Search

Background Campylobacter is a well-known bacterial pathogen for triggering acute gastroenteritis in humans both in developed and developing countries. This organism is highly resistant to fluoroquinolones. Macrolides are very much useful for the treatment of campylobacteriosis when clinical therapy is necessary. However, increasing resistance to azithromycin, a potent macrolide has been reported in Campylobacter in recent years. Macrolide resistance in Campylobacter is found mainly due to point mutation in V region of 23S rRNA. Results We have developed a PCR based assay, which can detect the azithromycin resistant and sensitive Campylobacter strains utilizing mutation responsible for the phenotype. This PCR was validated using 359 Campylobacter strains isolated from diarrhoeal patients at Kolkata, India. Antimicrobial resistance through disk diffusion method was also performed on these strains as a gold standard. Studies through sequencing analysis further confirmed the PCR result. Conclusion This study describes a simple and rapid method for detection of mutation conferring macrolide resistance with additional feature of identification of sensitive strains.

Vibrio cholerae O1 is the etiological agent of the severe diarrheal disease cholera. The bacterium has recently been causing outbreaks in Haiti with catastrophic effects. Numerous mutations have been reported in V. cholerae O1 strains associated with the Haitian outbreak. These mutations encompass among other the genes encoding virulence factors such as the pilin subunit of the toxin-co-regulated pilus (tcpA), cholera toxin B subunit (ctxB), repeat in toxins (rtxA), and other genes such as the quinolone resistance-determining region (QRDR) of gyrase A (gyrA), rstB of RS element along with the alteration in the number of repeat sequences at the promoter region of ctxAB. Given the numerous genetic changes in those Haitian isolates, we decided to investigate the possible origins of those variations in the Indian subcontinent. Thus, we determined the genetic traits among V. cholerae O1 strains in Delhi, India. A total of 175 strains isolated from cholera patients during 2004 to 2012 were analysed in the present study. Our results showed that all the tested strains carried Haitian type tcpA (tcpACIRS) and variant gyrA indicating their first appearance before 2004 in Delhi. The Haitian variant rtxA and ctxB7 were first detected in Delhi during 2004 and 2006, respectively. Interestingly, not a single strain with the combination of El Tor rtxA and ctxB7 was detected in this study. The Delhi strains carried four heptad repeats (TTTTGAT) in the CT promoter region whereas Haitian strains carried 5 such repeats. Delhi strains did not have any deletion mutations in the rstB like Haitian strains. Overall, our study demonstrates the sequential accumulation of Haitian-like genetic traits among V. cholerae O1 strains in Delhi at different time points prior to the Haitian cholera outbreak.

Helicobacter pylori, colonize in stomach of ~50% of the world population. cag pathogenicity Island of H. pylori is one of the important virulent factors that attributed to gastric inflammation. Coinfection with H. pylori strain with different genetic makeup alters the degree of pathogenicity and susceptibility towards antibiotics. The present study investigates host immunomodulatory effects of H. pylori infection by both cag + strain (SS1) and cag − strain (AM1). C57BL/6 mice were infected with AM1 or SS1 strain as well as AM1 followed by SS1 (AM1/SS1) and vice versa. Mice infected with AM1/SS1 strain exhibited less gastric inflammation and reduced proMMP9 and proMMP3 activities in gastric tissues as compared to SS1/SS1 and SS1/AM1 infected groups. The expression of both MMP9 and MMP3 followed similar trend like activity in infected tissues. Both Th1 and Th17 responses were induced by SS1 strain more profoundly than AM1 strain infection which induced solely Th1 response in spleen and gastric tissues. Moreover, IFN-γ, TNF-α, IL-1β and IL-12 were significantly downregulated in mice spleen and gastric tissues infected by AM1/SS1 compared to SS1/SS1 but not with SS1/AM1 coinfection. Surprisingly, IL-17 level was dampened significantly in AM1/SS1 compared to SS1/AM1 coinfected groups. Furthermore, number of Foxp3+ T-regulatory (Treg) cells and immunosuppressive cytokines like IL-10 and TGF-β were reduced in AM1/SS1 compared to SS1/SS1 and SS1/AM1 coinfected mice gastric tissues. These data suggested that prior H. pylori cag − strain infection attenuated the severity of gastric pathology induced by subsequent cag + strain in C57BL/6 mice. Prior AM1 infection induced Th1 cytokine IFN-γ, which reduced the Th17 response induced by subsequent SS1 infection. The reduced gastritis in AM1/SS1-infected mice might also be due to enrichment of AM1- primed Treg cells in the gastric compartment which inhibit Th1 and Th17 responses to subsequent SS1 infection. In summary, prior infection by non-virulent H. pylori strain (AM1) causes reduction of subsequent virulent strain (SS1) infection by regulation of inflammatory cytokines and MMPs expression.

The BabA adhesin mediates high-affinity binding of Helicobacter pylori to the ABO blood group antigen-glycosylated gastric mucosa. Here we show that BabA is acid responsive-binding is reduced at low pH and restored by acid neutralization. Acid responsiveness differs among strains; often correlates with different intragastric regions and evolves during chronic infection and disease progression; and depends on pH sensor sequences in BabA and on pH reversible formation of high-affinity binding BabA multimers. We propose that BabA's extraordinary reversible acid responsiveness enables tight mucosal bacterial adherence while also allowing an effective escape from epithelial cells and mucus that are shed into the acidic bactericidal lumen andthat bio-selection and changes in BabA bindingproperties through mutation and recombination with babA-related genes are selected by differencesamong individuals and by changes in gastric acidity over time. These processes generate diverse H.pylori subpopulations, in which BabA's adaptive evolution contributes to H.pylori persistence and overt gastric disease.

