Search

Gallstone ileus with impaction of gallstone in distal duodenum is an extremely rare complication of cholecystolithiasis. Gallstone ileus in itself accounts for less than 1% of these complications with 800 cases described so far. However, there are less than 15 cases described with the impaction of gallstone in distal duodenum. We report a case of an 84-year-old male patient in whom gallstone impacted in distal duodenum was found by ultrasonography and confirmed by computed tomography. Cholecystitis and a remaining large gallstone in the gallbladder were found intraoperatively, which made us opt for one-step procedure, i.e. lithotomy and fistula repair with cholecystectomy. Due to the rare position of impacted gallstone, we believe that cases like this should be reported in detail in order to generate enough data for establishing optimal treatment options.

The aim of this study was to analyze microphthalmia-associated transcription factor (MITF) as a marker for the detection of circulating melanoma cells, determine its prognostic value in melanoma patients, and compare it with tyrosinase. Blood samples from 201 melanoma patients in all stages of the disease and 40 healthy volunteers were analyzed. RNA was isolated from mononuclear cell fraction of the blood and assayed by reverse transcription-PCR for the expression of MITF and tyrosinase. All samples from healthy volunteers were negative for both MITF and tyrosinase. Out of 201 blood samples from melanoma patients 32 were positive for MITF, 20 for tyrosinase, and four for both MITF and tyrosinase. Analysis of MITF as an additional marker to tyrosinase allowed for detection of circulating melanoma cells in a larger number of melanoma patients in comparison to tyrosinase analysis alone (48 vs. 20 positive). A positive value of MITF was associated with shorter progression-free (P=0.005) and overall survival (P=0.042). A positive value of tyrosinase was associated with shorter overall survival (P=0.012), whereas there was no significant association between the value of tyrosinase and progression-free survival. The value of MITF was selected with multivariate analysis as the independent prognostic factor for progression-free survival, whereas the only independent prognostic factor for overall survival was the stage of disease. This study has shown that MITF is a specific marker for detection of circulating melanoma cells that has a prognostic value in melanoma patients. Determination of MITF in addition to tyrosinase improved the detection of circulating melanoma cells in melanoma patients.

Myeloid sarcoma is a tumor mass with extramedullary growth pattern, composed of myeloblasts or immature myeloid cells. The development of myeloid sarcoma may precede or concur with acute or chronic myeloid leukemia (AML or CML) or other myeloproliferative diseases or myelodysplastic syndromes (MDS). Isolated myeloid sarcoma of the breast is very rare. A case is presented of a 25-year-old, previously healthy woman that presented to our department for a palpable node, 5 x 2 cm in size, in the upper medial quadrant of her left breast. Fine needle aspiration (FNA) produced a sample consisting of medium sized blasts. Additional work-up revealed anemia, thrombocytopenia and leukocytosis, along with atypical blasts detected in peripheral blood and bone marrow smear. Based on the morphology, cytochemical characteristics and immature cell immunophenotype, it was considered a case of acute myeloid leukemia without maturation. In spite of intensive chemotherapy, the patient died within a year of diagnosis. In cases of isolated breast myeloid sarcoma, the diagnosis can be missed if the possibility of myeloid sarcoma is not remembered on differential diagnosis of a breast neoplasm.

Violence is an important social problem. Violence in the community has important social relevance for the political, criminal justice, and health care systems. Studies of homicide offenders have suggested a high prevalence of neurologic dysfunction due to organic brain damage such as traumatic brain injury, epilepsy and dementia have been observed to exhibit excessive violence. Moreover, violence in the mentally ill can be viewed as an important medical and mental health problem with significant implications for forensic psychiatry and the community. Although numerous previous studies showed that rate of violent behavior in the community is not much higher in patients with serious mental disorders (schizophrenia) than in healthy controls, that rate is substantially higher in patients with psychiatric comorbidity and substance abuse. A high proportion of patients in forensic psychiatric facilities are diagnosed with comorbidity, most often with schizophrenia, paranoid psychosis, organic brain syndrome, various personality disorders and comorbid substance abuse. These patients represent a high risk group for violence within forensic psychiatric facilities, and repetitive violent behavior in the community. Understanding the neurobiological basis of aggressive behavior clearly has important social and clinical implications. By introduction of neuroimaging studies (MRI, fMRI, PET, SPECT) as a useful tool in forensic psychiatry, the neurobiological aspect of violence is better understood. Previous studies have shown that individuals with frontotemporal brain dysfunction are frequently displaying antisocial behavior (disinhibition, impulsivity, lack of empathy) that justify the diagnosis of "acquired sociopathy/psychopathy". A correlation between the potential for impulsive aggression mediated by limbic brain structures, and the control of the aggression by frontotemporal brain regions has been shown. The individuals with such brain dysfunction have an increased risk of violent behavior and scored high on the Webster's and Hare's violence risk assessment scale. This article reviews the relationship between psychiatric comorbidity, violence risk assessment and neuroimaging in forensic psychiatry and showing the useful directions for future research, screening and prevention of violent behavior among mentally ill criminal offenders.

The aim of the study was investigation of specific forensic aspects in offenders involved in domestic homicide cases in regard to sociodemographic and psychosocial variables and modalities of the offense. The research was conducted at the Department of Forensic Psychiatry in Neuropsychiatric Hospital "Dr. Ivan Barbot" in Popovaca, Croatia. The sample in this study consisted of domestic homicide group (N = 162). The results showed certain characteristics within the group of domestic homicide offenders. Generally speaking the offenders in domestic homicide cases were often married and were living in their families. Moreover, they were brought up in families with both parents and they had history of regular military service. Furthermore, offenders in domestic homicide cases were less involved in intervention from social services with rare history of home runaway and substance abuse during adolescence. Finally, the same group of offenders was less often had mothers or close friends with antisocial personality disorder but had frequent language and speech problems during adolescent period. In regard to the victims of domestic homicide they were often aged females. The offenders usually commit crime in their living space, either in the house or in the apartment. Based on these findings we conclude there are certain specific characteristics in the domestic homicide cases compared to homicide in general.

The aim of this study is to show what part of our County has the most population with age-related macular degeneration (ARMD) and how some types frequently appear in same parts. The County includes 3 different geographic areas: Gorski Kotar, Coast and Islands. ARMD is the leading cause of visual impairment and blindness in developed countries. There are two categories of ARMD: atrophic or "dry" ARMD and exudative or"wet" ARMD. Our epidemiological study group includes 60 patients (33 females, 27 males) with both types of ARMD and they mostly spent their life times in our County. Patients were examined and treated in our Clinic during 2008 and 2009. We also examined which contribution factor (age, genetics, UV-exposure, diet, iris and macular pigment) is more common and found a links with occupation, residence and habits. Our study shows that ARMD in our County is most frequent in interval of 61-80 years. Incidence of ARMD is mild increased in female (55%). Significant incidence of ARMD is connected with patients who work outdoor more than 5 hours daily (70 %). There were no significant difference between patients in different areas[-Gorski Kotar and Coast (p = 0.9260), Gorshi Kotar and Islands (p = 0.8382) and Coast and Islands (p = 0.8546) connected with occupations. Regions Coast and Islands had more cases of ARMD than Gorski Kotar, but in Gorski Kotar patients had greater percent of "wet" type. Difference is statistically significant between areas Gorski Kotar and Islands (chi2 = 4.675, p = 0.0306). Also, there were statistically significant difference in nutrition between Gorski Kotar and Islands (chi2 = 4.17, p = 0.0411). Incidence of ARMD is related with less iris and macular pigment--47 patients (77%). There was an increased risk for exudative type in Trsće and Cabar in Gorski Kotar

