, Candresse, Thierry, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Biologie des organismes et des populations appliquées à la protection des plantes (BIO3P), AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National de la Recherche Agronomique (INRA), ProdInra, Migration, and Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST
- Subjects
[SDV] Life Sciences [q-bio] ,ILES SUBANTARCTIQUES ,[SDV]Life Sciences [q-bio] ,ComputingMilieux_MISCELLANEOUS ,GENOMIQUE ,VIROLOGIE - Abstract
National audience
- Published
- 2010
137. Approches pour l’identification sans à priori de nouveaux virus phytopathogènes : application à l’étude de l’étiologie de maladies des plantes et à l’étude du métagénome viral
- Author
-
Candresse, Thierry, Marais, Armelle, Youssef, Fater, Faure, Chantal, Svanella, Laurence, Ben Amor, Arous, Couture, Carole, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), and ProdInra, Migration
- Subjects
[SDV.MP.VIR] Life Sciences [q-bio]/Microbiology and Parasitology/Virology ,METAGENOME VIRAL ,ETIOLOGIE ,SIRNA ,[SDV.MP.VIR]Life Sciences [q-bio]/Microbiology and Parasitology/Virology ,GENETIQUE ,ComputingMilieux_MISCELLANEOUS ,AGENT VIRAL ,VIROLOGIE - Abstract
National audience
- Published
- 2010
138. Towards the description of the plant virus metagenome of the French Sub-Antarctic Islands
- Author
-
Marais, Armelle, Faure, Chantal, Arous, Salma, Svanella-Dumas, Laurence, Couture, Carole, Hullé, Maurice, ProdInra, Migration, Génomique, développement et pouvoir pathogène (GD2P), and Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)
- Subjects
[SDV] Life Sciences [q-bio] ,ILES SUBANTARCTIQUES ,METAGENOME VIRAL ,[SDV]Life Sciences [q-bio] ,GENETIQUE ,ComputingMilieux_MISCELLANEOUS ,GENOMIQUE ,VIROLOGIE - Abstract
International audience
- Published
- 2010
139. A new potyvirus virulence determinant: the CI C-terminus modulates pathogenicity of Lettuce mosaic virus in lettuce
- Author
-
German-Retana, Sylvie, Abdul Razzak, Anas, Svanella, Laurence, Roudet-Tavert, Genevieve, Le Gall, Olivier, Candresse, Thierry, ProdInra, Migration, Génomique, développement et pouvoir pathogène (GD2P), and Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA)
- Subjects
[SDV] Life Sciences [q-bio] ,POUVOIR PATHOGENE ,[SDV]Life Sciences [q-bio] ,CI ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2010
140. Characterisation of plant virus populations by a metagenomic approach : Survey in French sub-antarctic islands
- Author
-
Armelle Marais, Chantal Faure, Carole Couture, Laurence Svanella, Maurice Hullé, Marc Le Romancer, Thierry Candresse, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Biologie des organismes et des populations appliquées à la protection des plantes (BIO3P), Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST, Institut Universitaire Européen de la Mer (IUEM), Institut de Recherche pour le Développement (IRD)-Institut national des sciences de l'Univers (INSU - CNRS)-Université de Brest (UBO)-Centre National de la Recherche Scientifique (CNRS), Institut National de la Recherche Agronomique (INRA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,EVOLUTION VIRALE ,METAGENOME VIRAL ,[SDV]Life Sciences [q-bio] ,GENETIQUE - Abstract