An outbreak of cholera struck Bihar, an Indian state, in August 2008 following a massive flood. Here we report the phenotypic and genotypic characteristics of Vibrio cholerae strains isolated from patients with diarrhea. Rectal swabs were obtained from patients with diarrhea who were admitted to medical camps or the hospital, and the strains were biochemically and serologically characterized. V. cholerae was isolated from 21 (65.6%) of 32 rectal swabs. Serological studies revealed that all the 21 isolates belonged to V. cholerae O1 Ogawa. Mismatch amplification mutation assay (MAMA)-PCR showed that the isolates belonged to El Tor variant group, and pulsed-field gel electrophoresis (PFGE) proved that these isolates were of a different lineage than the conventional El Tor variant strains. These isolates were resistant to several drugs, including ampicillin, streptomycin, tetracycline, nalidixic acid, and furazolidone. The uniqueness of the current report arises from the fact that records of cholera in Bihar are availiable for the early 1960s but not for the next 4 decades. Moreover, the present study is the first to report a cholera outbreak in Bihar that was caused by an El Tor variant strain.

Strains of the enteric pathogen Vibrio parahaemolyticus harboring the thermostable hemolysin (TDH) encoding gene tdh is known to cause epidemic and pandemic diarrhea. In industrialized countries, this pathogen causes sporadic or outbreaks of diarrheal illness associated with consumption of raw or improperly cooked seafood. This report describes a foodborne outbreak of gastroenteritis caused by V. parahaemolyticus in June 2011 following consumption of food served at a funeral reception held at Habra, North 24 Parganas, West Bengal, India. About 650 people attended the function, of whom 44 had acute watery diarrhea with other clinical symptoms; 35 of them were admitted to the District Hospital for the rehydration treatment. Stool specimens collected from three hospitalized cases were positive for V. parahaemolyticus, of which two strains were identified as an O4:K8 serovar and one was identified as O3:K6 serovar. The O3:K6 strain also possessed the pandemic group-specific toxRS gene target (GS), whereas the O4:K8 strains were negative. All strains were polymerase chain reaction-positive for tdh but were polymerase chain reaction-negative for trh. All of the strains were resistant to ampicillin but were pansensitive to other antimicrobials tested. Pulsed-field gel electrophoresis (PFGE) analysis using NotI showed that the O3:K6 strain was similar to that of a recent clinical strain from Kolkata, but had diverged from other strains during previous years. In contrast, PFGE analysis showed that the O4:K8 strains were closely related but differed from the Kolkata strain.

We identified 281 Vibrio cholerae non-O1, non-O139 strains from patients with diarrhea in Kolkata, India. Cholera-like diarrhea was the major symptom (66.0%); some patients (20.3%) had severe dehydration. These strains lacked the ctxA gene but many had hlyA, rtxA, and rtxC genes. Pulsed-field gel electrophoresis showed no genetic link among strains.

Background Helicobacter pylori, colonize in stomach of ~50% of the world population. cag pathogenicity Island of H. pylori is one of the important virulent factors that attributed to gastric inflammation. Coinfection with H. pylori strain with different genetic makeup alters the degree of pathogenicity and susceptibility towards antibiotics. The present study investigates host immunomodulatory effects of H. pylori infection by both cag + strain (SS1) and cag − strain (AM1). C57BL/6 mice were infected with AM1 or SS1 strain as well as AM1 followed by SS1 (AM1/SS1) and vice versa. Results Mice infected with AM1/SS1 strain exhibited less gastric inflammation and reduced proMMP9 and proMMP3 activities in gastric tissues as compared to SS1/SS1 and SS1/AM1 infected groups. The expression of both MMP9 and MMP3 followed similar trend like activity in infected tissues. Both Th1 and Th17 responses were induced by SS1 strain more profoundly than AM1 strain infection which induced solely Th1 response in spleen and gastric tissues. Moreover, IFN-γ, TNF-α, IL-1β and IL-12 were significantly downregulated in mice spleen and gastric tissues infected by AM1/SS1 compared to SS1/SS1 but not with SS1/AM1 coinfection. Surprisingly, IL-17 level was dampened significantly in AM1/SS1 compared to SS1/AM1 coinfected groups. Furthermore, number of Foxp3+ T-regulatory (Treg) cells and immunosuppressive cytokines like IL-10 and TGF-β were reduced in AM1/SS1 compared to SS1/SS1 and SS1/AM1 coinfected mice gastric tissues. Conclusions These data suggested that prior H. pylori cag − strain infection attenuated the severity of gastric pathology induced by subsequent cag + strain in C57BL/6 mice. Prior AM1 infection induced Th1 cytokine IFN-γ, which reduced the Th17 response induced by subsequent SS1 infection. The reduced gastritis in AM1/SS1-infected mice might also be due to enrichment of AM1- primed Treg cells in the gastric compartment which inhibit Th1 and Th17 responses to subsequent SS1 infection. In summary, prior infection by non-virulent H. pylori strain (AM1) causes reduction of subsequent virulent strain (SS1) infection by regulation of inflammatory cytokines and MMPs expression.