The aim of this study is to evaluate pseudoexfoliative glaucoma (PEX) in Primorsko-Goranska County, Croatia, and its characteristics comparing to primary open angle glaucoma (POAG). In the study a hundred patients with open angle glaucoma were examined, twenty six of them had a pseudoexfoliative glaucoma diagnosed. We were following intraocular pressure (IOP) values, visual acuities, visual fields and optical nerve head changes retrospectively. Comparing to primary open angle glaucoma pseudoexfoliative glaucoma in Primorsko-Goranska County has less good prognosis because the IOP is usually higher and more difficult to control, we found progressive loss of retinal ganglion cells and visual field loss develop more rapidly. Because of that pseudoexfoliative glaucoma requires special treatment and following.

This study attempts to answer the question if any level of head and neck circulation takes a part in development of Age-Related Macular Degeneration (ARMD) and hearing and equilibrium impairments. Condition of large blood vessels was examined by Color-Doppler ultrasound, and carotid and ophthalmic arteries were included. The microcirculatory changes were examined directly by fundus photography and fluorescein angiography and indirectly testing hearing and equilibrium. The study group included 40 patients (21 females, 19 males) aging from 53 to 84 years with different stages of ARMD. The control group included 40 patients (18 females, 22 males) aging from 51 to 82 years without ARMD. Patients were inhabitants of Primorsko-Goranska County. There was no relationship between ARMD and condition of large blood vessels because significant stenosis of carotid arteries was found in 2 patients (5%) in study group and 3 patients (7.5%) in the control group (p > 0.05). On the contrary, we found correlation between ARMD and hearing (p = 0.0127) and equilibrium impairments (p = 0.0242). Fluorescein angiograms shows raised number of ischemic retinal capillaries in patients with ARMD (p = 0.0053). Results lead to conclusion that circulatory disorders on microcirculatory level take a great part in development of ARMD and hearing and equilibrium impairments in the elderly. The key is damage of sensory cells of the retina and inner ear caused by microcirculatory disorders. Interesting data was noticed that 9 patients with more serious ARMD on one side of head had greater hearing loss on the same side. If we find a new treatment for microcirculatory disorders, maybe we can treat both sensory impairments in earlier stage.

Carotid artery stenosis (CAS) is one of the major complications of external irradiation (radiotherapy, RT) for laryngeal carcinoma. Considering amaurosis fugax is often one of the first signs of significant CAS our focus was to determine weather patients with post-irradiation CAS also develop ocular microangiopathy as a result of insufficient ophthalmic circulation. In our study Carotid Duplex ultrasound scans revealed that 33.33% of patients had significant radiation-induced CAS. The majority (over 85.71%) of radiation-induced CAS had more than one atherosclerotic plaque including any degree of stenosis in the RT group, and had significantly more than that of the control group. Microangiopathic changes were documented only with the patients that have had an increased cerebrovascular risk (diabetes mellitus and arterial hypertension).

Applied neuroscientific knowledge such as brain neuroimaging has widespread application in the medical diagnostic and treatment areas. Neuroscientific progress such as cognitive neuroscience has strong implications in specific medical fields such as forensic psychiatry. Significant progress in forensic psychiatry has affected the practice of law, in which an understanding of the complex relationship among mind, brain, and behavior is becoming necessary. Forensic psychiatry is concerned with the relationship between psychiatric abnormalities and legal violations and crimes. Due to the lack of available biological criteria, assessment, evaluation and therapy in forensic psychiatry have so far been restricted to psychosocial and mental criteria of offender personality. Recent advances in nuclear radiology such as brain imaging techniques (fMRI, DT-MRI, PET SPECT) allow a closer approach to the neural correlates of personality, moral judgments and decision-making. Introduction of neurobiological criteria (based on advanced neuroimaging techniques) in the field of forensic psychiatry and establishing the rules to what extent such biological criteria will be more reliable choice in evaluating mentally ill offenders would be of fundamental value in the modern forensic psychiatry. Psychosocial and subjective criteria in forensic evaluation will be more accomplished by biopsychosocial and objective criteria. Advances in the neuroimaging techniques bring specificity to the problems underlying the application of neuroscience to criminal law.

Age-related maculopathy (ARM) is one of the leading causes of central visual acuity loss in older western population. Many factors are responsible for the fast development of ARM. One of this is significant increases of optical radiations through artificial lens after removal of the catarctous lens. The aim of this study was to compare progression of ARM in phakic and pseudophakic patients and to calculate the possibility ofpseudophakia as a risk factor for faster progression of ARM. Medical records of 76 patients, older than 60 years (32 male and 44 female) with early forms of ARM were randomly evaluated. They had undergone cataract removal by phacoemulsification with intraocular lens implantation from January 2002 to December 2006 at the Department of Ophthalmology, Rijeka University Hospital, Croatia. Patients were examined two weeks after the surgery and followed up for two years. The control group consisted of 48 patients (21 males and 27 females) with also early forms of ARM, older than 60 years, examined at the Policlinic Department from January 2006 to December 2006 and followed up at least for two years without any cataract surgery. Comparing progression of ARM in these two groups, a total of 19 patients (25%) in pseudophakic group showed progression to late forms of ARM, but only 6 patients (12.5 %) in the control group developed these aggressive ARM forms. More aggressive forms of ARM in pseudophakic group indicate that pseudophakia should be considered as a risk factor for development of ARM.

The endothelial cells are one of the most important structures in a donor cornea. Morphology and concentration of endothelial cells must be carefully evaluated with a specular microscope before transplantation. The aim of this study is to evaluate the status of corneal endothelium in glaucoma patients. Prospective study included 50 patients suffering from glaucoma and 50 patients in control group. Patients had no corneal disease, ocular inflammation, previous trauma or ocular surgery. Patients were not contact lens wearers. They were also analyzed in groups according to type of glaucoma. Specular microscopy was performed on central corneas. This study showed that patients with glaucoma have lower central corneal endothelial cell density than those without glaucoma of the same age group. Also, patients with pseudoexfoliative glaucoma had lower values of central endothelial cell density comparing to patients with open angle or angle closure glaucoma.

The method of stagnation point optical reflectometry was applied for investigation of adsorption of bovine serum albumin (BSA) on previously formed poly(allylamine hydrochloride)/poly(sodium 4-styrenesulphonate) (PAH/PSS) multilayer with PAH being a terminal layer. The solid substrate was silica in the form of silicon wafers carrying an oxide layer. In order to interpret the adsorption of BSA, the build-up mechanism of PAH/PSS multilayers was examined with special emphasis on the effect of electrolyte concentration, pH of solution, and the anchoring (precursor) layer on that process. Additionally, the effect of BSA concentration and of the anchoring layer on BSA adsorption was investigated. It was shown that in all investigated systems the adsorption of BSA depends on conditions under which the multilayer was formed (ionic strength, pH and presence of an anchoring layer), as well as on BSA concentration. It follows that adsorption of BSA could be controlled not only by choosing suitable BSA concentration, but also by modifying the preformed multilayer.

