Search

Erwinia chrysanthemi causes soft-rot diseases of many plants by secreting a battery of enzymes which degrade the plant cell walls. We initiated a proteomic analysis to create a reference map of the E. chrysanthemi secretome. Extracellular proteins were isolated from E. chrysanthemi culture supernatants and resolved by two-dimensional electrophoresis. By analysis of mutants, Western blotting, and matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) 55 spots representing 25 unique proteins were identified. In uninduced conditions, we identified spots corresponding to the cellulase Cel5, the proteases PrtA, PrtB, and PrtC, the flagellin FliC, and some intracellular proteins whose presence probably resulted from spontaneous cell lysis. We identified another secreted protein, AvrL, homologous to an avirulence protein of Xanthomonas campestris. After culture in conditions inducing pectinase production, i.e., in the presence of galacturonate and plant extract, we identified spots corresponding to the endopectate lyases PelA, PelB, PelC, PelD, PelE, PelI, PelL, and PelZ, the pectin acetylesterases PaeX and PaeY, the pectin methylesterase PemA, and the polygalacturonase PehX. In the presence of other inducing compounds, we detected the rhamnogalacturonate lyase RhiE and the esterase FaeD. Analysis of mutants, altered for one type of secretion system, was performed to determine the targets of each system. The type I system Prt was necessary for the secretion of three proteases. No proteins secreted by the type III Hrp system could be detected in E. chrysanthemi supernatants. In addition to the already known substrates (eleven pectinases and one cellulase), this analysis revealed that the type II Out system mediates secretion of the esterase FaeD and of the Avr-like protein AvrL.

Erwinia chrysanthemi is a host-promiscuous plant pathogen that possesses a type III secretion system (TTSS) similar to that of the host-specific pathogens E. amylovora and Pseudomonas syringae. The regions flanking the TTSS-encoding hrp/hrc gene clusters in the latter pathogens encode various TTSS-secreted proteins. DNA sequencing of the complete E. chrysanthemi hrp/hrc gene cluster and approximately 12 kb of the flanking regions (beyond the previously characterized hecA adhesin gene in the left flank) revealed that the E. chrysanthemi TTSS genes were syntenic and similar (>50% amino-acid identity) with their E. amylovora orthologs. However, the hrp/hrc cluster was interrupted by a cluster of four genes, only one of which, a homolog of lytic transglycosylases, is implicated in TTSS functions. Furthermore, the regions flanking the hrp/hrc cluster lacked genes that were likely to encode TTSS substrates. Instead, some of the genes in these regions predict ABC transporters and methyl-accepting chemotaxis proteins that could have alternative roles in virulence. Mutations affecting all of the genes in the regions flanking or interrupting the hrp/hrc cluster were constructed in E. chrysanthemi CUCPB5047, a mutant whose reduced pectolytic capacity can enhance the phenotype of minor virulence factors. Mutants were screened in witloof chicory leaves and then in potato tubers and Nicotiana clevelandii seedlings. Mu dII1734 insertion in one gene, designated virA, resulted in strongly reduced virulence in all three tests. virA is immediately downstream of hecA, has an unusually low G+C content of 38%, and predicts an unknown protein of 111 amino acids. The E. chrysanthemi TTSS was shown to be active by its ability to translocate AvrPto-Cya (a P. syringae TTSS effector fused to an adenylate cyclase reporter that is active in the presence of eukaryote calmodulin) into N. benthamiana However, VirA(1–61)¯ Cya was not translocated into plant cells, and virA expression was not affected by mutations in E. chrysanthemi Hrp regulator genes hrpL and hrpS. Thus, the 44-kb region of the E. chrysanthemi EC16 genome that is centered on the hrp/hrc cluster encodes a potpourri of virulence factors, but none of these appear to be a TTSS effector.

The "family 9 polysaccharide lyase" pectate lyase L (Pel9A) from Erwinia chrysanthemi comprises a 10-coil parallel beta-helix domain with distinct structural features including an asparagine ladder and aromatic stack at novel positions within the superhelical structure. Pel9A has a single high affinity calcium-binding site strikingly similar to the "primary" calcium-binding site described previously for the family Pel1A pectate lyases, and there is strong evidence for a common second calcium ion that binds between enzyme and substrate in the "Michaelis" complex. Although the primary calcium ion binds substrate in subsite -1, it is the second calcium ion, whose binding site is formed by the coming together of enzyme and substrate, that facilitates abstraction of the C5 proton from the sacharride in subsite +1. The role of the second calcium is to withdraw electrons from the C6 carboxylate of the substrate, thereby acidifying the C5 proton facilitating its abstraction and resulting in an E1cb-like anti-beta-elimination mechanism. The active site geometries and mechanism of Pel1A and Pel9A are closely similar, but the catalytic base is a lysine in the Pel9A enzymes as opposed to an arginine in the Pel1A enzymes.

To understand the function of each peroxidase (POD, EC 1.11.1.7) in terms of biotic stress, changes in POD specific activity and expression of 10 POD genes were investigated in four cultivars of sweetpotato ( Ipomoea batatas ) after infection with Pectobacterium chrysanthemi . POD specific activity (units mg –1 protein) increased from 16 h after inoculation (HAI) in three varieties. POD activities of two cultivars, Shinwhangmi and White Star, reached a maximum level at 24 HAI by about three times compared to mock treatment (MT), and then decreased, whereas those of Zami and Yulmi continuously increased until 36 HAI. Native gel analysis revealed that one POD isoenzyme with a high electrophoretic mobility significantly increased in response to pathogen infection in all cultivars. Additionally, 10 POD genes displayed differential expression patterns upon bacterial infection by northern analysis. Several POD genes such as swpa2, swpa3, swpa4, swpa5, swpb1 were induced upon bacterial infection, but other genes were not. Particularly, swpa4 gene was markedly expressed in response to bacterial infection in four different cultivars, suggesting that this gene has a stress-inducible promoter. These results indicate that some specific POD isoenzymes are involved in defense in relation to pathogenesis of P. chrysanthemi in sweetpotato plants.

The molecular weights of the native polysaccharides of Erwinia chrysanthemi strains range from 1.8 to 7.1 x 10(6) and their hydrodynamic properties are those of polydisperse, polyanionic biopolymers with pseudoplastic, non-thixotropic flow characteristics in aqueous solutions. The effect on the hydrodynamic properties of the polysaccharides by adding carboxyl groups to increase the charge density is studied, with particular reference to their molecular weight (MW), viscosity and conformation. In general, it is found that periodate oxidation of the extracellular polysaccharides of E. chrysanthemi strains, Ech9Sm6 and Ech6S+, introduces little change in the hydrodynamic properties of the resulting polyaldehydes. However, bromine oxidation at neutral pH of the polyaldehydes results in polycarboxylate biopolymers that show significant reduction in MW and viscosity, but they are still characteristic polyanions.