National audience; Only a few number of metagenomic studies concern plant viruses. However, a global knowledge of viral diversity would be very interesting in terms of ecology and could have important impacts on viral taxonomy and diversity studies and, potentially, on the prediction of emerging plant diseases. As an example, the “Plant Virus Biodiversity and Ecology” (PVDE) project has been initiated to survey the biodiversity of vascular plant viruses in the nature Conservancy’s Tallgrass Prairie Preserve of Oklahoma in USA (Wren et al., 2006). Our purpose is to describe the viral metagenome of the French sub-antarctic islands, especially in the Kerguelen islands. This project is included in the nationally funded EVINCE project “Vulnerability of native communities to invasive insects and climate change in sub-Antarctic islands” The ecosystems of these islands provide a suite of environments and scenarios that give key opportunities to improve our understanding of the consequences of climate change and biological invasions on terrestrial ecosystems. An additional interest is that almost nothing is known on the plant viruses present in such remote ecosystems, with the exception of a single report describing a new member of the Badnavirus genus (Skotnicki et al., 2003). Viral screening was done by two approaches. The first one, opened, consists in the analysis of double-stranded RNA, random cloning, sequencing, and comparison with sequences in databanks. By this approach we have been able to detect in an introduced Tropaeolum majus sample, sequences presenting 34% of identity in amino acids (56% of similarity) with the replicase of Oryza sativa endornavirus. The same approach permitted the identification of a new plant or fungal virus in a native plant of Kerguelen islands (Aceana magellanica). The sequences revealed 50% of identity with the capsid of Black raspberry virus F. The second approach consists in the screening of viruses belonging to known viral genera by polyvalent detection RT-PCR tests. One Tropaeolum majus sample was identified as being infected by a virus belonging to the Nepovirus genus. Indeed, the sequencing of the amplified fragment showed a significant identity in amino acids (89% and 93% of similarity) with the RNA-dependent RNA polymerase region of Cherry leaf roll virus (CLRV), a well known member of Nepovirus genus. Tropaeolum majus was known to be an experimental host of CLRV, but for our knowledge it is the first time that CLRV is described to infect naturally Tropaeolum majus. In this case, it seems that the virus was introduced in same time than the host plant, demonstrating, if necessary, the impact of species introduction on such terrestrial ecosystems.
- Published
- 2009
141. Molecular characterization of the 3' part of the genome of divergent Cherry virus A isolates and development of a polyvalent CVA-specific PCR detection assay
- Author
-
Svanella-Dumas, Laurence, Marais, Armelle, Candresse, Thierry, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,[SDE] Environmental Sciences ,CVA ,ETIOLOGIE ,[SDV]Life Sciences [q-bio] ,[SDE]Environmental Sciences ,RT-PCR ,GENETIQUE ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2009
142. Variation among Apple chlorotic leaf spot virus isolates affecting fruit tree cultivars and ornamental rosaceous hosts
- Author
-
Sobolev, I., Candresse, Thierry, Dombrovsky, A., Svanella-Dumas, Laurence, Spiegel, S., Dept of Plant Pathology, Cornell University [New York], Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,ETIOLOGIE ,ACLSV ,[SDV]Life Sciences [q-bio] ,RT-PCR ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2009
143. Vers une vision globale de la diversité biologique et moléculaire du Lettuce mosaic virus (LMV)