Our aim was to draw attention of clinicians, dermatovenereologists and ophthalmologists to the possible association of vitiligo and ocular findings characteristic of primary open angle glaucoma (POAG). According to our clinical experience, POAG is relatively often diagnosed or previously diagnosed in patients treated for vitiligo. We found no literature report directly connecting vitiligo and POAG. The articles mentioning glaucoma, i.e. increased intraocular pressure (IOP), are mainly based on secondary type of glaucoma as a direct consequence of vitiligo treated by corticosteroids. On the other hand, there is a substantial number of articles elaborating the association of vitiligo with ocular findings in known clinical syndromes. During a 2-year period, from May 2007 to May 2009, 42 patients with vitiligo were examined at University Department of Dermatology and Venereology and referred for previously appointed ophthalmologic examination at University Department of Ophthalmology, Split University Hospital Center. All patients with vitiligo underwent complete ophthalmologic examination including visual field analysis, in order to treat and follow up or diagnose newly discovered POAG. Of 42 patients with vitiligo suspect of glaucoma, POAG was confirmed in 24 (57%) patients. Age median of all vitiligo patients was 56 (range 19-82) years. In patients with vitiligo and glaucoma, the duration of vitiligo was twofold that recorded in patients with vitiligo alone, the difference being statistically significant (z=3.3; P<0.001). The risk of developing glaucoma in vitiligo patients was 4.4-fold in >56 age group versus <56 age group and 3.5-fold in patients with >13 year versus patients with <13 year duration of vitiligo. Multivariate logistic regression for glaucoma development according to vitiligo duration (< or =13 years vs. > or =13 years) and patient age (< or =56 years vs. > or =56 years) pointed to the association of glaucoma development and age and yielded a 92% probability for the association of glaucoma development and vitiligo duration. Therefore, we believe that patients treated for vitiligo should regularly undergo complete ophthalmologic examination with special attention paid to POAG irrespective of age, sex, severity, localization and duration of the disease. Although performed in a relatively small sample and over short period of time, the results of this pilot study demonstrated that this association was not accidental. Additional studies in a greater sample of vitiligo patients and POAG are expected to provide definitive answers and conclusion on the association of these two diseases.

Objective: Detailed ultrastructural and immunohistochemical examination of the trigeminal axons surrounded by the peripheral type of the myelin could add new information about the extent of the trigeminal nerve lesion in neuralgia., Patients, Materials and Methods: The examination comprised, firstly, the 10 trigeminal nerve roots (TNRs) in which the neurovascular contact was found in 20% of the cases, and the 2 additional control TNRs. Secondly, the biopsy specimens were taken from 6 patients with trigeminal neuralgia and 2 patients with trigeminal neuropathy following a partial TNR rhizotomy. The specimens were examined under the electron microscope (EM) and/or using the immunohistochemical (IHC) methods., Results: In addition to the central zone of demyelination, the EM examination of the TNR also revealed alterations of the peripheral myelin, i.e. deformation, thickening, demyelination and remyelination, as well as changes of the peripheral axons, that is, atrophy or hypertrophy, neurofilaments increase, loss of the myelin and sprouting occasionally. Some Schwann cells were also damaged. The IHC examination usually showed a moderate immune reaction against neuron-specific enolase (NSE) and protein gene product 9.5 (PGP9.5), but sporadically weaker reaction against the S-100 protein, synaptophysin (SY), neurofilament protein (NFP) and glial fibrillary acidic protein (GFAP). The substance P (SP) and calcitonin gene-related peptide (CGRP) immunoreactivity was weak at some sites, but strong at some other places., Conclusions: The pathological changes affect not only the central nerve fibers of the TNR, but also some of the peripheral axons, their myelin sheath and Schwann cells. These are signs of the retrograde ultrastructural and biochemical alterations, which could participate in the pathophysiological mechanism underlying the trigeminal neuralgia.

Numerous investigations indicate a close link between violent behavior, homicide (murder) and alcohol intoxication. With increased frequency of drinking and the chronic consummation of alcohol, the risk of the fatal outcome or homicide and victimization caused by violence is more likely to occur. Studies conducted on convicted murderers suggested that about half of them were under the heavy influence of alcohol at the time of perpetration of murder. The sample in this survey consisted of 177 male offenders which committed criminal act of murder in Croatia from the year of 1990 until 2007 (capital murder and attempted murder). All were assigned for the forensic psychiatric evaluation by the Criminal Justice System (Court of Law) at the Department of Forensic Psychiatry, Neuropsychiatric Hospital, Popovaca, Croatia. For the purpose of this work the sample is divided in two groups of subjects: 1) offenders which were intoxicated at the time of murder and committed offence on intoxicated victim 2) offenders who were sober and committed offence on sober victims. Groups are compared according to the variables of crime and history of alcohol abuse. On the basis of obtained results we can conclude that there are significant differences in relation to the variables and modalities of criminal offence between two groups of offenders and victims. We could conclude that alcohol intoxication in offenders and victims at the time of murder could strongly affect the modalities of murder.

The goal of this study was identification of highly specific patterns of schizophrenia related domestic homicides by comparing schizophrenic homicide offenders with related domestic homicide group of offenders diagnosed with other psychiatric disorders. This study was based on the comparison of schizophrenic homicide group and other homicide group of offenders on the basis of differences in psychosocial and sociodemographic patterns and the modality of crime. The survey was conducted on mentally insane domestic homicide offenders diagnosed with schizophrenia (n=44) and second group of mentally insane offenders diagnosed with other psychiatric diagnosis (n=43). All offenders were admitted to Department of Forensic Psychiatry (Neuropsychiatric Hospital "Dr. Ivan Barbot", Popovaca, Croatia) for psychiatric evaluation. They have undergone psychological testing and psychiatric evaluation in order to make forensic expert analyses of each case particularly. This study showed some specific characteristics in the cases of schizophrenic offenders; they are more often commit parricides and siblicides, the victims are often males with their own physical strength. Furthermore, schizophrenic offenders were indifferent upon killing their victim; they were less often provoked by a victim itself and were sober tempore criminis. Moreover, in the same homicide group we found young, single offenders with high school education, average intelligence and with positive psychiatric heredity. Finally, in the same group of offenders we have found no history of military serving, less social developmental disruptions, less history of drug and alcohol abuse during adolescence and adult age.

The pathogenesis of age-related maculopathy (ARM), the most common cause of visual loss after the age of 60 years, involves a variety of hereditary and environmental factors. When the cataractous lens is removed and replaced by clear intraocular lens, a significant increase in ocular transmittance of optical radiation occurs. The aim of this study was to assess whether cataract surgery in older persons may increase the risk for development of ARM. This is a retrospective study. Medical records of 307 patients, aged 43 to 96 years, (163 male and 144 female) were randomly evaluated. They had undergone cataract extraction (phacoemulsification or extracapsular lens extraction) with clear intraocular lens implantation from January 2001 to December 2005 at the Department of Ophthalmology, University Hospital Rijeka. Patients were examined two weeks after surgery and followed up for at least two years. Based on the exclusion criteria, only patients without any sign of AMD at the first postoperative check up were included. A total of 80 patients (26%) showed development of ARM at the last check up, which was at least 2 years after surgery. Our results indicate that pseudophakia is a risk factor for development of ARM.

