Search

A novel bis-iodurated polyether compound, based on an unprecedented tetra-THF backbone, has been isolated as a trace by-product of the oxidation of squalene with the catalytic system RuO₂(cat.)/NaIO₄. The double erythro configuration of the central portion of the molecule furnishes the first indirect support of the previously postulated pathway operating in the oxidative pentacyclization of the isoprenoid substrate. A bidirectional double oxidative bis-cyclization is invoked to explain the formation of this compound. The isolated substance was successfully subjected to a double rearrangement-ring expansion to give a novel bis-THF-bis-THP compound.

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

The absolute stereochemistry at the C-7, C-8, and C-9 chiral centers of pinolidoxin (1) has been determined by chemical and spectral methods. First, the synthesis of four stereoisomeric fully benzoylated 2,3-erythro-1,2,3,4-heptanetetrols, corresponding to the C(6)-C(18) portion of the natural substance, has been accomplished starting from meso-tartaric acid. As next step, the selection of the synthetic tetrabenzoate possessing "natural" stereochemistry (10a'), suitable for absolute configuration determination, has been carried out by correlation with its "natural" homologue derived from degradation of pinolidoxin. Determination of the stereochemistry at the title chiral centers has been carried out by application of the Mosher's method both to 7a', a compound stereochemically related to 10a', and to pinolidoxin itself. The stereoselective synthesis of a protected form of the C(6)-C(18) portion of pinolidoxin, to be used in its total synthesis, has also been accomplished starting from commercially available D-erythronolactone.

Six new delta 8- and delta 8(14)-5 alpha,6 alpha-epoxysterols (1-6) have been isolated from a collection of the Mediterranean sponge Spongia officinalis. The structures of the new metabolites, isolated as diacetate derivatives, have been determined by spectral analyses and an x-ray diffraction experiment performed on the diacetyl derivative of 1.

Two new 9,11-secosterol, 9,11-seco-3 beta,6 alpha,11-trihydroxy-5 alpha-cholest-7-en-9-one (2) and 9,11-seco-3 beta,6 alpha,11-trihydroxy-24- methylene-5 alpha-cholest-7-en-9-one (3), have been isolated from the marine sponge Spongia officinalis and their structures elucidated by analysis of spectral data including 1H nuclear magnetic resonance correlation spectroscopy (COSY) experiments. Partial synthesis of 2 starting from 3 beta,6 alpha-dihydroxy-9-oxo-9,11-seco-5 alpha-cholest-7-en-11- al (1) confirmed the structure assignment.

The synthesis of 9 alpha,11 alpha-epoxy-5 alpha-cholest-7-ene-3 beta,5,6 beta-triol (1), a highly oxygenated marine sterol containing a 9,11-epoxide moiety in the nucleus, is described. Epoxy sterol 1 was synthesized from cholesta-5,7-dien-3 beta-ol. Oxidation of this sterol with m-chloroperbenzoic acid followed by hydrolysis and acetylation furnished 5 alpha-cholest-7-ene-3 beta,5,6 alpha-triol 3,6-diacetate (2). Mercuric acetate dehydrogenation of diacetate 2, followed by oxidation with manganese dioxide and epoxidation with m-chloroper-benzoic acid, afforded 9 alpha,11 alpha-epoxy-3 beta,5-dihydroxy-5 alpha-cholest-7-en-6-one (5). Reduction of 5 with lithium aluminum hydride gave the desired compound 1. The structures of all synthetic intermediates were confirmed by 1H and 13C nuclear magnetic resonance (NMR) spectroscopy. A reassignment of resonances for carbons 1, 8, and 15 in the 13C NMR spectrum of 1, based on 2D-NMR correlation spectroscopy, has been accomplished.