Vibrio cholerae causes cholera outbreaks in endemic regions where the water quality and sanitation facilities remain poor. Apart from biotype and serotype changes, V. cholerae undergoes phase variation, which results in the generation of two morphologically different variants termed smooth and rugose. In this study, 12 rugose (R-VC) and 6 smooth (S-VC) V. cholerae O1 Ogawa isolates were identified in a cholera outbreak that occurred in Hyderabad, India. Antimicrobial susceptibility results showed that all the isolates were resistant to ampicillin, furazolidone and nalidixic acid. In addition, R-VC isolates were resistant to ciprofloxacin (92 %), streptomycin (92 %), erythromycin (83 %), trimethoprim-sulfamethoxazole (75 %) and tetracycline (75 %). Based on the ctxB gene analysis, all the isolates were identified as El Tor variant with mutation in two positions of ctxB, similar to the classical biotype. The R-VC isolates specifically showed excessive biofilm formation and were comparatively less motile. In addition, the majority of these isolates (~83 %) displayed random mutations in the hapR gene, which encodes haemagglutinin protease regulatory protein. In the PFGE analysis, R-VC and S-VC were placed in distinct clusters but remained clonally related. In the ribotyping analysis, all the R-VC isolates exhibited R-III pattern, which is a prevailing type among the current El Tor isolates. A hapR deletion mutant generated using an S-VC isolate expressed rugose phenotype. To our knowledge, this is the first report on the association of rugose V. cholerae O1 in a large cholera outbreak with extended antimicrobial resistance and random mutations in the haemagglutinin protease regulatory protein encoding gene (hapR).

PURPOSE OF REVIEW The purpose of this review is to synopsize and highlight the recent subtle genetic changes in cholera causing toxigenic Vibrio cholerae with special reference to their virulence, integrating and conjugative elements and toxin-antitoxin systems. It is not intended to cover issues on the whole genome sequence and epidemiology of cholera. RECENT FINDINGS Analyses have been made using major published works on genetic changes associated with potential virulence, integrating and conjugative elements and toxin-antitoxin systems of toxigenic V. cholerae. During the course of evolution, V. cholerae strains show evidence of genetic selection for the expression of additional virulence, better survival in the environment, colonization ability and antimicrobial resistance. Some of the critical modifications that occurred at the molecular level include CTXϕ genome, cholera toxin B-subunit, integrating and conjugative elements and toxin-antitoxin systems. Frequent changes in the genome of V. cholerae appear to be an ongoing dynamic process that is assisting the pathogen to subtly change during or after epidemics of cholera. SUMMARY Cholera is a reemerging public health problem. Continued basic research is important to understand the changing dynamics of bacterial virulence, survival strategies and disease pathogenesis for efficient therapeutic intervention and to abort transmission of the disease.

Incidence of epidemic Vibrio cholerae serogroup O139 has declined in cholera endemic countries. However, sporadic cholera caused by V. cholerae O139 with notable genetic changes is still reported from many regions. In the present study, 42 V. cholerae O139 strains isolated from 2001 to 2006 in Delhi, India, were retrospectively analyzed to understand their phenotype and molecular characteristics. The majority of isolates were resistant to ampicillin, furazolidone and nalidixic acid. Though the integrative conjugative element was detected in all the O139 isolates, the 2004-2006 isolates remained susceptible to co-trimoxazole, chloramphenicol, and streptomycin. Cholera toxin genotype 1 was present in the majority of the O139 isolates while few had type 3 or a novel type 4. In the cholera toxin encoding gene (ctx) restriction fragment length polymorphism, the majority of the isolates harbored three copies of CTX element, of which one was truncated. In this study, the ctx was detected for the first time in the small chromosome of V. cholerae O139 and one isolate harbored 5 copies of CTX element, of which 3 were truncated. The ribotype BII pattern was found in most of the O139 isolates. Three V. cholerae O139 isolated in 2001 had a new ribotype BVIII. Pulsed-field gel electrophoresis analysis revealed clonal variation in 2001 isolates compared to the 2004-2006 isolates. Molecular changes in V. cholerae O139 have to be closely monitored as this information may help in understanding the changing genetic features of this pathogen in relation to the epidemiology of cholera.

Background: Almost all Helicobacter pylori infected person develop gastritis and severe gastritis is supposed to be the denominator of peptic ulcer diseases, which may lead to gastric cancer. However, it is still an enigma why few strains are associated with ulcer formation, while others are not related with any disease outcome. Although a number of putative virulence factors have been reported for H. pylori, there are contradictory results regarding their connotation with diseases. Recently, there has been a significant attention in strain-specific genes outside the cag pathogenicity island, especially genes within plasticity regions. Studies demonstrated that certain genes in this region may play important roles in the pathogenesis of H. pylori-associated diseases. The aim of this study was to assess the role of selected genes (jhp0940, jhp0945, jhp0947 and jhp0949) in the plasticity region in relation to risk of H. pylorirelated diseases in Indian population. Methods: A total of 113 H. pylori strains isolated from duodenal ulcer (DU) (n = 61) and non-ulcer dyspepsia (NUD) subjects (n = 52) were screened by PCR and Dot-Blot to determine the presence of these genes. The comparative study of IL-8 production and apoptosis were also done by co-culturing the AGS cells with H. pylori strains of different genotype. Results: PCR and Dot-Blot results indicated that the prevalence rates of jhp0940, jhp0945, jhp0947 and jhp0949 in the H. pylori strains were 9.8, 47.5, 50.8, 40.9 % and 17.3, 28.8, 26.9, 19.2 % isolated from DU and NUD, respectively. IL-8 production and apoptotic cell death were significantly higher in H. pylori strains containing jhp0945, jhp0947 and jhp0949 than the strains lacking those genes. Results indicated that the prevalence of jhp0945, jhp0947 and jhp0949 are associated with increased risk of severe diseases in India. Conclusion: Our study showed that presence of jhp0945, jhp0947 and jhp0949 were significantly associated with symptomatic expressions along with the increased virulence during in vitro study whereas jhp0940 seems to be negatively associated with the disease. These results suggest that jhp0945, jhp0947 and jhp0949 could be useful prognostic markers for the development of duodenal ulcer in India.