The aim of this study is to report short-term effect of the treatment of "wet" ARMD (age-related macular degeneration) with intravitreal bevacizumab (Avastin). Prospective study included 36 patients (36 eyes) with "wet' form of ARMD. All patients were over 60 year old (22 female, 14 male). Changes of macula included minimally classic CNV (choroidal neovascularisation) (24), occult subfoveal CNV (10) and first stage of cicatrial CNV (2). Bevacizumab 1.25 mg was administered intravitreally through pars plana using a 27-gauge needle. Patients had no previous eye treatment. Ophthalmic exam before and after the treatment included: Snellen VA (visual acuity) and examination including measurement of IOP (intraocular pressure), FA (fluorescein angiography) and interview with patients. After 4-6 weeks 28 (78%) patients had significant improvement of VA. Median VA improved from 0.083 to 0.200 (p<0.01). Eight patients (22%) had no significant improvement in VA but three of them reported to see more light. FA showed complete resolution of macular edema in 6 patients (17%), partially resolved in 23 patients (64%) and no change in 7 patients (19%). No systemic side-effect was found. Short-term results suggest that intravitreally administered bevacizumab is well tolerated treatment for ARMD with very high number of patients showing improvement in VA.

This is a case report of Acanthamoeba as a causative agent of keratitis at the Department of Ophthalmology, University Hospital Rijeka. Delay in treatment led to an advanced stage of the disease with multiple complications. Initially, presented symptoms were similar to those of herpetic keratitis. In the mean time progression of the disease led to a cloudy cornea with a stromal ring infiltrate, poor vision, elevated intraocular pressure, a mature cataract and finally corneal melt. Corneal scrapings were obtained from a 28 years old female patient, wearing soft contact lenses and with poor lens hygiene. Acanthamoeba cysts were identified by the cytological examination. Culture of the corneal scraping had confirmed Acanthamoeba as the etiological agent. Making the diagnosis of Acanthamoeba is difficult. We presented this case of delayed diagnosis and unfavorable outcome as a reminder that clinical suspicion remains the most important diagnostic tool. Contact lens wears with a new diagnosis of herpes simplex keratitis are in high risk group, especially those with significant pain or poor response to conventional therapy. We also wanted to point out the possibility of an early, prompt and inexpensive diagnosis with the cytological examination.

Chromotherapy is based on the effect of colored light with different frequencies on human neurohormonal pathways, precisely on melatonin and serotonin pathways in brain. There is evidence that visible electromagnetic spectrum of light we see as colors can have impact on human health, Cicardian rhythm or biological clock is complex fundamental physiological and biological cycle in human organism. The biological clock in humans is located in the specialized group of brain cells called suprachiasmatic nucleus (SCN) within the anterior hypothalamus. The complex process of neurohormonal regulation of cicardian rhythm in humans is essential for synchronized interaction and coordination of internal body function with the environment. Given these facts it is clear that any shift in cicardian rhythm results in neurohormonal imbalance which consequently could lead to various psychiatric disorders affecting humans. Studies on sleep disorders, depression, seasonal affective disorder (SAD) and post-traumatic stress disorder (PTSD) suggested that symptoms, signs, and biologic markers associated to these psychiatric disorders are due to marked alterations in melatonin and serotonin levels. The main hypothesis of chromotherapy is that specific colors of the visible spectrum are activators or inhibitors of complex physiological, biological and biochemical processes in human brain such as synthesis of various neurohormons. According to all previous findings, our goal is future investigation of the effect and possible application of chromotherapy in the complementary psychiatric treatment in patients with diagnostic criteria which are clearly related to melatonin and serotonin disturbances.

Considering that VEGF is the key factor for angiogenesis stimulation, we wanted to establish if VEGF level is increased in aqueous humor of patients with open globe eye injury. The study included 20 patients with open globe injury. During the surgery, aqueous humor samples were taken out and VEGF levels were measured by ELISA. VEGF levels were significantly higher in the aqueous humor of patients with open globe eye injury and uveitis, in patients with wound bigger than 2 mm and in patients where from injury to surgery passed more than 4 hours. VEGF levels were also higher, but not significantly, in patients with intrabulbar foreign body. Considering that VEGF levels were significantly higher in patients with open globe eye injury with uveitis, wound larger than 2 mm and in patients where from injury to surgery passed more than 4 hours, anti VEGF therapy might have application in these conditions.

The study included 20 patients with diabetes mellitus type I (DM I) and 16 with type II (DM II) suffering from prolipherative diabetic retinopathy (PDR) for which they underwent vitrectomy. The quantity of VEGF and its receptors in the vitreous of investigated patients were measured by immunoassay and results compared between patients with DM I and II. The mean levels in the vitreous were significantly higher in diabetics with PDR and diabetes mellitus I (432.2 pg/mL, 1460.4 pg/mL and 1054.6 pg/mL) than in diabetics with PDR and diabetes mellitus II (147.5 pg/mL, 641.4 pg/mL and 448.5 pg/mL) and in control group (63.26 pg/mL). Considering that VEGF VEGFR1 and VEGFR2 levels were significantly higher in diabetics with PDR than in controls and that the patients with DM I had higher levels than with DM II, anti-VEGF therapy might be beneficial for diabetics with PDR, especially those with DM I.

In the north Croatian Adriatic area in the period of seven years (from January 2001 to September 2007) 475 patients (39 to 80 years of age) with dry form of age related macular degeneration (AMD) were diagnosed. Complete ophthalmologic examination with special reference to visual field testing (Perimetric analysis) was performed. Peripheral visual field defects were found in 85% of patients. Elderly patients with more advanced forms of macular degeneration had more peripheral visual field defects. In 400 patients corticosteroid therapy (5 mg Prednisolonacetate, anterior H-inject, Winthorp) was administered via parabulbar injections every day/five days. Control group consisted of 75 patients treated with regular polyvitamine therapy (Lutein, Beta Karoten, Vitamin E). Patients treated with corticosteroids had peripheral visual field improvements from 10 to 25 degrees and central field improvements from 5 to 20%. In the control group treated with vitamins, central visual field showed improvements from 0.5 to 1% in 43 patients but without peripheral visual field improvements after 6 months.

Diagnosis and management of patients with SLE (Systemic Lupus Eritematosus), autoimmune hepatitis (AIH), primary biliary cirrhosis (PBC), involves specific diagnostic tests, such as IFA-AMA, IFA anti-dsDNA and immunoblotting for the detection of autoantibodies for specific autoantigens (mitochondria, dsDNA, M2, LKM-1, LC-1, SLA/LP). We established specific correlation between the detected autoantibodies and corresponding clinical findings. The total of 813 serum specimens were probed with IFA-anti-dsDNA, 98 of which tested positive. We also performed dilution analysis to the end point for all the positive specimens. Numerous specimens were tested by IFA, AMA and immunoblotting.