The pectate lyase PelI is involved in the degradation of plant tissues by the phytopathogenic bacterium Erwinia chrysanthemi. It has been crystallized from a solution containing PEG 550 in the space group P2(1), with unit-cell parameters a = 61.6, b = 70.7, c = 73.4 A, beta = 112.8 degrees. Crystals diffract to 1.45 A using synchrotron radiation. SAD phases have been computed from a gold-derivative crystal at the wavelength of maximum absorption (L(III) edge).

TolC is the outer-membrane component of several multidrug resistance (MDR) efflux pumps and plays an important role in the survival and virulence of many gram-negative bacterial animal pathogens. We have identified and characterized the outer-membrane protein-encoding gene tolC in the bacterial plant pathogen Erwinia chrysanthemi EC16. The gene was found to encode a 51-kDa protein with 70% identity to its Escherichia coli homologue. The E. chrysanthemi gene was able to functionally complement the E. coli tolC gene with respect to its role in MDR efflux pumps. A tolC mutant of E. chrysanthemi was found to be extremely sensitive to antimicrobial agents, including several plant-derived chemicals. This mutant was unable to grow in planta and its ability to cause plant tissue maceration was severely compromised. The tolC mutant was shown to be defective in the efflux of berberine, a model antimicrobial plant chemical. These results suggest that by conferring resistance to the antimicrobial compounds produced by plants, the E. chrysanthemi tolC plays an important role in the survival and colonization of the pathogen in plant tissue.

Type II systems allow for the secretion of numerous enzymes and toxins in several Gram-negative pathogens. In Erwinia chrysanthemi, 14 Out proteins are necessary for building the type II apparatus. We performed a systematic two-hybrid analysis to test interactions between the periplasmic regions of the Out proteins. Results obtained using this approach suggested that OutJ (a pseudopilin) was able to interact with (i) OutD, the outer membrane secretin, (ii) OutI, mainly located in the periplasm, and (iii) OutL, an inner membrane protein. Taken together, these results suggest that OutJ is involved in multiple partnerships. Implications of these partnerships in the overall architecture of the type II secretion machinery are discussed.

Erwinia chrysanthemi causes soft-rot diseases of various plants by enzymatic degradation of the pectin in plant cell walls. Pectin is a complex polysaccharide. The main chain is constituted of galacturonate residues, and some of them are modified by methyl and/or acetyl esterification. Esterases are necessary to remove these modifications and, thus, to facilitate the further degradation of the polysaccharidic chain. In addition to PaeY, the first pectin acetylesterase identified in the E . chrysanthemi strain 3937, we showed that this bacterium produces a second pectin acetylesterase encoded by the gene paeX . The paeX open reading frame encodes a 322-residue precursor protein of 34,940 Da, including a 21-amino-acid signal peptide. Analysis of paeX transcription, by using gene fusions, revealed that it is induced by pectic catabolic products and affected by catabolite repression. The expression of paeX is regulated by the repressor KdgR, which controls all the steps of pectin catabolism; by the repressor PecS, which controls most of the pectinase genes; and by catabolite regulatory protein, the global activator of sugar catabolism. The paeX gene is situated in a cluster of genes involved in the catabolism and transport of pectic oligomers. In induced conditions, the two contiguous genes kdgM , encoding an oligogalacturonate-specific porin, and paeX are both transcribed as an operon from a promoter proximal to kdgM , but transcription of paeX can also be uncoupled from that of kdgM in noninduced conditions. PaeX is homologous to the C-terminal domain of the Butyrivibrio fibriosolvens xylanase XynB and to a few bacterial esterases. PaeX contains the typical box (GxSxG) corresponding to the active site of the large family of serine hydrolases. Purified PaeX releases acetate from various synthetic substrates and from sugar beet pectin. The PaeX activity increased after previous depolymerization and demethylation of pectin, indicating that its preferred substrates are nonmethylated oligogalacturonides. PaeX is mostly found in the periplasmic space of E . chrysanthemi . These data suggest that PaeX is mainly involved in the deacetylation of esterified oligogalacturonides that enter the periplasm by the KdgM porin.

A collection of 42 strains belonging to the five subspecies of Pectobacterium carotovorum (subspecies atrosepticum, betavasculorum, carotovorum, odoriferum and wasabiae) and 11 reference and type strains of biovars of Pectobacterium chrysanthemi, Pectobacterium cacticidum and Brenneria paradisiaca were studied by DNA-DNA hybridization, numerical taxonomy of 120 phenotypic characteristics, serology and new phylogenetic analysis of previously reported sequences from a database of aligned 16S rDNA sequences. The P. carotovorum subspecies formed a clade according to neighbour-joining methods, but they formed two paraphyletic clusters according to maximum-likelihood and maximum-parsimony. However, phylogenetic analysis of 16S rDNA sequences alone is not sufficient to justify generic differentiation and therefore, it is proposed to retain the P. carotovorum subspecies in the genus Pectobacterium. The strains of P. carotovorum were distributed in four genomospecies: genomospecies 1, harbouring all strains of subsp. atrosepticum, genomospecies 2, including the strains of subsp. betavasculorum isolated from sugar beet, sunflower, potato, hyacinth and artichoke, genomospecies 3, clustering all strains of subsp. wasabiae isolated from wasabi in Japan, and genomospecies 4, gathering together strains of subsp. carotovorum and strains of subsp. odoriferum. Four strains of P. carotovorum subsp. carotovorum remained unclustered. Biochemical criteria, deduced from a numerical taxonomy study of phenotypic characteristics and serological reactions, allowed discrimination of strains belonging to the four genomospecies. Thus, it is proposed that three genomospecies be elevated to species level as Pectobacterium atrosepticum sp. nov. (type strain CFBP 1526T =LMG 2386T =NCPPB 549T =ICMP 1526T), Pectobacterium betavasculorum sp. nov. (type strain CFBP 2122T =LMG 2464T =NCPPB 2795T =ICMP 4226T) and Pectobacterium wasabiae sp. nov. (type strain CFBP 3304T =LMG 8404T =NCPPB 3701T =ICMP 9121T). Only two subspecies are maintained within P. carotovorum, subsp. carotovorum (type strain CFBP 2046T =LMG 2404T =NCPPB 312T =ICMP 5702T) and subsp. odoriferum (type strain CFBP 1878T =LMG 5863T =NCPPB 3839T = ICMP 11553T), for which discriminating tests are available.

