Search

Uterine leiomyosarcomas are malignant tumors that have a grim prognosis. These neoplasms have a high metastatic potential. Limited literature exists on leiomyosarcoma metastasizing to the thyroid. This case emphasizes the importance of considering metastasis as a possible cause for thyroid swelling in patients with a history of malignancy., Competing Interests: Conflict of interestThe authors declare that they have no conflict of interest., (© Association of Otolaryngologists of India 2023. Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.)

The fight against infectious diseases often focuses on epidemics and pandemics, which demand urgent resources and command attention from the health authorities and media. However, the vast majority of deaths caused by infectious diseases occur in endemic zones, particularly in developing countries, placing a disproportionate burden on underfunded health systems and often requiring international interventions. The provision of vaccines and other biologics is hampered not only by the high cost and limited scalability of traditional manufacturing platforms based on microbial and animal cells, but also by challenges caused by distribution and storage, particularly in regions without a complete cold chain. In this review article, we consider the potential of molecular farming to address the challenges of endemic and re-emerging diseases, focusing on edible plants for the development of oral drugs. Key recent developments in this field include successful clinical trials based on orally delivered dried leaves of Artemisia annua against malarial parasite strains resistant to artemisinin combination therapy, the ability to produce clinical-grade protein drugs in leaves to treat infectious diseases and the long-term storage of protein drugs in dried leaves at ambient temperatures. Recent FDA approval of the first orally delivered protein drug encapsulated in plant cells to treat peanut allergy has opened the door for the development of affordable oral drugs that can be manufactured and distributed in remote areas without cold storage infrastructure and that eliminate the need for expensive purification steps and sterile delivery by injection., (© 2021 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

This data article presents the experimental data set on the optimization of four important parameters which are type of blending fuel, blending ratio, compression ratio and injection timing for four objective functions namely higher brake thermal efficiency, lower brake specific fuel consumption, lower oxides of nitrogen emission and lower unburnt hydrocarbon emission using grey relational analysis and orthogonal array based experimental design. Each parameter was fixed with three levels and L9 orthogonal array has been chosen for experimental analysis. The data obtained from the experimental work reported that butanol as blending fuel, 40% of maximum blending ratio, compression ratio of 16:1 and injection timing of 26 °CA before top dead centre were identified as optimized set of parameters.

Biofouling is a severe problem in membrane systems which hampers their broad applications because it requires regular chemical cleaning, reduces membrane life, and also decreases product quality. In this study, nanocurcumin (CCM) was prepared by sonication-assisted wet-milling technique and then incorporated in polyethersulfone (PES) membrane to enhance the anti-biofouling property. TEM analysis of the curcumin showed that nanomaterials are spherical. FTIR studies confirmed that the presence of CCM nanomaterial in PES membrane. Zone inhibition studies revealed that PES/CCM nanocomposite membranes exhibited the better anti-biofouling propensity against Escherichia coli and Pseudomonas aeruginosa. Static adhesion studies also showed that PES/CCM nanocomposite membranes prevented the attachment and proliferation of E. coli cells. Also, PES/2 wt% CCM nanocomposite membrane had a high thermal degradation temperature of 575.62 °C and tensile strength of 1.87 MPa. Moreover, addition of CCM nanomaterial in casting solution altered the membrane morphology and hydrophilicity. Further, pure water flux was increased up to 64.48 L·m -2 ·h -1 for PES/2 wt% CCM nanocomposite membrane. Filtration of raw sewage treatment plant effluent was also carried out. The incorporation of curcumin in membranes was effectively improved the antifouling tendency without compromised affecting the chemical oxygen demand reduction. This study highlights the anti-biofouling potential of CCM incorporated PES nanocomposite membranes, which could be utilized for various filtration applications., (Copyright © 2018 Elsevier B.V. All rights reserved.)

In this study, xanthan gum (XA) was used as a hydrophilic biopolymer additive for the modification of polyethersulfone (PES) membrane to removal of humic acid (HA). The membranes are prepared using phase inversion technique and the concentration of XA was varied from 0.5 to 1.5wt%. The prepared membranes are characterized as a function of hydrophilicity, equilibrium water content (EWC), porosity studies and functional group analysis. Membrane surface and cross-sectional morphology was studied using scanning electron microscope. The lower contact angle value 64.2° was exhibited, when 1.5wt% of XA incorporated in PES membrane and this ensures that increase of hydrophilicity in pristine PES membrane. Further, higher water permeability (PWP) of 68.9(-9)m/skPa was observed for 1.5wt% of XA/PES membrane. The effect of pH on HA removal was studied for neat PES and XA/PES membranes. The rejection performance of XA incorporated in PES membranes were compared with commercial available PES membrane., (Copyright © 2015 Elsevier Inc. All rights reserved.)

1, 2, 8-trihydroxy-6-methoxy xanthone (1) and 1, 2- dihydroxy-6-methoxyxanthone-8-O-β-d-xylopyranosyl (2) are the main constituents of petroleum ether and ethyl acetate extracts from Swertia corymbosa (Gentinaceae), a medicinal plant used in Indian traditional system for the treatment of diabetes. The present study was designed to examine the antihypoglycemic, antihyperlipidemic and antioxidant effect of compounds 1 and 2 in streptozotocin (STZ) induced diabetic rats. Diabetes was induced in male Wistar rats by a single intraperitoneal injection of STZ (60 mg/kg b.w.). The isolated compounds 1 and 2 at a dose of 50 mg/kg b.w., produced the maximum fall of 83% in the blood glucose level in the diabetic rats after 3h of the treatment. The administration of 1 and 2 (50 mg/kgb.w.) daily for 28 days in STZ induced diabetic rats, resulted in a significant decrease in blood glucose, glycosylated hemoglobin, SGOT, SGPT, ALP serum urea and creatinine with significant rise in plasma insulin level. Test compounds 1 and 2 showed antihyperlipidemic activities as evidenced by significant decrease in serum TC, TG, LDL-C, VLDL-C levels coupled together with elevation of HDL-C level in diabetic treated rats when compared to diabetic untreated rats, indicate the protective role against liver and kidney damage. The results of histopathology also showed 1 and 2 protected tissues (pancreas, liver and kidney) against peroxidation damage and maintained tissue integrity. Further, the molecular interaction study of the ligands 1, 2 and glibenclamide with various diabetes mellitus related protein targets like glucokinase (PDB ID: 1V4S), fructose-1, 6-bisphosphatase 1 (PDB ID: 2JJK) 11-β-hydroxysteroid dehydrogenase (PDB ID: 2BEL) and modeled protein sulfonylurea receptor 1 (SUR1) showed that ligand 1 and 2 possess binding affinity with all protein targets except for 2BEL target protein for which ligand 1 has no interaction. The ligand pose with 2BEL and SUR1 protein target of ligand 2 gave the best binding conformation. Hence 1 and 2 can be considered for developing into a potent antidiabetic drug., (Copyright © 2014 Elsevier GmbH. All rights reserved.)

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev-3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.