The aim of our study was to determine if there is a difference between the type of crime committed by persons diagnosed with posttraumatic stress disorder (PTSD) and that committed by other offenders. The study included 389 male patients at the Department of Forensic Psychiatry in Popovaca who underwent forensic psychiatric evaluation to establish a psychiatric diagnosis, evaluate the mental capacity, and provide advice on further treatment. The data on the number of individuals with PTSD vs. other psychiatric disorders and the data on family violence vs. other criminal acts were analyzed with chi2 test. Of a total of 389 forensically evaluated male patients, 45 (11.6%) suffered from PTSD. Study subjects with PTSD only or PTSD comorbid with the other psychiatric disorders committed family violence significantly more often than subjects diagnosed with the other psychiatric disorders chi2(1) = 40.092, P < 0.001. Subjects with PTSD, whether or not comorbid with the other psychiatric disorders, committed family violence significantly more often than subjects with other psychiatric diagnoses.

Background and Aim: Soluble c-erbB-2 oncoprotein has been proven as a useful marker in the management of breast cancer patients, but its value in diagnostics and follow-up of colorectal cancer patients remains controversial. The aim of this study was to evaluate the usefulness of serum c-erbB-2 monitoring in diagnostics and prediction of disease outcome in rectal cancer patients., Materials and Methods: Serum samples from 88 patients with rectal adenocarcinoma before surgery and from 41 healthy controls were tested for the presence of c-erbB-2 oncoprotein by ELISA, and the patients were followed up for at least 5 years after the surgery., Results: Preoperative serum c-erbB-2 levels were significantly higher in stage IV patients than in healthy controls (P<0.001) and did not show correlation with preoperative CEA levels. Elevated preoperative serum c-erbB-2 levels showed relatively high specificity (88%) and low sensitivity (44%) in the diagnosis of rectal cancer. Elevated preoperative oncoprotein levels were predictive neither for overall survival nor for development of local recurrence/distant metastases., Conclusion: Although preoperative serum c-erbB-2 levels were significantly higher in rectal cancer patients than in healthy controls, the soluble c-erbB-2 does not seem to be useful in the diagnosis of rectal cancer due to its low sensitivity. Preoperative serum levels of this oncoprotein were predictive neither for overall survival nor for local recurrence/distant metastases in rectal cancer patients.

The total number of 542 patients with colorectal cancer surgery have been analyzed in order to estimate the effect of receiving transfusion local recurrences, and the disease free - survival. It should be examined whether there are changes in general immunity indicators which would be connected with perioperative transfusion. A significant connection has been found between local recurrences and blood transfusion (p<0.0001), the most noticeable being in Dukes A (p =0.045), localization on rectum (p=0.036). The receiving of blood transfusion is linked significantly with disease free - survival reduction (p =0.0068; log rank), the most significant being in Dukes A stage (p =0.0123; log rank) and with localization on rectum (p=0.0231). The analysis of general immunity indicators has shown significant immunocompromitation of patients just before the surgery and this could have effect on immunomodulation caused by transfusion and just as on the treatment prognosis of colorectal carcinoma.

The purposes of this study were to assess the prevalence of temporomandibular disorders in Croatian war veterans suffering from post-traumatic stress disorder (PTSD) and to analyze the impact of the disease on mandibular function. One hundred eighty-two male subjects participated in the study. The examined group consisted of 94 subjects who had taken part in the war in Croatia and for whom PTSD had previously been diagnosed. Patients were compared with an age- and gender-matched group of subjects who had not taken part in the war and for whom PTSD was excluded by means of a psychiatric examination. The study used a clinical examination and standard questionnaire. Statistically significant differences were found in almost all measured parameters. With regard to restricted movements, overbite, and overjet, the differences obtained did not have clinical significance. The most significant differences were found in the parameters of pain. Headache was experienced by 63.83% of the subjects with PTSD, facial pain by 12.77%, and pain in the region of the jaw by 10.64%. Headache was the most intense pain, with an average intensity of 4.92 on a scale of 0 to 10. Pain on loading, temporomandibular joint clicking, and intrameatal tenderness were more prevalent in the PTSD group than in the healthy control group. The study supports the concept that PTSD patients are at increased risk for the development of temporomandibular disorder symptoms.

Systematic adsorption tests were carried out to determine the efficiency of organo-zeolite (OZ) for removal of atrazine, lindane and diazinone from water. The hydrophobic character of OZ-pesticide interactions was confirmed by measuring the amount of pesticides sorbed on zeolite samples modified with 25, 50, 75 and 150 mmol of stearyldimethylbenzylammoniumchloride (SDBAC)/kg of zeolite. The effects of adsorbent particle size, solid content in the suspension and the initial pesticide concentration in the solutions were also investigated. For effective adsorption of diazinone onto an OZ, it is necessary for the SDBAC/diazinon ratio to be higher than 25. The adsorption capacities, calculated by fitting the experimental data to the Langmuir-Freundlich equation, were 2.0 micromol/g (atrazine), 4.4 micromol/g (diazinone) and 3.4 micromol/g (lindan). At lower initial concentrations of pesticide solution, a linear dependence existed between the amount adsorbed and the equilibrium concentration of pesticide. Column experiments showed that at volumetric flow of 6 cm3/ min, the breakthrough points (at C/C0 = 0.1) were 560 bed volume (BV) for lindane and 620 for diazinone.

Aim: To present longterm results of laser photocoagulation for retinal ruptures in preventing retinal detachment., Methods: Retrospective analysis of 405 patients (430 eyes) operated on (treated) with argon laser photocoagulation for retinal tear from January 1992 to January 2002. Inclusion criteria were retinal rupture(s) on one or both eyes. Follow up period was 2 to 9 years. Indications for laser treatment were symptomatic retinal ruptures, ruptures with vitreoretinal tractions, ruptures associated with high myopia, retinal pathology in the fellow eye, aphakia, pseudophakia, eye trauma, vitreous hemorrhage, and ruptures with shallow retinal detachment not exceeding 1-2 disc diameter. Laser treatment was done with Coherent 900, Novus and Ultima lasers, usually in one session under topical anesthesia. Laser surgery consisted of 2-3 continuous rows surrounding the lesion, power setting 100-300 mW, time 0.2 s, spots 100-200 micron in size., Results: The types of tear were analyzed and tabularly presented. There were 20 (4.6%) round holes with no operculum, 32 (7.4%) round holes with operculum and 143 (33%) horseshoe tears with visible vitreoretinal tractions. Retinal ruptures were associated with vitreous hemorrhage in 96 (22.3%) eyes, myopic changes were found in 82 (19%) eyes, and pseudophakia in 56 (13%) eyes. Posterior vitreous detachment was found in 146 (34%) eyes and traumatic ruptures were found in 27 (6.3%) eyes. The position and number of retinal ruptures were analyzed. Single ruptures were found in 255 (59%) and multiple ruptures in 175 (45%) eyes. In the group of single ruptures, superotemporal localization was found in 120 (28%) eyes. The most common complication following laser treatment was retinal detachment in 24 (6%) eyes. Two (0.5%) eyes developed proliferative vitreoretinopathy. Twenty-four eyes with retinal detachment after laser treatment were operated on. Scleral buckling procedure was done in 20 (83%) and pars plana vitrectomy in 4 (17%) eyes. Two (8.5%) eyes underwent repeat vitrectomy due to postoperative complications., Discussion: Today there is a strong suggestion that all symptomatic retinal ruptures should be treated. Ruptures with small and shallow retinal detachments should be treated. If there is vitreoretinal traction and retinal defect, these eyes should be treated. There are some medical eye conditions where it is wise to perform laser treatment for retinal rupture (aphakia, pseeudophakia, myopia, retinal changes in fellow eye, vitreous hemorrhage, trauma). In our study there was a number of asymptomatic retinal ruptures that were treated. The reason was a very long period of time elapsed from the treatment of our first patients (15 years before), when it was considered necessary to treat these patients., Conclusion: The most serious complication of retinal rupture, retinal detachment, can be prevented by early laser photocoagulation. There are some conditions associated with retinal rupture that require obligatory treatment. In our study, the success rate was 94%. No major complications attributable to laser treatment were noted.