International audience; Two major virulence determinants of the plant-pathogenic enterobacterium Erwinia chrysanthemi strain 3937 are the production of pectate lyase enzymes that degrade plant cell walls and expression of two high-affinity iron uptake systems mediated by two structurally unrelated siderophores, chrysobactin and achromobactin. Low iron availability is a signal that triggers transcription of the genes encoding pectate lyases PelD and PelE as well as that of genes involved in iron transport. This metalloregulation is mediated by the transcriptional repressor Fur. In this study, we analyzed the molecular mechanisms of this control. We purified the Erwinia chrysanthemi Fur protein. Band shift assays showed that Fur specifically binds in vitro to the regulatory regions of the genes encoding the ferrichrysobactin outer membrane receptor Fct and the pectate lyases PelD and PelE. We identified the Fur-binding sites of these promoter regions by performing DNase I footprinting experiments. From these data, we propose that Fur could inhibit the activation of the pelD and pelE genes by the cAMP receptor protein CRP according to an anti-activation mechanism. To identify other possible effectors involved in this control, we screened a bank of insertion mutants for an increase in transcriptional activity of pelD and fct genes in response to iron limitation. We isolated a mutant affected in the kdgK gene encoding the 2-keto-3-deoxygluconate (KDG) kinase, an enzyme involved in pectin catabolism. The growth of this mutant in the presence of pectic compounds led to a constitutive expression of iron transport genes as well as complete derepression of the pectinolysis genes. This effect was caused by intracellular accumulation of KDG. However, the derepression of iron transport genes by KDG does not involve the KdgR regulator of pectinolysis genes, which uses KDG as inducer. Thus, in Erwinia chrysanthemi, iron depletion or presence of KDG induces transcription of the genes involved in iron assimilation and pectinolysis. These important pathogenicity functions are coregulated by responding to common signals encountered in planta.

Microarray technology was used to identify genes in Erwinia chrysanthemi 3937 that are specifically up- or down-regulated in a plant host compared with growth in laboratory culture medium. Several genes were plant down-regulated, and almost all of them were homologues of well-known housekeeping genes, such as those encoding metabolic functions, oxidative phosphorylation components, and transcription or translation processes. On the other hand, almost all of the plant up-regulated genes were involved with specialized functions, including already known or new putative virulence factors, anaerobiosis, iron uptake, transporters or permeases, xenobiotic resistance, chemotaxis, and stress responses to reactive oxygen species and heat. A substantial number of the plant up-regulated genes do not appear to be directly involved in damaging the host, but are probably important in adapting the pathogen to the host environment. We constructed insertion mutations in several of the plant up-regulated E. chrysanthemi 3937 genes. Among these, mutations of Bacillus subtilis pps1, Escherichia coli purU, and Pseudomonas aeruginosa pheC homologues reduced virulence on African violet leaves. Thus, new insights were obtained into genes important in bacterial virulence.

Erwinia chrysanthemi 3937 secretes an arsenal of pectinolytic enzymes, including at least eight endo-pectate lyases encoded by pel genes, which play a major role in the soft-rot disease caused by this bacterium on various plants. E. chrysanthemi also produces some hydrolases that cleave pectin. Three adjacent hydrolase genes, pehV , pehW , and pehX, encoding exo-poly-α- d -galacturonosidases, have been characterized. These enzymes liberate digalacturonides from the nonreducing end of pectin. We report the identification of a novel gene, named pehN, encoding a protein homologous to the glycosyl hydrolases of family 28, which includes mainly polygalacturonases. PehN has a low hydrolase activity on polygalacturonate and on various pectins. PehN action favors the activity of the secreted endo-pectate lyases, mainly PelB and PelC, and that of the periplasmic exo-pectate lyase PelX. However, removal of the pehN gene does not significantly alter the virulence of E. chrysanthemi . Regulation of pehN transcription was analyzed by using gene fusions. Like other pectinase genes, pehN transcription is dependent on several environmental conditions. It is induced by pectic catabolic products and is affected by growth phase, catabolite repression, osmolarity, anaerobiosis, nitrogen starvation, and the presence of calcium ions. The transcription of pehN is modulated by the repressor KdgR, which controls almost all the steps of pectin catabolism, and by cyclic AMP receptor protein (CRP), the global activator of sugar catabolism. The regulator PecS, which represses the transcription of the pel genes but activates that of pehV , pehW , and pehX , also activates transcription of pehN . The three regulators KdgR, PecS, and CRP act by direct interaction with the pehN promoter region. The sequences involved in the binding of these three regulators and of RNA polymerase have been precisely defined. Analysis of the simultaneous binding of these proteins indicates that CRP and RNA polymerase bind cooperatively and that the binding of KdgR could prevent pehN transcription. In contrast, the activator effect of PecS is not linked to competition with KdgR or to cooperation with CRP or RNA polymerase. This effect probably results from competition between PecS and an unidentified repressor involved in peh regulation.

The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera , E. carotovora subsp. betavasculorum , E. carotovora subsp. atroseptica , and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

The phytopathogenic bacterium Pectobacteium chrysanthemi PY35 secretes Cel5Z endoglucanase belonging to the glycoside hydrolase family 5 of EC 3.2.1.4. The mutation of cel5Z::Omega gene was constructed by cloning the 2.0-kb SmaI fragment containing the streptomycin/spectinomycin-resistance gene of pHP45(Omega) into the BalI site of pPY100. The insertion of Omega fragment generated a new stop codon, removing the Ser/Thr-rich linker region and the cellulose binding domain (CBD) in the C-terminal region of cel5Z gene. By subsequent subcloning from this 4.9-kb fragment (pPY1001), a 1.0-kb (pPY1002) fragment was obtained and designated as cel5Z::Omega. The cel5Z::Omega gene had an open reading frame (ORF) of 1011 bp, encoding 336 amino acids, starting with an ATG codon and ending with a new TGA stop codon. The molecular mass of the Cel5Z::Omega protein in E. coli transformant appeared to be 32 kDa by SDS-PAGE analysis in the presence of carboxymethyl-cellulose (CMC). The Cel5Z::Omega protein hydrolyzed CMC with 1.7-fold higher activity than the intact Cel5Z cellulase.

In the plant-pathogenic bacterium Erwinia chrysanthemi production of pectate lyases, the main virulence determinant, is modulated by a complex network involving several regulatory proteins. One of these regulators, PecS, also controls the synthesis of a blue pigment identified as indigoidine. Since production of this pigment is cryptic in the wild-type strain, E. chrysanthemi ind mutants deficient in indigoidine synthesis were isolated by screening a library of Tn 5 -B21 insertions in a pecS mutant. These ind mutations were localized close to the regulatory pecS-pecM locus, immediately downstream of pecM . Sequence analysis of this DNA region revealed three open reading frames, indA , indB , and indC , involved in indigoidine biosynthesis. No specific function could be assigned to IndA. In contrast, IndB displays similarity to various phosphatases involved in antibiotic synthesis and IndC reveals significant homology with many nonribosomal peptide synthetases (NRPS). The IndC product contains an adenylation domain showing the signature sequence DAWCFGLI for glutamine recognition and an oxidation domain similar to that found in various thiazole-forming NRPS. These data suggest that glutamine is the precursor of indigoidine. We assume that indigoidine results from the condensation of two glutamine molecules that have been previously cyclized by intramolecular amide bond formation and then dehydrogenated. Expression of ind genes is strongly derepressed in the pecS background, indicating that PecS is the main regulator of this secondary metabolite synthesis. DNA band shift assays support a model whereby the PecS protein represses indA and indC expression by binding to indA and indC promoter regions. The regulatory link, via pecS , between indigoidine and virulence factor production led us to explore a potential role of indigoidine in E. chrysanthemi pathogenicity. Mutants impaired in indigoidine production were unable to cause systemic invasion of potted Saintpaulia ionantha . Moreover, indigoidine production conferred an increased resistance to oxidative stress, indicating that indigoidine may protect the bacteria against the reactive oxygen species generated during the plant defense response.