The babA2 gene along with the cagA and vacA of Helicobacter pylori has been considered as a risk factor for the disease outcome in certain populations. This study was aimed to understand the role of babA2 of H. pylori with the background of cagA and vacA in disease manifestations in Indian sub population. A total of 114 H. pylori strains isolated from duodenal ulcer (DU) (n = 53) and non-ulcer dyspepsia (NUD) patients (n = 61) were screened for the prevalence of these virulence markers by PCR. The comparative study of IL-8 production and apoptosis were done by co-culturing the AGS cell line with H. pylori strains with different genotypes. Adherence assay was performed with babA2 positive and negative strains. Two isogenic mutants of babA2 were constructed and the aforesaid comparative studies were carried out. PCR results indicated that 90.6 % (48/53), 82 % (50/61) and 73.6 % (39/53) strains from DU patients were positive for cagA, vacA, and babA2, respectively. Whereas the prevalence of these genes in NUD subjects were 70.5 % (43/61); 69.8 % (37/53), and 65.6 % (39/61), respectively. Although adherence to AGS cells was comparable among strains with babA2 positive and negative genotypes, but the triple positive strains could induce highest degree of IL-8 production and apoptosis, followed by the cagA −/vacA −/babA2 + strains and triple negative strains, respectively. The wild type strains showed significantly higher IL-8 induction as well as apoptosis in ex vivo than its isogenic mutant of babA2. PCR study demonstrated that there was no significant association between the distribution of babA2 genotype or of triple positive strains and disease outcome in this sub population. The adherence assay showed that there was no significant difference in the extent of adherence to AGS cells among babA2 positive and negative strains. But the ex vivo study indicated that the triple positive or even the babA2 only positive strains are involved in increased virulence. The wild type strains also exhibited increased virulence compared to the babA2 mutant strains. This inconsistency demonstrated that bacterial genotype along with host genetic polymorphisms or other factors play important role in determining the clinical manifestation of H. pylori infections.

DNA replication in Helicobacter pylori is initiated from a unique site (oriC) on its chromosome where several proteins assemble to form a functional replisome. The assembly of H. pylori replication machinery is similar to that of the model gram negative bacterium Escherichia coli except for the absence of DnaC needed to recruit the hexameric DnaB helicase at the replisome assembly site. In the absence of an obvious DnaC homologue in H. pylori, the question arises as to whether HpDnaB helicase is loaded at the Hp-replication origin by itself or is assisted by other unidentified protein(s). A high-throughput yeast two-hybrid study has revealed two proteins of unknown functions (Hp0897 and Hp0340) that interact with HpDnaB. Here we demonstrate that Hp0897 interacts with HpDnaB helicase in vitro as well as in vivo. Furthermore, the interaction stimulates the DNA binding activity of HpDnaB and modulates its adenosine triphosphate hydrolysis and helicase activities significantly. Prior complex formation of Hp0897 and HpDnaB enhances the binding/loading of DnaB onto DNA. Hp0897, along with HpDnaB, colocalizes with replication complex at initiation but does not move with the replisome during elongation. Together, these results suggest a possible role of Hp0897 in loading of HpDnaB at oriC.

Summary Background Zanzibar, in east Africa, has been severely and repeatedly affected by cholera since 1978. We assessed the effectiveness of oral cholera vaccination in high-risk populations in the archipelago to estimate the indirect (herd) protection conferred by the vaccine and direct vaccine effectiveness. Methods We offered two doses of a killed whole-cell B-subunit cholera vaccine to individuals aged 2 years and older in six rural and urban sites. To estimate vaccine direct protection, we compared the incidence of cholera between recipients and non-recipients using generalised estimating equations with the log link function while controlling for potential confounding variables. To estimate indirect effects, we used a geographic information systems approach and assessed the association between neighbourhood-level vaccine coverage and the risk for cholera in the non-vaccinated residents of that neighbourhood, after controlling for potential confounding variables. This study is registered with ClinicalTrials.gov, number NCT00709410. Findings Of 48 178 individuals eligible to receive the vaccine, 23 921 (50%) received two doses. Between February, 2009, and May, 2010, there was an outbreak of cholera, enabling us to assess vaccine effectiveness. The vaccine conferred 79% (95% CI 47–92) direct protection against cholera in participants who received two doses. Indirect (herd) protection was shown by a decrease in the risk for cholera of non-vaccinated residents within a household's neighbourhood as the vaccine coverage in that neighbourhood increased. Interpretation Our findings suggest that the oral cholera vaccine offers both direct and indirect (herd) protection in a sub-Saharan African setting. Mass oral cholera immunisation campaigns have the potential to provide not only protection for vaccinated individuals but also for the unvaccinated members of the community and should be strongly considered for wider use. Because this is an internationally-licensed vaccine, we could not undertake a randomised placebo-controlled trial, but the absence of vaccine effectiveness against non-cholera diarrhoea indicates that the noted protection against cholera could not be explained by bias. Funding Bill & Melinda Gates Foundation, Swedish International Development Cooperation Agency, and the South Korean Government.