Aim: To evaluate the long term results of argon laser iridotomy in neovascular glaucoma with previous primary angle-closure glaucoma., Patients and Methods: The study included 186 glaucomatouse eyes of 160 patients who had over a 10-year chronic primary angle-closure glaucoma. Inclusion criterion was later associated neovascular activities in the anterior globe segment, due to prolipherative diabetic retinopathy or central retinal vein occlusion. All the patients were treated with preparatory stretch burns of 200 u spot size, 0.2 sec. exposure and 200 mW power, and than with penetration burns of 50 u, 0.2 sec. and 1000 mW. until the transillumination appear., Results: The iris falls back and the peripheral anterior chamber deepens in 90% of the treated eyes., Conclusion: Argon laser iridotomy is safely than any other method to deepen the anterior chamber when rubeosis of the iris is associated to primary angle--closure glaucoma.

Multiple sclerosis (MS) is an inflammatory disease of unknown etiology involving the central nervous system. Certain clinical manifestations affect the oro-facial region. Three in particular should be of interest to the dentist: trigeminal neuralgia, sensory neuropathy of the trigeminal nerve and facial palsy. The aim of this study was to determine the oral health status, the frequency of subjective symptoms and temporomandibular disorders (TMD) subtype according to Research diagnostic criteria for temporomandibular disorders (RDC/TMD) among MS patients. Examinees in this study were 50 patients suffering from MS, who were at least once treated during their disease in the Clinic Hospital Center, Rijeka, Clinic for Neurology. All examinees had to meet the diagnostic criteria for clinically and laboratory confirmed MS, according to Poser. The results show the difference in mean DMFT (decayed, missing, filled teeth) between MS and the control group. The number of decayed and missing teeth was higher, but the number of filled teeth was significantly lower in MS group. Eighty-two per cent of the subjects with MS had a least one symptom of dysfunction compared with 24% of the subjects in the healthy control group. In the present study, pain, the pain during mouth opening, the difficulty with mouth opening and temporomandibular joint (TMJ) sounds were more commonly reported in the MS group than in the control group. This study shows a statistically significant excess of dental caries and temporomandibular disorders among MS patients compared with the control group. These results suggest that MS is a possible etiological factor in temporomandibular disorders.

In this study, we investigated and analysed clinical efficacy and tolerability of moxifloxacin, a new quinolone antibiotic, for the outpatient treatment of bacterial respiratory infections--acute exacerbation of chronic obstructive pulmonary disease (AE-COPD), pneumonia and acute sinusitis. The study was post-marketing and observational, and was conducted after the registration and listing of moxifloxacin in commercial distribution in Croatia. A total of 84 physicians throughout Croatia participated in this study that included 440 patients, 231 with clinically confirmed diagnosis of AE-COPD, 103 with pneumonia and 46 with acute sinusitis. According to physicians, evaluation, 96.8% of the patients were cured. The improvement was recorded on the average after 3.2 days and cure after 6.4 days from the beginning of treatment. Adverse events (48 side effects) were recorded in 40 patients, most commonly suffering from milder gastrointestinal symptoms (nausea, diarrhoea). Serious adverse events were not recorded (phototoxicity, severe hepatic impairment, cardiotoxicity). Moxifloxacin tolerability and patient compliance during treatment were rated as excellent in three-quarters of the patients. Physicians stated they would again prescribe moxifloxacin in 415 or 94.3% of the patients.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Background and Aims: Overexpression of p53 protein in malignancies induces an immune response in some cancer patients. We investigated whether production of serum antibodies against p53 (p53-Ab) is associated with pathohistological parameters of colorectal carcinoma and whether p53-Ab can serve as a tumor marker during cancer treatment., Patients and Methods: Serum samples from 220 colorectal cancer patients during surgery and adjuvant chemotherapy and 42 healthy controls were tested for the presence of p53-Ab by ELISA. Expression of p53 protein in tumors was determined using mouse anti-human p53-Ab., Results: Serum p53-Ab were detected in 18% of patients while all controls were negative. A strong correlation between p53-Ab production and p53 protein expression was observed: 70% of p53-Ab positive cases had tumors positive for p53 vs. 52% of p53-Ab negative cases. There was also a significant predominance of p53-Ab positive cases in Dukes' stages B and C over stage A. Although surgery alone reduced p53-Ab levels, decreases in p53-Ab titer became significant midterm through chemotherapy compared to both pre- and postoperative values and remained decreased until the completion of treatment., Conclusion: The presence of p53-Ab in sera of patients with colorectal cancer indicates tumors in more advanced histopathologic stages (Dukes' B, C). Due to low sensitivity (18%) p53-Ab are not recommendable as a preoperative marker for colorectal cancer. However, due to high specificity (100%), their monitoring after surgery and adjuvant chemotherapy has potential for early diagnosis of tumor relapse in p53-Ab positive cases.

The study examines the relationships between different craniometric distances and the nasion-gnathion (N-Gn) distance which represents the lower two thirds of the face in vertical dimension determination. The highest degree of correlation (r = 0.9217; p < 0.05) was observed between the N-Gn and zygion-zygion (Zy-Zy) distances. The N-Gn distance could be determined using the formula N-Gn = Zy-Zy/1.15 or by means of regression analysis: N-Gn = 0.54749 + 0.82822 x Zy-Zy. Considering that the coefficient of correlation between N-Gn and Zy-Zy was higher than the one between the eye-ear (E-E) and the subnasale-gnathion (Sn-Gn) distances reported earlier (r = 0.8676) it was concluded that calculating the N-Gn distance from the Zy-Zy distance was more reliable. The fact that none of the calculated correlation coefficients was 1, but was lower than 1, points to the presence of individual variations of the cephalometric parameters. Although the method cannot be taken as absolutely reliable, owing to its simplicity and practical applicability it can be recommended for use in everyday clinical practice in combination with other methods for the determination of the vertical dimension of occlusion.

This study uses the intraoral microdensitometric method to examine the impact of masticatory pressure on the alveolar bone around the abutment teeth clasp. Two retroalveolar radiographs were carried out on all 30 subjects over a period of 3 months using a copper calibration stepwedge. The dental radiographs were digitized and converted into positive. Grey level values on dental radiographs in the alveolar bone area in 7 region of interest (ROI) were measured. They were converted into the equivalent thickness of the calibration stepwedge using mathematical methods and the difference of the bone density between the two radiographs was calculated. The results demonstrated that there were no statistically significant differences between the 1st and 2nd radiographs in any of ROI (p > 0.05).