Uptake of [14C]galacturonic acid in Erwinia chrysanthemi was found to be stimulated during growth on pectin and its degradation products, saturated digalacturonic acid and galacturonic acid. Cells isolated from macerated potato tissue also showed increased levels of uptake activity for this molecule compared with those showed by glycerol-grown cells. Uptake was found to be an active process, and it displayed saturation kinetics. An Escherichia coli galacturonic acid transport mutant harboring the E. chrysanthemi exuT gene(s) for galacturonic acid uptake was able to transport galacturonic acid but unable to take up the dimer [3H]digalacturonic acid.

Pectate lyase A is a virulence factor secreted by the plant-pathogenic bacteria Erwinia chrysanthemi. The enzyme cleaves the glycosidic bond of pectate polymers by a calcium-dependent [beta]-elimination mechanism. The crystal structure of pectate lyase A from E. chrysanthemi EC16 has been determined in two crystal forms, monoclinic C2 to 1.8 Å and rhombohedral R3 to 2.1 Å. The protein structure is compared with two other pectate lyase isoforms from E. chrysanthemi EC16, pectate lyase C and pectate lyase E. Pectate lyase A is unique as it is the only acidic pectate lyase and has end products that are significantly more varied in length in comparison to those of the other four major pectate lyase isozymes. Differences and similarities in polypeptide trace, size and volume of the active-site groove and surface electrostatics are discussed.

Erwinia chrysanthemi exports degradative enzymes by using a type I protein secretion system. The proteases secreted by this system lack an N-terminal signal peptide but contain a C-terminal secretion signal. To explore the substrate specificity of this system, we have expressed the E. chrysanthemi transporter system ( prtDEF genes) in Escherichia coli and tested the ability of this ABC transporter to export hybrid proteins carrying C-terminal fragments of E. chrysanthemi protease B. The C terminus contains six glycine-rich repeated motifs, followed by two repeats of the sequences DFLV and DIIV. Two types of hybrid proteins were assayed for transport, proteins with the 93-residue-protease-B C terminus containing one glycine-rich repeat and both hydrophobic terminal repeats and proteins with the 181-residue C terminus containing all repeat motifs. Although the shorter C terminus is unable to export the hybrids, the longer C terminus can promote the secretion of hybrid proteins with N termini as large as 424 amino acids, showing that the glycine-rich motifs are required for the efficient secretion of these hybrids. However, the secretion of hybrids occurs only if these proteins do not carry disulfide bonds in their mature structures. These latter results suggest that disulfide bond formation can occur prior to or during the secretion. Disulfide bonds may prevent type I secretion of hybrids. One simple hypothesis to explain these results is that the type I channel is too narrow to permit the export of proteins with secondary structures stabilized by disulfide bonds.

Erwinia chrysanthemi produces a battery of hydrolases and lyases which are very effective in the maceration of plant cell walls. Although two endoglucanases (CelZ and CelY; formerly EGZ and EGY) are produced, CelZ represents approximately 95% of the total carboxymethyl cellulase activity. In this study, we have examined the effectiveness of CelY and CelZ alone and of combinations of both enzymes using carboxymethyl cellulose (CMC) and amorphous cellulose (acid-swollen cellulose) as substrates. Synergy was observed with both substrates. Maximal synergy (1.8-fold) was observed for combinations containing primarily CelZ; the ratio of enzyme activities produced was similar to those produced by cultures of E. chrysanthemi . CelY and CelZ were quite different in substrate preference. CelY was unable to hydrolyze soluble cellooligosaccharides (cellotetraose and cellopentaose) but hydrolyzed CMC to fragments averaging 10.7 glucosyl units. In contrast, CelZ readily hydrolyzed cellotetraose, cellopentaose, and amorphous cellulose to produce cellobiose and cellotriose as dominant products. CelZ hydrolyzed CMC to fragments averaging 3.6 glucosyl units. In combination, CelZ and CelY hydrolyzed CMC to products averaging 2.3 glucosyl units. Synergy did not require the simultaneous presence of both enzymes. Enzymatic modification of the substrate by CelY increased the rate and extent of hydrolysis by CelZ. Full synergy was retained by the sequential hydrolysis of CMC, provided CelY was used as the first enzyme. A general mechanism is proposed to explain the synergy between these two enzymes based primarily on differences in substrate preference.

The phytopathogenic bacterium Erwinia chrysanthemi produces five major pectate lyases that are key virulence factors in soft-rot disease development. Using transcriptional fusions, we studied the regulation of pelA, pelD, and pelE gene expression as a function of variation of the external pH. pelA and pelD were expressed when bacteria were grown in an acidic medium while pelE was transcribed only in basic medium. Using phenol red, we observed that, in chicory leaves, pH value of infected tissue varies from acidic to basic. Taken together, these findings are discussed in the context of a model unifying both catalysis and regulation to account for pel gene evolution. In particular, we propose that the three isoenzymes are produced sequentially during the infection process.

A pectate lyase (Pel; pectate transeliminase: EC4.2.2.2.), designated Pel-15H, was found in an alkaline culture of Bacillus sp. strain KSM-P15 and purified to homogeneity by sequential column chromatographies. The molecular weight of the enzyme determined by SDS-polyacrylamide gel electrophoresis was approximately 70,000 and the pI was around pH 4.6. Pel-15H randomly trans-eliminated polygalacturonate in the presence of Ca2+ ions, and the maximum activity was observed at pH 11.5 and at 55 degrees C in glycine-NaOH buffer. The gene for Pel-15H was cloned and sequenced, and the structural gene contained a 2,031-bp open reading frame that encoded 677 amino acids including a possible 28-amino-acid signal sequence. The mature enzyme (649 amino acids, molecular weight 69,550) showed very low similarity to Pels from Bacillus with 12.7-18.2% identity. Interestingly, part of the amino acid sequence of Pel-15H had fairly high similarity only to an N-terminal half of PelL and a C-terminal half of PeIX from Erwinia chrysanthemi 3937, and a C-terminal half of PeIX from E. chrysanthemi EC16 (approximately 35% identity for all).

The expression, in Escherichia coli , of variants of the Erwinia chrysanthemi secretion genes outB and outS under the P tac promoter is toxic to the cells. During attempts to clone E. chrysanthemi genes able to suppress this toxicity, I identified two genes, sotA and sotB , whose products are able to reduce the isopropyl-β- d -thiogalactopyranoside (IPTG) induction of the E. coli lac promoter. SotA and SotB belong to two different families of the major facilitator superfamily. SotA is a member of the sugar efflux transporter family, while SotB belongs to the multidrug efflux family. The results presented here suggest that SotA and SotB are sugar efflux pumps. SotA reduces the intracellular concentration of IPTG, lactose, and arabinose. SotB reduces the concentration of IPTG, lactose, and melibiose. Expression of sotA and sotB is not regulated by their substrates, but sotA is activated by the cyclic AMP receptor protein (CRP), while sotB is repressed by CRP. Lactose is weakly toxic for E. chrysanthemi . This toxicity is increased in a sotB mutant which cannot efficiently efflux lactose. This first evidence for a physiological role of sugar efflux proteins suggests that their function could be to reduce the intracellular concentration of toxic sugars or sugar metabolites.