A novel virulence factor, duodenal ulcer-promoting gene A (dupA), in Helicobacter pylori has been found to be associated with disease in certain populations but not in others. This study analysed a South-east Indian population as part of the debate about the relevance of dupA for the prediction of clinical outcomes. A total of 140 H. pylori strains isolated from duodenal ulcer (DU) (n = 83) and non-ulcer dyspepsia (NUD) patients (n = 57) were screened by PCR and dot-blot hybridization to determine the presence of the ORFs jhp0917 and jhp0918. Part of jhp0917-jhp0918 was sequenced to search for the C/T insertion that characterizes dupA and the levels of dupA transcripts were also assessed. The PCR and dot-blot results indicated the presence of jhp0917 and jhp0918 in 37.3 % (31/83) and 12.2 % (7/57) of H. pylori strains isolated from DU and NUD patients, respectively. Sequencing analysis showed insertion of a C at nt 1386 in the 3' region of jhp0917, forming the dupA gene in 35 strains. RT-PCR analysis detected the dupA transcript in 28 of these 35 strains. The expression level of the dupA transcript varied from strain to strain, as shown by real-time PCR. The results demonstrated that analysis based on PCR only for dupA may produce an erroneous interpretation. The prevalence of dupA was significantly greater among strains isolated from patients with DU than from patients with NUD in this population (P = 0.001, odds ratio = 4.26, confidence interval = 1.60-11.74). Based on these findings, dupA can be considered a biomarker for DU patients in India. The reported discrepancies for this putative virulence marker in different populations may be due to the genome plasticity of H. pylori.

The genome of Helicobacter pylori is rich in restrictionmodification (RM) systems. Approximately 4% of the genome codes for components of RM systems. hpyAVIBM, which codes for a phase-variable C5 cytosine methyltransferase (MTase) from H. pylori, lacks a cognate restriction enzyme. Over-expression of M.HpyAVIB in Escherichia coli enhances the rate of mutations. However, when the catalytically inactive F9N or C82W mutants of M.HpyAVIB were expressed in E. coli, mutations were not observed. The M.HpyAVIB gene itself was mutated to give rise to different variants of the MTase. M.HpyAVIB variants were purified and differences in kinetic properties and specificity were observed. Intriguingly, purified MTase variants showed relaxed substrate specificity. Homologues of hpyAVIBM homologues amplified and sequenced from different clinical isolates showed similar variations in sequence. Thus, hpyAVIBM presents an interesting example of allelic variations in H. pylori where changes in the nucleotide sequence result in proteins with new properties.

A sensitive rRNA-targeted reverse transcription-quantitative polymerase chain reaction (RT-qPCR) method was developed for detection of Vibrio cholerae/mimicus, V. parahaemolyticus/alginolyticus and Campylobacter jejuni/coli by using specific primers. Counts of the enteric pathogens spiked in human stools were quantified at the lower detection limit of 10(3) cells/g stool by RT-qPCR, in marked contrast with conventional quantitative polymerase chain reaction (qPCR) at the detection limit of 10(5) to 10(6) cells/g stool. The bacterial counts determined by RT-qPCR were almost equivalent to those determined by the culture method and fluorescence in situ hybridization (FISH) during the course of in vitro culture. Bacterial rRNA in the stools was stable for at least 4 weeks when the stools were kept as the suspensions in RNA-stabilizing agent, RNAlater®, even at 37(o) C. These data suggested that the rapid and high sensitive rRNA-targeted RT-qPCR was applicable for the accurate quantification of viable enteric pathogens, such as V. cholerae/mimicus, V. parahaemolyticus/alginolyticus and C. jejuni/coli.

SUMMARYNew variants ofVibrio choleraeO1 have appeared in different time-frames in various endemic regions, especially in Asia and Africa. Sixty-nine strains ofV. choleraeO1 isolated in Zambia between 1996 and 2004 were investigated by various genotypic techniques to determine the lineage of virulence signatures and clonality. All strains were positive forVibrioseventh pandemic Islands (VSP)-I and VSP-II and repeat toxin (RTX) gene clusters attesting their El Tor lineage. Interestingly, strains isolated in recent times (2003–2004) were identified as an altered variant (El Tor biotype that harbours El Tor typerstRbut produce classicalctxB) that replaced completely the progenitor El Tor strains prevalent in 1996–1997. Recent altered variant strains differed from prototype El Tor strains isolated earlier in that these strains lacked two ORFs, VC0493 and VC0498, in the VSP-II region. PFGE analysis revealed two major clonal lineages in the strains; cluster A represented the strains isolated before 2003 and cluster B the altered strains isolated in 2003–2004. Cluster A was closely related to prototype El Tor reference strain isolated in Bangladesh in 1971. Cluster B was found to be matched with Bangladeshi altered strains but was different from the hybrid strains isolated from Mozambique and Bangladesh. This report provides important information on the genesis of altered strains ofV. choleraeO1 isolated in Zambia and emphasizes the need for further studies to follow the trends of evolutionary changes.