Introduction: Ventricular fibrillation (VF) presents a complete disintegrated myocardial activity associated with hemodynamic collapse and loss of consciousness requiring urgent reanimation. VF mostly occurs following myocardial infarction and endstage of ischemic heart disease in patients with ejection fraction less than 30%., Material and Methods: This paper analyzes occurrence of VF following coronary artery revascularization in patients undergoing surgery at the Institute of Cardiovascular Diseases in Sremska Kamenica. During the period 1994-1998, 3.186 patients underwent coronary artery revascularization procedure, whereas following it VF occurred in 20 patients (0.63%)., Results and Discussion: In all patients VF presented in the first postoperative week, while in 16 patients it occurred in the first 3 days following surgery. Nine patients with VF underwent left coronary artery revascularization with endarterectomy, 9 patients underwent right coronary artery revascularization with endarterectomy. One patient had a left-ventricular aneurysmectomy and 80% of patients had low ejection fraction rate--20-35%. After VF in 75% of patients urgent reoperation was performed, and only one suffered from thrombotic occlusion, that is perioerative infarction. After defibrillation patients were treated with xylocaine, amiodarone and beta-blockers. During the 30-day period following surgery, there were no lethal outcomes, whereas in the 24-month period after surgery 3 patients died. Cardiac-related death occurred in one patient, while two died due to cerebral insult., Conclusion: VF was not a frequent complication in our patients. Effective antiarrhythmic drugs prevent repeated VF. Beta-blockers, xy-locaine and amiodarone are drugs of choice for the treatment of malignant cardiac rhythm disturbances.

We investigated the prevalence of DPC4 loss of heterozygosity in sporadic colorectal cancer. Thirty-six cases of human sporadic colon carcinoma and corresponding normal tissue samples were examined to evaluate loss of heterozygosity at the DPC4 tumor suppressor locus using variable nucleotide tandem repeat (VNTR) analysis and three polymorphic markers. From 36 analyzed samples 35 (97%) were heterozygous or informative. Loss of heterozygosity at the DPC4 locus was detected in 18 (51%) of informative tumor DNAs. The DPC4 LOH was more frequent in smaller tumors (<5 cm) than in larger ones. There was no correlation between DPC4 LOH and age or sex of patients. There was a negative correlation between DPC4 LOH and histological grade or Dukes' stage of tumors, but without statistic significance. Observed results are in agreement with the view that malignant progression is consequence of many genetic changes. It can be concluded that inactivation of the DPC4 gene plays a role in a multistep process of outgrowth and progression of colon cancer.

Purpose: Nonsteroidal anti-inflammatory drugs lower the incidence of and mortality from colon cancer. In this paper, we present the effect of indomethacin on growth inhibition and alterations in the expression of several genes involved in cell cycle and apoptosis in CaCo-2 colon adenocarcinoma cells., Methods: We used the MTT test to evaluate the effect of indomethacin on the proliferation rate of colon cancer and normal fibroblast cells in vitro. The expression of c-myc oncoprotein and p53 and p27 suppressor proteins was examined using the immunocytochemical method., Results: We have shown that indomethacin reduces the proliferation rate of CaCo-2 colon cancer cells (up to 60% at the concentration of 4 x 10(-4) M), alters their morphology, and induces cell death by apoptosis. The most pronounced inhibitory effect was observed at the concentration of 6 x 10(-4) M where the growth was completely suppressed. However, the growth of normal fibroblasts (Hef 522) was much less inhibited (about 30% of inhibition at the concentration of 6 x 10(-4) M). Indomethacin reduces the proliferation rate and induces apoptosis in CaCo-2 colon cancer cells through enhanced expression of c-myc, p53, and p27 proteins., Conclusions: This is the first report about p27-increased expression in colon carcinoma cells induced by indomethacin treatment. Increased expression of p27 represents a new mechanism of apoptosis in cells treated with NSAIDs (indomethacin). This effect probably contributes to the anti-proliferative effect on colon cancer cells in vitro.

In this study pigmented glaucoma was diagnosed in 29 out of 4350 patients suffering from glaucoma. In clinical analysis of those cases main attention was put on Krukenberg spindle with emphasis on the process and reason of its development. In all cases of Krukenberg spindle moderate myopia and myopic astigmatism were present. The main axis of the spindle lies in the principal meridian of corneal astigmatism. The principal meridian of the anterior cornea surface corresponds with the axis of the principal meridian of the posterior corneal surface. The higher degree of astigmatism more pronounced Krukenberg spindle. This corresponds to a number of cases in which the spindle is hardly recognisable in the astigmatism, of only +/- 0.25 to +/- 0.50 Dcyl. The axis of meridian corresponds to direct astigmatism (from 110 degrees to 70 degrees). The authors conclude that there is no pigmented Krukenberg spindle without myopic astigmatism. It is for this reason and because of the inheritance factor that this type of glaucoma should be considered primary glaucoma and a separate clinical entity.

Twenty-eight patients with rhegmatogenous retinal detachment were treated by pneumatic retinopexy using intravitreal perfluorpropane (C3F8) gas. Reattachment was successfully achieved in 22 eyes (78.6%) after one treatment. Most of the eyes were myopic and had a single retinal break or group of breaks within one o'clock hour. All retinal complications developed in the inferior retinal quadrants with postoperative proliferative vitreoretinopathy (PVR) as one of the most serious complications, occurring in 3 (10.7%) eyes. New retinal breaks developed in 2 (7.1%) eyes.

The paper describes the use of an objective method for the quantitative analysis of the relationship between the posterior cross-bite and the occurrence of occlusive interferences and damages to the mandible muscle elevator. Two groups of subjects were selected for the analysis: 10 patients with unilateral cross-bite and 10 students without any symptoms of temporomandibular disorders (TMD). By means of the Robert Jenkelson K5A kinesiograph we measured maximal opening velocity of the mandible (mm/s), maximal-closing velocity (mm/s), first tooth contact velocity and displacement in the vertical plane at the maximal intercuspidation (mm). The following values were obtained: maximal-opening velocity in the first group was 349 mm/s and 380 mm/s in the control group. This difference was incidental. The maximal closing velocity in the study group was 204.9 and 345.2 in the control group (p < 0.05). The first tooth contact velocity in the study group was 75.93 and 325 in the control group (p < 0.01). Displacements in the vertical plane at the maximal intercuspidation in the investigated group was 0.24 +/- 0.01 mm, while in control group that value was 0.12 +/- 0.012 mm.

Introduction: Arrhythmogenic right ventricular dysplasia (ARVD), disease of uncertain etiology, is characterized by fibrofatty collections in the right ventricular myocardium, premature ventricular complexes with left bundle branch block (LBBB) morphology, ventricular tachycardia and fibrillation., Goals: To point out diagnostic methods for this progressive disease and to analyze differential diagnosis and significance of arrhythmogenic right ventricular dysplasia in young, active athletes., Results: Arrhythmogenic right ventricular disease can be asymptomatic or manifested (syncope). It is not uncommon that the first evidence of the disease is ventricular tachycardia/fibrillation or sudden cardiac death. Results of electrocardiography, echocardiography, invasive and other methods can, even after few years, be negative for ARVD. The most significant ECG features are inverese T wave in precordial V1-V3 leads and widened QRS complex (> 120 ms) in V1 lead. Significant echocardiographic features and data obtained by invasive hemodynamic examinations are: dilated right ventricle, left and right ventricular end-diastolic diameter ratio less then 0.5, hypokinetic/akinetic areas involving the wall of the right ventricle, predominantly inferobasal, apical and wall of the left ventricular outflow tract. Findings may also include deep fissures among hypertrophied trabeculae. Biopsy may reveal fibrofatty tissue in hypo/akinetic regions of the right ventricular myocardium., Discussion and Conclusion: Since arrhythmogenic right ventricular dysplasia is diagnosed in predominantly young population, not uncommonly athletes, and since it may be cause of sudden cardiac death, there must be a high degree of suspicion in cases with activity related VT/VF and positive family history (it is proposed that it is a hereditary disease).