- Author
-
Svanella-Dumas, Laurence, Candresse, Thierry, Rosales-Villavicencio, Marlene, Fakhfakh, Hatem, Le Gall, Olivier, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Instituto de Investigaciones Agropecuarias, Université of Tunis, and ProdInra, Migration
- Subjects
[SDV] Life Sciences [q-bio] ,DIVERSITE BIOLOGIQUE ,[SDV]Life Sciences [q-bio] ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
National audience
- Published
- 2009
144. The determinant of potyvirus ability to overcome the RTM resistance of Arabidopsis thaliana maps to the N-terminal region of the coat protein
- Author
-
Thierry Candresse, Juan Antonio García, Véronique Decroocq, Patrick Cosson, Laurence Svanella-Dumas, Beatriz Salvador, Ophélie Sicard, Miroslav Glasa, Frédéric Revers, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Centro Nacional de Biotecnologia (CNB), Universidad Autonoma de Madrid (UAM)-Consejo Superior de Investigaciones Científicas [Madrid] (CSIC), and Slovak Academy of Sciences (SAS)
- Subjects
0106 biological sciences ,Physiology ,Potyvirus ,Arabidopsis ,01 natural sciences ,déterminant viral ,santé des plantes ,pathologie végétale ,Heat-Shock Proteins ,Genetics ,0303 health sciences ,biology ,Tobacco etch virus ,BLOCAGE DE LA RESISTANCE ,General Medicine ,Plants, Genetically Modified ,Lettuce mosaic virus ,3. Good health ,VIROLOGIE ,Plum Pox Virus ,Host-Pathogen Interactions ,Plant Lectins ,résistance aux maladies ,N-TERMINAL REGION ,Molecular Sequence Data ,virus ,Plant disease resistance ,Genes, Plant ,Models, Biological ,Virus ,03 medical and health sciences ,Plant virus ,[SDV.BBM]Life Sciences [q-bio]/Biochemistry, Molecular Biology ,Amino Acid Sequence ,Gene ,030304 developmental biology ,DNA Primers ,virus phytopathogène ,Base Sequence ,Sequence Homology, Amino Acid ,Potyviridae ,Arabidopsis Proteins ,arabidopsis thaliana ,RESISTANCE RTM ,GENETIQUE ,biology.organism_classification ,Virology ,DNA, Viral ,Capsid Proteins ,Agronomy and Crop Science ,mouvement à longue distance ,010606 plant biology & botany - Abstract
International audience; In Arabidopsis thaliana Columbia (Col-0) plants, the restriction of Tobacco etch virus (TEV) long-distance movement involves at least three dominant RTM (restricted TEV movement) genes named RTM1, RTM2, and RTM3. Previous work has established that, while the RTM-mediated resistance is also effective against other potyviruses, such as Plum pox virus (PPV) and Lettuce mosaic virus (LMV), some isolates of these viruses are able to overcome the RTM mechanism. In order to identify the viral determinant of this RTM-resistance breaking, the biological properties of recombinants between PPV-R, which systemically infects Col-0, and PPV-PSes, restricted by the RTM resistance, were evaluated. Recombinants that contain the PPV-R coat protein (CP) sequence in an RTM-restricted background are able to systemically infect Col-0. The use of recombinants carrying chimeric CP genes indicated that one or more PPV resistance-breaking determinants map to the 5′ half of the CP gene. In the case of LMV, sequencing of independent RTM-breaking variants recovered after serial passages of the LMV AF199 isolate on Col-0 plants revealed, in each case, amino acid changes in the CP N-terminal region, close to the DAG motif. Taken together, these findings demonstrate that the potyvirus CP N-terminal region determines the outcome of the interaction with the RTM-mediated resistance.