Several genes including the cagA in the cag pathogenicity island (cag PAI) of Helicobacter pylori are thought to be associated with the gastroduodenal diseases and hence variation in the genetic structure of the cag PAI might be responsible for different clinical outcomes. Our study was undertaken to characterize the cag PAI of H. pylori strains from duodenal ulcer (DU) patients and asymptomatic or non-ulcer dyspepsia (NUD/AV) subjects from Kolkata, India. Strains isolated from 52 individuals (30 DU and 22 NUD/AV) were analyzed by PCR using 83 different primers for the entire cag PAI and also by dot-blot hybridization. Unlike H. pylori strains isolated from other parts of India, 82.6% of the strains used in this study had intact cag PAI, 9.6% had partially deleted cag PAI, and 7.7% of the strains lacked the entire cag PAI. Dot-blot hybridization yielded positive signals in 100% and 93.8% of PCR-negative strains for HP0522-523 and HP0532-HP0534 genes, respectively. An intact cagA promoter region was also detected in all cagA-positive strains. Furthermore, the expression of cagA mRNA was confirmed by RT-PCR for the representative strains from both DU and NUD/AV subjects indicating the active cagA promoter regions of these strains. A total of 66.7% of Kolkata strains produced a ~390-bp shorter amplicon than the standard strain 26695 for the HP0527 gene, homologue of virB10. However, sequence analyses confirmed that the deletion did not alter the reading frame of the gene, and mRNA transcripts were detected by RT-PCR analysis. The strains isolated from DU and NUD/AV express CagA protein and possess a functional type IV secretion system, as revealed by Western blot analyses. Interestingly, no significant differences in cag PAI genetic structure were found between DU and NUD/AV individuals suggesting that other bacterial virulence factors, host susceptibility, and environmental determinants also influence the disease outcome at least in certain geographical locations.

Objective: Helicobacter pylori resistance toward commonly used antibiotics is increasing leading to the treatment failure; hence, our aim is to determine the antibiogram susceptibility pattern of H. pylori strains isolated from Guwahati, Assam (Northeast India) and also to test the efficacy of the Brassica capitata against the multi and dual drug-resistant strains of North and Northeast India.Methods: Minimum inhibitory concentration of different antibiotics was determined by agar dilution method. Disc diffusion method was used to check the efficacy of B. capitata against clarithromycin (CLR), metronidazole (MTZ), and levofloxacin (LEV)-resistant H. pylori strains.Results: All the H. pylori strains were 100% sensitive to CLR, tetracycline, amoxicillin, and furazolidone. 72.8% of the strains were sensitive toward MTZ and 54.5% were sensitive toward LEV. B. capitata showed good efficacy against the resistant strains of H. pylori of North and Northeast India.Conclusion: Most of the H. pylori strains from Northeast India were sensitive toward the commonly used antibiotics for the treatment regime. B. capitata is effective against H. pylori infection, suggesting its potential as an alternative therapy, and opens the way for further studies on identification of novel antimicrobial targets of B. capitata.

Genomic sequences of Helicobacter pylori strains 26695, J99, HPAGI and G27 have revealed an abundance of restriction and modification genes. hp0050, which encodes an N(6) adenine DNA methyltransferase, was cloned, overexpressed and purified to near homogeneity. It recognizes the sequence 5'-GRRG-3' (where R is A or G) and, most intriguingly, methylates both adenines when R is A (5'-GAAG-3'). Kinetic analysis suggests a nonprocessive (repeated-hit) mechanism of methylation in which HP0050 methyltransferase methylates one adenine at a time in the sequence 5'-GAAG-3'. This is the first report of an N(6) adenine DNA methyltransferase that methylates two adjacent residues on the same strand. Interestingly, HP0050 homologs from two clinical strains of H. pylori (PG227 and 128) methylate only 5'-GAGG-3' compared with 5'-GRRG-3' in strain 26695. HP0050 methyltransferase is highly conserved as it is present in more than 90% of H. pylori strains. Inactivation of hp0050 in strain PG227 resulted in poor growth, suggesting its role in the biology of H. pylori. Collectively, these findings provide impetus for exploring the role(s) of this conserved DNA methyltransferase in the cellular processes of H. pylori.

Objective: Non-typhoidal salmonellosis is one of the leading zoonosis in the world caused by non-typhoidal Salmonella (NTS). Invasive infections with NTS serovars occurs due to the presence of virulence genes like invA along with the immunosuppressive conditions of the patient. The study was conducted to isolate and identify the NTS serovars and their antimicrobial resistance profile from patients with diarrhea and also to detect the virulence marker – invA gene among these NTS serovars.Methods: A prospective cross-sectional study was conducted from January 2015 to December 2016 at the Enteric Diseases Division, Kasturba Medical College, Manipal. 1218 fecal specimens were collected from patients with diarrhea and before antibiotic treatment. NTS serovars were identified, serotyped and then screened for the presence of invA virulence gene.Results: A total of 33 (2.7%) NTS was isolated. Salmonella typhimurium (33.34%) was predominant followed by Salmonella oslo (30.3%). Out of 33 NTS, invA was positive for 28 isolates (84.8%) of which 25 (89.3%) patients were febrile which was statistically significant (p=0.000).Conclusion: Non-typhoidal salmonellosis is an emerging global infection among immunocompromised patients. Our study showed an association between the invA gene and febrile illness among the patients suffering. Thus, this study highlights the importance of invA as a significant marker for bloodstream invasion.