Introduction: Magnesium is an oligo-element which has an important effect on the myocardial function and peripheral vascular system., Material and Methods: The experiences of other authors as well as other papers have been analyzed., Results: Magnesium participates in over 300 enzymatic reactions in the human organism. It may be found in drinking water and food through which it is substituted. According to WHO, there is a good correlation between Ca++/Mg++ ratio in drinking water and frequency of cardiac events. Higher Mg++ quantity reduces coronary disease. Decreased Mg++ quantity in plasma has been registered in patients with acute myocardial infarction (AMI), coronary patients and patients with heart failure. Various rhythm disturbances, particularly Torsade de points are related to hypomagnesemia. Diuretics and some cytostatics, and antibiotics decrease Mg++ in plasma, erythrocytes and muscles. Decreased Mg++ have been found in alcoholics, diabetics and Crohn disease, which are in certain cases related to existing heart rhythm disturbances. In cardiology it is proved that Mg++ are beneficial in AMI, protection during open heart surgery and treatment and prevention of heart surgery and heart rhythm disturbances. The use of Mg++ in vasospastic angina pectoris, Raynaud's disease and cardiomyopathies due to cytostatics is still in the process of investigation. It is still a matter of discussion whether Mg++ should be administered in these conditions or only when its quantities are reduced. Do Mg++ values in plasma indicate its total presence in the organism? Where should Mg++ be administered as therapy, in which doses and how rapidly? Should preventive addition of Mg++ in drinking water reduce heart disease and prolong life? There are neither many answers nor real conclusions on Mg++ significance in cardiology. However, some encouraging results about its use indicate the significance of further investigations., Discussion: It has been accepted by the authors all over the world that the role of magnesium is of great importance in prevention and treatment of cardiac patients., Conclusion: Our first experiences are in accordance with other studies.

We examined 36 cases of human sporadic colon carcinoma and corresponding normal tissue samples to evaluate loss of heterozygosity at the APC and DCC tumor suppressor genes loci using restriction fragment length polymorphism polymerase chain reaction and variable nucleotide tandem repeat analysis. Observed informativity was 83% for APC and 75% for DCC. DNA from 6 (20%) of 30 informative tumors exhibited loss of heterozygosity at the APC locus. Loss of heterozygosity at the DCC locus was observed in 7 (26%) of 27 informative tumor DNAs. Our results support the view that malignant progression is a consequence of more than one genetic change and suggest that inactivation of APC and DCC genes plays a role in a multistep process of colon tumor progression.

Sudden death occurs unexpectedly, within 24 hours after the onset of subjective symptoms with or without known preexisting conditions. According to Framingham Heart Study, during a 20-year follow-up, 13% of deceased have died of sudden death. Most frequently it occurs in the first 6 months in infants and in the period 45-75 years of age. In more than 80% of cases sudden death is caused by coronary disease, while in 5% of cases the cause is cerebrovascular insult. The mechanism of sudden death is ventricular fibrillation in 65-85%, ventricular tachycardia in 7-10% and electromechanical dissociation in 20-30%. Sometimes sudden death may be caused iatrogenically, by drug intoxication, catheterization and reflex mechanisms--vasovagal reflex and sinus caroticus reflex. Pathoanatomical finding can be positive on myocardium like fibrosis, edema, individual necrosis, cell infiltration or it can be unchanged. In cases of heart failure, resuscitation is performed: airway maintenance, artificial respiration, artificial circulation, drug therapy and electrotherapy. Prevention of sudden death means detection of high-risk patients and application of medical treatment in order to postpone it. Coronary patients with sustained myocardial infarction and ejection fraction lower than 30% and registered tachycardia represent high-risk patients.

Unlabelled: Shock is a consequence of disturbed circulation and decreased blood perfusion of tissues which, on the whole, cause functional and morphological impairments of organic systems. Occurrence of shock is not high, but it is significant due to bad prognosis and high mortality rate., Classification: This is one of the classifications of shock: cardiogenic, extracardiogenic-obstructive, oligentic and distributive shock. PATHOPHYSIOLOGIC MECHANISMS OF SHOCK: Regardless of the cause of shock, the clinical picture is dominated by hypotension mostly caused by decrease of minute volume (septic shock may be an exception--minute volume might be high). Due to hypotension a lot of compensatory mechanisms are activated and in the beginning showing the compensatory phase of disease and if nothing is done decompensatory and in the end irreversible phase of shock occurs with fatal outcome. The clinical picture depends on the etiology of shock, type of shock, but it also has certain specificities., Prognosis: The prognosis depends on the clinical picture dominated by the following symptoms: hypotension, decreased diuresis, acidosis, consciousness disorders, tachypnea, peripheral cyanosis, cold and damp skin., Management: These patients are managed in intensive care units, where the following parameters are followed-up: arterial pressure, central venous pressure, minute heart volume, systemic vascular resistance, diuresis, continual follow-up of heart rate, breathing and consciousness. In treatment of shock it is necessary to: normalize the circulatory volume, establish electrolyte balance, regulate glycemia and acid-base status, compensate the volume, calm the patient and alleviate pain.

Introduction: The objective of this study was to examine the occurrence of asymptomatic myocardial ischemia prior to and after myocardial revascularization in patients with multivessel occlusive coronary disease. Asymptomatic ischemia can be described as real ischemia without anginal pain or other ischemic symptoms in patients with coronary disease or coronary artery spasm. Our study examined silent ischemia after myocardial revascularization. Early detection of silent ischemia is important for prevention of cardiac incidents., Material and Methods: We have examined patients with multivessel coronary disease with occurrence of continued preoperative silent ischemia. All patients have undergone ECG examination, exercise stress test and Holter-monitoring prior to and after myocardial revascularization., Results: The investigation comprised 27 patients and their average age was 54.5 years. All patients with silent ischemia had a multivessel occlusive coronary disease and have undergone myocardial revascularization managed with triple or quadruple aortocoronary bypass surgery. Exercise stress test was performed postoperatively in elder patients, as well as ECG and Holter-monitoring. Silent ischemia was established in 21.6% of patients, while in 87.5% untreated diabetes mellitus was diagnosed. Silent ischemia most often occurred in the early morning hours and it was frequently associated with heart rhythm disturbances (VES) whereas these rhythm disturbances depended on the length of the ischemic episode. Intermittent 2nd degree atrioventricular block was found in one patient., Conclusion: Silent myocardial ischemia occurred in 21% of patients after myocardial revascularization. It is most often detected in the early morning hours and is associated with ventricular rhythm disorders. Silent ischemia is easily detected by simple examination procedures providing adequate therapy and prevention of cardiac incidents.