- Published
- 2009
- Full Text
- View/download PDF
145. Caractéristiques de populations virales phytopathogènes des îles sub-antarctiques
- Author
-
Marais, Armelle, Faure, Chantal, Couture, Carole, Svanella, Laurence, Hulle, Maurice, Le Romancer, Marc, Candresse, Thierry, ProdInra, Migration, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Biologie des organismes et des populations appliquées à la protection des plantes (BIO3P), AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National de la Recherche Agronomique (INRA), Technopole Brest Iroise, and Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST
- Subjects
[SDV] Life Sciences [q-bio] ,CHERRY LEAFROLL VIRUS ,[SDV]Life Sciences [q-bio] ,BLACK RASPBERRY VIRUS F ,ILE SUB-ANTARCTIQUE ,TROPAEOLUM MAJUS ,ACEANA MAGELLANICA ,ILE AMSTERDAM ,CAPUCINE ,ComputingMilieux_MISCELLANEOUS ,GENOMIQUE ,VIROLOGIE - Abstract
National audience
- Published
- 2009
146. Further characterization of a new recombinant group of Plum pox virus isolates, PPV-T, found in orchards in the Ankara province of Turkey
- Author
-
Çiğdem Ulubaş Serçe, Laurence Svanella-Dumas, Kadriye Çağlayan, Thierry Candresse, Mona Gazel, Laszlo Krizbai, Mustapha Kemal University, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Soil Conservation and Plant Health Service, and Partenaires INRAE
- Subjects
0106 biological sciences ,Cancer Research ,Turkey ,Sequence analysis ,Molecular Sequence Data ,Biology ,01 natural sciences ,Genome ,Serology ,03 medical and health sciences ,RECOMBINANT ,Phylogenetics ,Virology ,Plant virus ,Typing ,Orchidaceae ,Gene ,Phylogeny ,030304 developmental biology ,Plant Diseases ,Recombination, Genetic ,0303 health sciences ,Strain (biology) ,BIOLOGIE MOLECULAIRE ,VIROLOGIE ,Infectious Diseases ,Plum Pox Virus ,[SDV.MP.VIR]Life Sciences [q-bio]/Microbiology and Parasitology/Virology ,010606 plant biology & botany - Abstract
Sixteen Plum pox virus (PPV) isolates collected in the Ankara region of Turkey were analyzed using available serological and molecular typing assays. Surprisingly, despite the fact that all isolates except one, which was a mix infection, were typed as belonging to the PPV-M strain in four independent molecular assays, nine of them (60%) reacted with both PPV-M specific and PPV-D specific monoclonal antibodies. Partial 5' and 3' genomic sequence analysis on four isolates demonstrated that irrespective of their reactivity towards the PPV-D specific monoclonal antibody, they were all closely related to a recombinant PPV isolate from Turkey, Ab-Tk. All three isolates for which the relevant genomic sequence was obtained showed the same recombination event as Ab-Tk in the HC-Pro gene, around position 1566 of the genome. Complete genomic sequencing of Ab-Tk did not provide evidence for additional recombination events in its evolutionary history. Taken together, these results indicate that a group of closely related PPV isolates characterized by a unique recombination in the HC-Pro gene is prevalent under field conditions in the Ankara region of Turkey. Similar to the situation with the PPV-Rec strain, we propose that these isolates represent a novel strain of PPV, for which the name PPV-T (Turkey) is proposed. Given that PPV-T isolates cannot be identified by currently available typing techniques, it is possible that their presence has been overlooked in other situations. Further efforts should allow a precise description of their prevalence and of their geographical distribution in Turkey and, possibly, in other countries. (C) 2009 Elsevier B.V. All rights reserved.
- Published
- 2008
- Full Text
- View/download PDF
147. Diversité génomique du Cherry capillovirus A (CVA) et implications sur le diagnostic
- Author
-
Marais, Armelle, Svanella-Dumas, Laurence, Barone, Monica, Gentit, Pascal, Ragozzino, A., Candresse, Thierry, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Università degli studi di Napoli Federico II, Centre de Lanxade, and Centre Technique Interprofessionnel des Fruits et Légumes (CTIFL)
- Subjects
CVA ,DIAGNOSTIC ,DIVERSITE GENOMIQUE ,CHERRY CAPILLOVIRUS A ,[SDV]Life Sciences [q-bio] ,CAPILLOVIRUS ,RT-PCR ,GENETIQUE ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