The incidence of Vibrio cholerae non-O1, non-O139 strains from hospitalized patients with acute diarrhea constituted 27.4% ( n = 54) of the total 197 V. cholerae strains isolated from patients in Kolkata, India, in 2003. Of 197 strains, 135 were identified as O1 serotype Ogawa and 2 were identified as O139. In the same time period, six O1 background rough strains that possessed all known virulence factors were identified. Serotype analysis of the non-O1, non-O139 strains placed 42 strains into 19 serogroups, while 12 remained O nontypeable (ONT); the existing serotyping scheme involved antisera to 206 serogroups. Detection of a good number of ONT strains suggested that additional serogroups have arisen that need to be added to the current serotyping scheme. The non-O1, non-O139 strains were nontoxigenic except for an O36 strain (SC124), which regulated expression of cholera toxin as O1 classical strains did. Additionally, strain SC124 carried alleles of tcpA and toxT that were different from those of the O1 counterpart, and these were also found in five clonally related strains belonging to different serogroups. Strains carrying tcpA exhibited higher colonization in an animal model compared to those lacking tcpA . PCR-based analyses revealed remarkable variations in the distribution of other virulence factors, including hlyA , rtxA , Vibrio seventh pandemic island I (VSP-I), VSP-II, and type III secretion system (TTSS). Most strains contained hlyA (87%) and rtxA (81.5%) and secreted cytotoxic factors when grown in vitro. Approximately one-third of the strains (31.5%) contained the TTSS gene cluster, and most of these strains were more motile and hemolytic against rabbit erythrocytes. Partial nucleotide sequence analysis of the TTSS-containing strains revealed silent nucleotide mutations within vcsN2 (type III secretion cytoplasmic ATPase), indicating functional conservation of the TTSS apparatus.

Summary Cathelicidin (hCAP-18/LL-37) and b-defensin 1 (HBD-1) are human antimicrobial peptides (AMPs) with high basal expression levels, which form the first line of host defence against infections over the epithelial surfaces. The antimicrobial functions owe to theirdirectmicrobicidaleffectsaswellastheimmuno- modulatory role. Pathogenic microorganisms have developed multiple modalities including transcrip- tional repression to combat this arm of the host immune response. The precise mechanisms and the pathogen-derived molecules responsible for tran- scriptional downregulation remain unknown. Here, we have shown that enteric pathogens suppress LL-37 and HBD-1 expression in the intestinal epithe- lial cells (IECs) with Vibrio cholerae and enterotoxi- genic Escherichia coli (ETEC) exerting the most dramatic effects. Cholera toxin (CT) and labile toxin (LT), the major virulence proteins of V. cholerae and ETEC, respectively, are predominantly responsible for these effects, both in vitro and in vivo. CT tran- scriptionally downregulates the AMPs by activating several intracellular signalling pathways involving protein kinase A (PKA), ERK MAPKinase and Cox-2 downstream of cAMP accumulation and inducible cAMP early repressor (ICER) may mediate this role of CT, at least in part. This is the first report to show transcriptional repression of the AMPs through the activation of cellular signal transduction path- ways by well-known virulence proteins of pathogenic microorganisms.

The occurrence of 16S rRNA gene mutations associated with resistance to tetracycline in H. pylori isolated in Bangladesh was investigated. Tetracycline susceptibility was determined by the agar dilution method. The 16S rRNA genes of these isolates were sequenced and analyzed. A tetracycline accumulation assay was performed. DNA sequence and transformation tests of nine tetracycline-resistant (MIC = 2 microg/ml) Bangladeshi H. pylori clinical isolates showed that in no case was the resistance due to mutations in the 16S rRNA gene, the only known cause of tetracycline resistance in this pathogen. Tetracycline accumulation assays implicated altered uptake or efflux.

Summary Objectives To study the phenotypic and genotypic characterization of newly emerged V. cholerae O1, Inaba strains isolated from patients with diarrhoea. Methods Bacterial characterization was made using polymerase chain reaction, ribotyping, PFGE and RFLP. Results After its first appearance in July 2004, O1 Inaba became the dominant serotype by March 2005 and totally replaced the former dominant serotype, Ogawa from May 2005. Most of the Inaba isolates belong to a new ribotype RIV. Ogawa and also some Inaba strains isolated during the same period were identified as RIII. Similarly, the majority of the Inaba isolates belong to ‘H1' pulsotype and one isolate is type ‘H', while the Ogawa isolates were mostly ‘H' pulsotype. Presence of CTX prophage was detected in a single site of the chromosome with at least two RS elements. Conclusions There has been a switch of dominant serotype from Ogawa to Inaba in the Kolkata region. This is not necessarily due to emergence of a new clone but does serve as an epidemiological marker. Further analysis at the molecular level will be required to define this trend and to monitor future spread to other regions.