Under iron-depleted conditions, bacteria produce siderophores that bind iron and are then actively taken up by the cell. New structural and biochemical insights are reported for the synthetic pathway of achromobactin, a siderophore from the plant pathogen Pectobacterium chrysanthemi.

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases which attack pectin, the major constituent of the plant cell wall. Of these enzymes, the alkaline isoenzyme named PelD in strain 3937 and PelE in strain EC16 has been described as being particularly important, based on virulence studies of plants. Expression of the pelD and pelE genes is tightly modulated by various regulators, including the KdgR repressor and the cyclic AMP-cyclic AMP receptor protein (CRP) activator complex. The use of a lacZ reporter gene allowed us to quantify the repression of E. chrysanthemi 3937 pelD expression exerted by PecS, another repressor of pectinase synthesis. In vitro DNA-protein interaction experiments, centered on the pelD and pelE wild-type or pelE mutated promoter regions, allowed us to define precisely the sequences involved in the binding of these three regulators and of RNA polymerase (RNAP). These studies revealed an unusual binding of the KdgR repressor and suggested the presence of a UP (upstream) element in the pelD and pelE genes. Investigation of the simultaneous binding of CRP, KdgR, PecS, and the RNAP to the regulatory region of the pelD and pelE genes showed that (i) CRP and RNAP bind cooperatively, (ii) PecS partially inhibits binding of the CRP activator and of the CRP-RNAP complex, and (iii) KdgR stabilizes the binding of PecS and prevents transcriptional initiation by RNAP. Taken together, our data suggest that PecS attenuates pelD and pelE expression rather than acting as a true repressor like KdgR. Overall, control of the pelD and pelE genes of E. chrysanthemi appears to be both complex and novel.

Erwinia chrysanthemi are gram-negative bacterial phytopathogens causing soft rots in a number of plants. The structure of the extracellular polysaccharide (EPS) produced by E. chrysanthemi strain CU643, pathogenic to Philodendron, has been determined using a combination of chemical and physical techniques including methylation analysis, high- and low-pressure gel-filtration and anion-exchange chromatography, high-pH anion-exchange chromatography, partial acid hydrolysis, mass spectrometry, and 1- and 2-D NMR spectroscopy. In contrast to the structures of the EPS reported for other strains of E. chrysanthemi, the EPS from strain CU643 is a linear polysaccharide containing L-Rhap, D-Galp, and D-GlcAp in the ratio 4:1:1. Evidence is presented for the following hexasaccharide repeat unit: -->3)-beta-D-Galp-(1-->2)-alpha-L-Rhap-(1-->4)-beta-D-GlcAp- (1-->2)-alpha-L- Rhap-(1-->2)-alpha-L-Rhap-(1-->2)-alpha-L-Rhap-(1-->(1 ).

Peptide methionine sulfoxide reductase (MsrA), which repairs oxidized proteins, is present in most living organisms, and the cognate structural gene belongs to the so-called minimum gene set [Mushegian, A. R. & Koonin, E. V., (1996) Proc. Natl. Acad. Sci. USA 93, 10268–10273]. In this work, we report that MsrA is required for full virulence of the plant pathogen Erwinia chrysanthemi . The following differences were observed between the wild-type and a MsrA − mutant: ( i ) the MsrA − mutant was more sensitive to oxidative stress; ( ii ) the MsrA − mutant was less motile on solid surface; ( iii ) the MsrA − mutant exhibited reduced virulence on chicory leaves; and ( iv ) no systemic invasion was observed when the MsrA − mutant was inoculated into whole Saintpaulia ionantha plants. These results suggest that plants respond to virulent pathogens by producing active oxygen species, and that enzymes repairing oxidative damage allow virulent pathogens to survive the host environment, thereby supporting the theory that active oxygen species play a key role in plant defense.

PeIL, a pectate lyase (E.C. 4.2.2.9) from E. chrysanthemi 3937 that is not homologous to the lyases with known structures, has been purified and crystallized by the hanging-drop method using a variety of organic solvents as precipitant. Elongated lathes grown from poly(ethylene glycol) plus isopropanol belong to the space group P212121 with cell dimensions a = 55.5, b = 58.2, c = 16.4 Å with a single molecule in the asymmetric unit. Although complete data sets have been collected to 2.3 Å resolution, these crystals diffract to at least 1.9 Å resolution and are suitable for structure determination. Chunky plates grown using other organic solvents as the precipitant diffracted to 3 Å resolution and were partially characterized as a second orthorhombic crystal form with space group P21212 and cell dimensions a = 119.1, b = 140.5 and c = 105.4 Å, suggesting four molecules in the asymmetric unit.

The main determinant of the plant pathogen Erwinia chrysanthemi virulence is the production of extracellular enzymes, mainly pectate lyases. Adjacent to a pectate lyase encoding locus, we identified the gene rotA supposed to encode a folding catalyst. Overproduction of the protein and assay of activity using a synthetic substrate, confirmed that rotA encodes a periplasmic peptidyl-prolyl cis-trans isomerase. rotA disruption provokes no change in cell morphology, cell viability, growth rate or stability of the extracellular and periplasmic proteins. In addition, this mutation does not alter the activity of the pectate lyases, their stability in the periplasm during the transitory step of secretion or their recognition by the Out secretory system. rotA expression was followed using a rotA::uidA transcriptional fusion. Some environmental conditions, such as temperature variations and nitrogen starvation, modulate rotA expression. In contrast to the E. coli rotA gene, the E. chrysanthemi rotA possesses only one promoter and is not controlled by the CRP global regulator.

The pecS regulatory locus is responsible for the down-expression of many virulence genes in Erwinia chrysanthemi. This locus consists of two genes, pecS and pecM, divergently transcribed. Genetic evidence indicates that the PecM protein modulates the regulatory activity of PecS. Purification and characterization of PecS, expressed either from E. coli, from the wild-type E. chrysanthemi strain or from a pecM mutant, showed that the PecS protein produced in these three genetic backgrounds displays the same biochemical properties. Band-shift assay analysis with the three PecS isoforms confirmed the involvement of the PecM protein in modulating the PecS DNA-binding capacity. Moreover, determination of the Kdapp for operator regions of the PecS protein, produced either by the wild-type E. chrysanthemi or by E. coli, reveals similar affinities. Thus, in E. coli, there is likely to be at least one other PecM-like protein able to cross-react with the E. chrysanthemi PecS protein.