National audience
- Published
- 2007
148. Genomic diversity of Cherry capillovirus A (CVA) and suitability of various assays for its detection
- Author
-
Thierry Candresse, Laurence Svanella-Dumas, Armelle Marais, A. Ragozzino, Pascal Gentit, M. Barone, Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Università degli studi di Napoli Federico II, Centre de Lanxade, and Centre Technique Interprofessionnel des Fruits et Légumes (CTIFL)
- Subjects
0106 biological sciences ,Cherry capillovirus ,media_common.quotation_subject ,CHERRY CAPILLOVIRUS A ,[SDV]Life Sciences [q-bio] ,SWEET CHERRY TREE DECLINE DISEASE ,Horticulture ,Biology ,01 natural sciences ,03 medical and health sciences ,Botany ,ComputingMilieux_MISCELLANEOUS ,030304 developmental biology ,media_common ,0303 health sciences ,CVA ,business.industry ,FILAMENTOUS VIRUS ,Biotechnology ,ETIOLOGY ,VIROLOGIE ,CAPILLOVIRUSES ,VARIABILITY ,ETIOLOGIE ,CAPILLOVIRUS ,PLANT DISEASE ,business ,010606 plant biology & botany ,Diversity (politics) - Abstract
International audience; Cherry virus A (CVA) is a poorly known member of the Capillovirus genus whose potential association to a new decline disease of sweet cherry described from Southern France was recently questioned. The PDO nested RT-PCR was used as a detection tool to look for Trichoviruses, Capilloviruses and Foveaviruses in symptomatic and asymptomatic cherry samples (Foissac et al., 2005). The results suggest that there is no association between CVA and the cherry tree decline disease. In parallel, using the short fragment of the viral RNA-dependent RNA polymerase (RdRp) amplified by the PDO nested RT-PCR assay, the diversity of CVA isolates was analyzed. Substantial diversity was observed, with an average pairwise nucleotide divergence between isolates of about 9%. The major group of isolates identified clustered together with the CVA type isolate. Four additional divergent clusters of isolates could be identified, one of which corresponds to isolates obtained from non-cherry (apricot, plum) hosts. The average genetic distance between the various clusters in the sequenced region reached 19%. The polyvalence of the currently available CVA detection techniques was then assessed using a range of isolates representative of the four main phylogenetic clusters. Remarkably, outside of the major phylogenetic cluster, neither molecular hybridisation tests using probes derived from the 5' end or from the 3' end of the genome, nor the RT-PCR assay using the CVA1-CVA2 primer pair (James and Jelkmann, 1998) permitted the detection of all the CVA isolates. These results provide evidence for a previously unrecognized genetic diversity in CVA and indicate that new, more polyvalent assays are needed for the efficient detection of all isolates of this virus.
- Published
- 2006
149. Analysis of Apple chlorotic leaf spot virus (ACLSV) genetic diversity and implications for its evolutionnary history and for its epidemiology
- Author
-
Candresse, Thierry, Barone, Monica, Svanella-Dumas, Laurence, Marais, Armelle, Ragozzino, A., Mathioudakis, M.M., Maliogka, V.I., Katis, N.I., Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), Università degli studi di Napoli Federico II, and Aristotle University of Thessaloniki
- Subjects
ACLSV ,[SDV]Life Sciences [q-bio] ,APPLE CHLOROTIC LEAF SPOT VIRUS ,PLANT DISEASE ,ComputingMilieux_MISCELLANEOUS ,VIROLOGIE - Abstract
International audience
- Published
- 2006
150. Biology and epidemiology of seed transmission in potyviruses
- Author
-
Le Gall, O., Renate Krause-Sakate, Redondo, E., Svanella-Dumas, L., German-Retana, S., Zerbini, M., Rosales, M., Candresse, T., Génomique, développement et pouvoir pathogène (GD2P), Université Bordeaux Segalen - Bordeaux 2-Institut National de la Recherche Agronomique (INRA), FCA/UNESP, Partenaires INRAE, Universidade Federal de Vicosa (UFV), and Instituto Nacional de Investigación Agropecuaria (INIA)
- Subjects
MALADIE DES PLANTES ,TRANSMISSION ,[SDV]Life Sciences [q-bio] ,LETTUCE MOSAIC VIRUS ,LMV ,BIOLOGIE MOLECULAIRE ,POTYVIRUS ,ComputingMilieux_MISCELLANEOUS ,SEMENCE ,VIROLOGIE - Abstract
International audience
- Published
- 2006
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.