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi are pectinases that cleave pectin, a major constituent of the plant cell wall. Although physiological studies suggested that pectinase production in Erwinia species is subjected to catabolite repression, the direct implication of the cyclic AMP receptor protein (CRP) in this regulation has never been demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation and then constructed E. chrysanthemi crp mutants by reverse genetics. The carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is similar to that of an E. coli crp mutant. Furthermore, these mutants are unable to grow on pectin or polygalacturonate as the sole carbon source. Analysis of the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of a 630-bp open reading frame (ORF) that codes for a protein highly similar to the CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that the E. chrysanthemi CRP represses its own expression, probably via a mechanism similar to that described for the E. coli crp gene. Moreover, in the E. chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD, and pelE) and of genes of the intracellular part of the pectin degradation pathway (ogl, kduI, and kdgT), which are important for inducer formation and transport, is dramatically reduced in induced conditions. In contrast, expression of pelA, which encodes a pectate lyase important for E. chrysanthemi pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp mutants have greatly decreased maceration capacity in potato tubers, chicory leaves, and celery petioles as well as highly diminished virulence on saintpaulia plants. These findings demonstrate that CRP plays a crucial role in expression of the pectinolysis genes and in the pathogenicity of E. chrysanthemi.

The phytopathogenic enterobacterium Erwinia chrysanthemi 3937 produces five major and several secondary endo-pectate lyases encoded by the pel genes. Most of these genes are arranged in clusters on the bacterial chromosome. The genomic region surrounding the pelB-pelC cluster was supposed to be involved in the regulation of PelB and PelC synthesis. We demonstrated that the variation of pelB expression resulted from the titration of a regulatory protein by the gene adjacent to pelC. This gene was renamed pelZ since it encodes a protein of 420 amino acids with an endo-pectate lyase activity. Regulation of pelZ expression was investigated by using transcriptional fusions and a study of mRNA synthesis. Its transcription depends on different environmental conditions. It is induced in planta and in the presence of pectic catabolite products. This induction seems to be partially mediated by the KdgR protein but does not result from a direct interaction of KdgR with the pelZ 5' region. The transcription of pelZ leads to the synthesis of a monocistronic mRNA. However, the synthesis of a polycistronic mRNA from the pelC promoter, regulated by KdgR, is responsible for increased production of PelZ under inducing conditions. pelZ transcription is also controlled by pecT, which regulates some other pel genes, but it is independent of the pecS regulatory locus. The pelZ gene appears to be widespread in different strains of E. chrysanthemi. Moreover, a gene homologous to pelZ exists in Erwinia carotovora subsp. atroseptica adjacent to the cluster containing the pectate lyase-encoding genes pel1, pel2, and pel3. This conservation could reflect a significant role of PelZ in the pectinolytic system of Erwiniae. We showed pelZ is not a predominant virulence factor of E. chrysanthemi but is involved in host specificity.

Erwinia chrysanthemi is an enterobacterium that causes various plant diseases. Its pathogenicity results from the secretion of pectinolytic enzymes responsible for the disorganization of the plant cell wall. The E. chrysanthemi strain 3937 produces two pectin methylesterases, at least seven pectate lyases, a polygalacturonase, and a pectin lyase. The extracellular degradation of the pectin leads to the formation of oligogalacturonides that are catabolized through an intracellular pathway. The pectinase genes are expressed from independent cistrons, and their transcription is favored by environmental conditions such as presence of pectin and plant extracts, stationary growth phase, low temperature, oxygen or iron limitation, and so on. Moreover, transcription of the pectin lyase gene responds to DNA-damaging agents. The differential expressions of individual pectinase genes presumably reflect their role during plant infection. The regulation of pel genes requires several regulatory systems, including the KdgR repressor, which mediates the induction of all the pectinolysis genes in the presence of pectin catabolites. KdgR also controls the genes necessary for pectinase secretion and other pectin-inducible genes not yet characterized. PecS, a cytoplasmic protein homologous to other transcriptional regulators, can bind in vitro to the regulatory regions of pectinase and cellulase genes. The PecT protein, a member of the LysR family of transcriptional regulators, represses the expression of some pectinase genes and also affects other metabolic pathways of the bacteria. Other proteins involved in global regulations, such as CRP or HNS, can bind to the regulatory regions of the pectinase genes and affect their transcription.

International audience; Growth of Erwinia chrysanthemi in media of elevated osmolarity can be achieved by the uptake and accumulation of various osmoprotectants. This study deals with the cloning and sequencing of the ousA gene-encoded osmoprotectant uptake system A from E. chrysanthemi 3937. OusA belongs to the superfamily of solute ion cotransporters. This osmotically inducible system allows the uptake of glycine betaine, proline, ectoine, and pipecolic acid and presents strong similarities in nucleotide sequence and protein function with the proline/betaine porter of Escherichia coli encoded by proP. The control of ousA expression is clearly different from that of proP. It is induced by osmotic strength and repressed by osmoprotectants. Its expression in E. coli is controlled by H-NS and is rpoS dependent in the exponential phase but unaffected by the stationary phase.

The pathways of pectin and galacturonate catabolism in Erwinia chrysanthemi converge to form a common intermediate, 2-keto-3-deoxygluconate (KDG), which is phosphorylated by KDG kinase encoded by the kdgK gene. We cloned the kdgK gene of E. chrysanthemi 3937 by complementing an Escherichia coli kdgK mutation, using an RP4-derivative plasmid. One of the kdgK R-prime plasmids harbored a DNA insert of about 80 kb and carried the uxuA and uxuB genes involved in glucuronate catabolism and the celY gene coding for an E. chrysanthemi cellulase. The kdgK and celY genes were precisely located on this plasmid, and their respective transcriptional directions were determined. The nucleotide sequence of the kdgK region indicated that the kdgK reading frame is 981 bases long, corresponding to a protein of 329 amino acids with a molecular mass of 36,377 Da. Analysis of the deduced primary amino acid sequence showed that this enzyme is a new member of the PfkB family of carbohydrate kinases. Expression of kdgK is controlled by a negative regulatory gene, kdgR, which represses all the steps of pectin degradation. Near the putative promoter of the kdgK gene, we identified a putative KdgR-binding site and demonstrated that the KdgR protein specifically binds in vitro to this DNA region. The KdgR-KDG couple directly mediates the phenomenon of repression or induction. The KDG kinase, by limiting the intracellular inducer concentration, appears to be a key enzyme in induction of the whole catabolic pathway.

Summary Erwinia chrysanthemi mutants (designated as pecS) displaying derepressed pectate lyase and cellulose synthesis were isolated. In addition, the pecS mutation is responsible for production of an extracellular insoluble blue pigment whose synthesis is cryptic in the wild-type 3937 strain. Transduction analysis indicates that the phenotype is due to a single mutation located near the xyl marker on the strain 3937 chromosome. This mutation was complemented by an R-prime plasmid carrying the xyl and argG genes of E. chrysanthemi, suggesting that the pecS product acts in trans to modulate pectinase, cellulase and blue pigment production. Insertion mutagenesis of the cloned region and recombination of the corresponding mutations in the bacterial chromosome by marker exchange revealed the existence of two divergently transcribed genes, pecS and pecM, that are both involved in the pectate lyase and cellulase regulation. The nucleotide sequences of pecS and pecM were determined. The pecS gene encodes a 166 amino acid polypeptide that shows similarity to the MprA regulatory protein of Escherichia coli whereas the pecM gene encodes a 297 amino acid polypeptide that was shown to be an integral membrane protein. The possible functions of the PecS and PecM proteins derived from the mutant phenotype and sequence analysis are discussed in terms of signal transduction and transcription regulation.

Two Erwinia chrysanthemi homologues of the himA and himD genes of Escherichia coli which encode the integration host factor (IHF) were cloned, sequenced and compared to their homolog in other enterobacteria (EMBL accession nos X74749 and X74750). Both genes were inactivated by the insertion of an antibiotic resistance cassette, allowing for the isolation of IHF- mutants of E chrysanthemi.

The role of endoglucanases (endoglucanases Z and Y) in Erwinia chrysanthemi pathogenicity on Saintpaulia ionantha was assessed by mutagenizing cloned cel genes (celZ and celY) and recombining them with the chromosomal alleles. Strains with an omega interposon in celZ, a deletion in celY, or a double cel mutant were as virulent as the wild-type strain. However, in the strain with a deletion in celY, a delay in the appearance of symptoms was observed, and then maceration progressed as in plants infected with the wild-type strain, suggesting that E. chrysanthemi endoglucanases play a minor role in soft rot disease development.

In spring 2009 and 2010 significant bacterial disease symptoms were observed in potato ( Solanum tuberosum cv.Spunta) crops in the Messara plain of Crete in Greece. Affected plants had blackleg and rotting symptoms on stem base, brown…

Oncidium orchids have been subjected to extensive cultivation in the pot-plant and cut flower industries because of their attractive and numerous flowers. In August 2008, approximately 50 Oncidium ‘Gower Ramsey’ orchids were discovered at a commercial orchid nursery in South Florida with brown, macerated leaves typical of soft rot disease reported in other orchids. Ten plants were selected, and sections were removed from the edge of symptomatic tissue and bacteria were isolated according to the method described by Schaad et al. (3). All isolates were gram negative, anaerobic, degraded pectate, grew at 37°C, produced blue-to-brown pigment on nutrient agar-glycerol-manganese chloride (NGM) medium (1), were sensitive to erythromycin, oxidase negative, and positive for phosphatase and indole production. Further analyses were performed on four of the isolates. MIDI analysis (Sherlock version TSBA 4.10; Microbial Identification, Newark, DE) identified the isolates as Erwinia chrysanthemi (SIM 0.880 to 0.929). Polymerase chain reactions were performed with the 16S primers 27f and 1495r (4) and 1,423 bp of the 16S rDNA gene showed 98 to 99% sequence identity to Pectobacterium chrysanthemi (GenBank Accession No. FM946179). Sequences were deposited in GenBank (Nos. HQ287572–HQ287575). Pathogenicity tests were performed by injecting 10 Oncidium ‘Gower Ramsey’ orchids with 100 μl of a bacterial suspension at 1 × 108 CFU/ml. Ten plants were inoculated with 100 μl of sterile water as controls. Plants were placed in a greenhouse at 26.0°C to 30.0°C and 50 to 83% relative humidity. Soft rot symptoms were observed on all inoculated plants within 24 h while control plants appeared normal. A Dickeya sp. was reisolated and identified according to the method described above. Oncidium orchids are known to be highly susceptible to P. carotovora (= E. carotovora) and soft rot caused by P. carotovora is known to occur frequently on Oncidium orchids (2). Although, an Erwinia sp. has been reported to cause soft rot symptoms on Oncidium aureum, to our knowledge, this is the first report of a Dickeya sp. (= P. chrysanthemi) causing soft rot symptoms on Oncidium orchids grown in large-scale commercial production in the United States. References: (1) Y. A. Lee and C. P. Yu. J. Microbiol. Methods 64:200, 2006. (2) C. H. Liau et al. Transgenic Res. 12:329, 2003. (3) N. W. Schaad et al. Erwinia soft rot group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (4) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Sweet corn ( Zea mays ) is one of the most important crops in Korea. In Goesan District, Korea in 2007 it was cultivated on 1,178.7 ha and produced 9,725 tonnes (http://www.goesan.go.kr). Bacterial stalk rot of sweet corn (cv. Daehak) was…

Banana is one of the most important fruit crops grown in China (2). A severe outbreak of a soft rot of banana occurred in Guangzhou, China from 2009 to 2010. The disease was characterized by an odorous soft rot of the center of the rhizome. The rot progressed up the pseudostem, destroying the growing point and causing internal decay and often accompanied by vascular discoloration. Yellowing and wilting of the leaves were also characteristic symptoms. A survey of three areas of production of Musa sapientum (cv. ABB) covering 10 ha in Guangzhou revealed that 82% of the fields were affected at an incidence ranging from 20 to 40%. Forty-five bacterial isolates were obtained from lesions on plants sampled from these fields by surface-sterilizing symptomatic tissue in 0.3% NaOCl for 10 min, rinsing the tissue sections three times in sterile water, and plating the sections on nutrient agar. Three representative isolates selected randomly were all gram negative, caused a soft rot of potato disks, utilized malonate, tested positive for phosphatase production, and tested negative for acid production from palatinose, glucopyranoside, and trehalose. A Biolog similarity index of 0.803 indicated that the three isolates had a high similarity to the Biolog reference strain of Pectobacterium chrysanthemi (Version 4.2, Biolog Inc., Hayward, CA). The 16S rDNA sequence (GenBank Accession No. 1321085) of each of the three isolates was determined (1). When compared with sequences in GenBank, the highest degree of sequence similarity was with P. chrysanthemi AF373199. On the basis of a phylogenetic tree of the sequences, the three bacterial isolates are related to Pectobacterium (100% bootstrap values). On the basis of two diagnostic methods, the three isolates were identified as P. chrysanthemi. However, according to Samson et al. (3), they are a Dickeya sp. Additional genetic comparisons with type strains will be needed for the strains to be assigned to a known species of Dickeya. Pathogenicity of each of the three strains on M. sapientum (cv. ABB) was confirmed by injecting 60 40-day-old seedlings each with 5 ml of a suspension of the isolate (108 CFU/ml) into the rhizome. Sixty plants of the same cultivar injected with sterile water served as the control treatment. After 48 h, yellowing and wilting of the leaves, similar to symptoms observed on field plants, were observed on all inoculated seedlings for each of the three bacterial strains. There were no symptoms on the control plants. Koch's postulates were fulfilled by reisolating bacteria from lesions on the leaves of inoculated seedlings. The reisolates were identical to the inoculated strains in biochemical characteristics. Bacteria characteristic of the inoculated strains were not reisolated from the control plants. To our knowledge, this is the first report of a Dickeya sp. causing soft rot of banana in mainland China. References: (1) W. S. Kaneshiro et al. Plant Dis. 92:1444, 2008. (2) Y. P. Ke et al. China Trop. Agric. 1:14, 2008. (3) R. Samson et al. Evol. Microbiol. 55:1415, 2005.

To depolymerize plant pectin, the phytopathogenic enterobacterium Erwinia chrysanthemi produces a series of enzymes which include a pectin-methyl-esterase encoded by the pem gene and five isoenzymes of pectate lyases encoded by the five genes pelA, pelB, pelC, pelD, and pelE. We have constructed transcriptional fusions between the pectinase gene promoters and the uidA gene, encoding beta-glucuronidase, to study the regulation of these E. chrysanthemi pectinase genes individually. The transcription of the pectinase genes is dependent on many environmental conditions. All the fusions were induced by pectic catabolic products and responded, to different degrees, to growth phase, catabolite repression, temperature, and nitrogen starvation. Transcription of pelA, pelD, and pelE was also increased in anaerobic growth conditions. High osmolarity of the culture medium increased expression of pelE but decreased that of pelD; the other pectinase genes were not affected. The level of expression of each gene was different. Transcription of pelA was very low under all growth conditions. The expression of the pelB, pelC, and pem genes was intermediate. The pelE gene had a high basal level of expression. Expression of pelD was generally the most affected by changes in culture conditions and showed a low basal level but very high induced levels. These differences in the expression of the pectinase genes of E. chrysanthemi 3937 presumably reflect their role during infection of plants, because the degradation of pectic polymers of the plant cell walls is the main determinant of tissue maceration caused by soft rot erwiniae.

Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.

Endoglucanase Z from the phytopathogenic bacterium Erwinia chrysanthemi (strain 3937) was purified by affinity chromatography on microcrystalline cellulose Avicel PH101. A kinetic characterization using p-nitrophenyl beta-D-cellobioside and p-nitrophenyl beta-D-lactosde as substrates was conducted: endoglucanase Z exhibited Km values of 3 mM and 7.5 mM and Vm values of 129 and 40 nmol.min-1.mg-1 towards p-nitrophenyl beta-D-cellobioside (kcat = 0.1 s-1) and p-nitrophenyl beta-D-lactoside (kcat = 0.03 s-1), respectively). The hydrolysis of cellotetraitol by endoglucanase Z was followed by HPLC and 1H NMR. Results show that cellobiitol and beta-cellobiose are initially formed, demonstrating that the enzyme is acting by a molecular mechanism retaining the anomeric configuration. This suggests the involvement of a glycosyl-enzyme intermediate.

In December 2007, stem rot symptoms on orchids (Oncidium Gower Ramsey) were observed at a flower nursery in the Zhejiang Province of China. Initial symptoms were water-soaked lesions starting at the base of the stem. As these lesions expanded and elongated, the stem and leaf tissues became soft and watery. When examined with a microscope, cut edges of symptomatic stem and leaf tissues consistently exhibited bacterial streaming. The bacteria were isolated by streaking on nutrient agar (3). All isolates were gram-negative, facultative, anaerobic rods with peritrichous flagella. Infiltration of tobacco leaves (Nicotiana tabacum cv. Samsun) with the bacterial suspension of 108 CFU/ml resulted in typical hypersensitivity reactions within 24 h. Five representative isolates were further characterized by the Biolog Microbial Identification System, version 4.2 (Biolog Inc., Hayward, CA) and gas chromatography of fatty acid methyl esters (FAME) by the Microbial Identification System (MIDI Inc., Newark, DE) with aerobic bacterial library (TSBA50). The five isolates were identified as Erwinia chrysanthemi (Pectobacterium chrysanthemi) with a Biolog and FAME similarity index of 0.81 to 0.88 and 0.62 to 0.75, respectively. The transfer of P. chrysamthemi to a novel genus, Dickeya gen. nov., was recently proposed (2). The almost complete 16S rDNA sequence from Oncidium isolate SCH-01 (1,604 bp; EMBL Accession No. FM946179) was determined according to the method of Li et al. (1). A subsequent GenBank search showed that this isolate is 98% identical to that of type strain CFBP 1269T of Dickeya dadantii (EMBL Accession No. AF520707) and CFBP 1200T of Dickeya dianthicola (EMBL Accession No. AF520708). Nevertheless, species identification within genus Dickeya is still difficult since only a limited number of strains of each species have been characterized fully. Koch's postulates were completed with the inoculation of Oncidium seedlings with cell suspensions (108 CFU/ml) by a pinprick at the base of the stem. All five representative isolates induced stem rot similar to that observed in natural infections. No symptoms were noted on the control plants inoculated with sterilized distilled water by the same method. The bacterium was reisolated from symptomatic stems of Oncidium plants. To our knowledge, this is the first report of stem rot on Oncidium orchid in Mainland China caused by the bacterium formerly referred to as P. chrysanthemi, now proposed as Dickeya sp. References: (1) B. Li et al. J. Phytopathol. 154:711, 2006. (2) R. Samson et al. Int. J. Syst. Evol. Microbiol. 55:1415, 2005. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society. St. Paul, MN, 2001.

Erwinia chrysanthemi is a phytopathogenic enterobacterium able to degrade the pectic fraction of plant cell walls. The kdgR negative regulatory gene controls all the genes involved in pectin catabolism, including the pel genes encoding pectate lyases. The E. chrysanthemi kdgR regulatory gene was subcloned in Escherichia coli where it was shown to be functional, since it repressed the expression of a pelE::uidA fusion. The nucleotide sequence of kdgR contained an open reading frame of 918bp preceded by classical transcriptional initiation signals. KdgR shows similarity to two other regulatory proteins, namely GylR, encoding an activator protein of the glycerol operon in Streptomyces coelicolor, and IclR, encoding a repressor of the acetate operon in Salmonella typhimurium and in Escherichia coli. Previously, comparison of regulatory regions of several genes controlled by kdgR revealed the existence of a conserved region which was proposed as a KdgR-binding site. The 25 bp oligonucleotide AAAAAAGAAACATTGTTTCATTTGT corresponding to this consensus was substituted to the lac operator, at the beginning of transcription of the lacZ gene. This construct functioned as an operator for binding of the KdgR protein in vivo.

In Erwinia chrysanthemi, all the genes involved in pectin degradation are controlled by the negative regulatory gene kdgR. 2-keto-3-deoxygluconate (KDG) is the inducing molecule that interacts with KdgR to allow the expression of all the genes of the kdg regulon. The inducing properties on the expression of genes regulated by kdgR of various analogs and derivatives of KDG were tested. All the inducers share the common moiety COOHCOCH2CHOHCC included in a pyranic cycle. Our results show that esterification of C1 prevents induction. Presence of a ketone function on C2 and absence of hydroxyl on C3 are necessary for induction. The nature and the configuration of substituent on C5 has no influence on induction. Two compounds have interesting properties: 5-O-methyl-KDG is a gratuitous inducer and gluconic acid can prevent induction.