Resistance of Helicobacter pylori to clarithromycin is associated with a single base substitution in the 23S rRNA gene. In this study, clarithromycin-resistant H. pylori isolates were analysed for the presence of 23S rRNA gene mutations. H. pylori were isolated from 68 patients suffering from various gastroduodenal diseases in North India. Minimum inhibitory concentrations (MICs) were determined by the agar dilution method, and point mutations in clarithromycin-resistant strains were identified by PCR-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing. Clarithromycin resistance was observed in 11.8% (8/68) of the H. pylori isolates in North India. The A2143G point mutation in the 23S rRNA gene was found in 87.5% (7/8) of the clarithromycin-resistant strains, and the A2142G mutation in association with the T2182C mutation was found in 12.5% (1/8). In conclusion, the continued high prevalence of clarithromycin-sensitive H. pylori strains (88.2%) observed in this study allows the use of the triple-therapy regimen for the treatment of H. pylori infection in this region. Surveillance studies need to be conducted at regular intervals for clarithromycin resistance in the population. To our knowledge, this is the first study in India to report that point mutations at position A2143G and at A2142G in association with T2182C are associated with clarithromycin resistance, confirming reports from other parts of the world.

To the Editor: The epidemiology of cholera, especially in Africa and Asia, has periodically changed in subtle ways (1). The recent cholera epidemic in Haiti, a Caribbean country with no cholera cases in decades, affected >500,000 persons, caused ≈8,000 deaths, and brought this illness to the forefront of Haitian public health concerns (2,3). This life-threatening disease is caused by Vibrio cholerae, a waterborne bacterium with >200 serogroups, 2 of which, O1 and O139, cause epidemic or pandemic cholera. V. cholerae O1 is categorized as classical and El Tor biotypes, which differ biochemically and have different levels of virulence. Classical strains typically cause more severe illness than El Tor strains, which result in mild or moderate and sometimes asymptomatic cases. However, El Tor strains have replaced classical strains as the cause of cholera; the classical biotype is believed to be extinct, and El Tor strains currently prevail. However, the genetic traits specific to classical strains are still present in environmental and clinical V. cholerae isolates. Currently, all clinical strains of V. cholerae in Kolkata produce classical cholera toxin. Such phenotypic and genetic changes in V. cholerae are being monitored worldwide.

Background and Objectives The antimicrobial susceptibility patterns and genetic characteristics of Vibrio cholerae O1, which is responsible for several cholera epidemics in Nigeria, are not reported in detail since 2007. In this study, we screened V. cholerae O1 El Tor biotype isolates from cholera cases and water samples from different states to investigate their phenotypic and genetic attributes with special reference to their clonality. Results All the V. cholerae O1 biotype El Tor isolates isolated during 2007–2013 were susceptible to fluoroquinolones and tetracycline, the drugs currently used in the treatment of cholera cases in Nigeria. Emergence of CT genotype 7 (Haitian type of ctxB allele) was predominantly seen among Ogawa serotype and the CT genotype 1 (classical ctxB allele) was mostly found in Inaba serotype. Overall, V. cholerae O1 from clinical and water samples were found to be closely related as determined by the pulsed-field gel electrophoresis. V. cholerae isolates from Abia, Kano and Bauchi were found to be genetically distinct from the other states of Nigeria. Conclusion Fecal contamination of the water sources may be the possible source of the cholera infection. Combined prevalence of Haitian and classical ctxB alleles were detected in Ogawa and Inaba serotypes, respectively. This study further demonstrated that V. cholerae O1 with the ctxB has been emerged similar to the isolates reported in Haiti. Our findings suggest that the use of fluoroquinolones or tetracycline/doxycycline may help in the effective management of acute cholera in the affected Nigerian states. In addition, strengthening the existing surveillance in the hospitals of all the states and supply of clean drinking water may control cholera outbreaks in the future.

H. pylori induce ETS2 and Twist1 expression in the infected GCC. ETS2 and Twist1 transcriptionally activate siah2 in the H. pylori-infected GCCs. H. pylori-mediated Siah2 induction enhances motility and invasiveness of the infected GCCs., Helicobacter pylori infection is one of the most potent factors leading to gastric carcinogenesis. The seven in absentia homologue (Siah2) is an E3 ubiquitin ligase which has been implicated in various cancers but its role in H. pylori-mediated gastric carcinogenesis has not been established. We investigated the involvement of Siah2 in gastric cancer metastasis which was assessed by invasiveness and migration of H. pylori-infected gastric epithelial cancer cells. Cultured gastric cancer cells (GCCs) MKN45, AGS and Kato III showed significantly induced expression of Siah2, increased invasiveness and migration after being challenged with the pathogen. Siah2-expressing stable cells showed increased invasiveness and migration after H. pylori infection. Siah2 was transcriptionally activated by E26 transformation-specific sequence 2 (ETS2)- and Twist-related protein 1 (Twist1) induced in H. pylori-infected gastric epithelial cells. These transcription factors dose-dependently enhanced the aggressiveness of infected GCCs. Our data suggested that H. pylori-infected GCCs gained cell motility and invasiveness through Siah2 induction. As gastric cancer biopsy samples also showed highly induced expression of ETS2, Twist1 and Siah2 compared with noncancerous gastric tissue, we surmise that ETS2- and Twist1-mediated Siah2 up-regulation has potential diagnostic and prognostic significance and could be targeted for therapeutic purpose.

The duodenal ulcer promoting gene (dupA) and dupA cluster in Helicobacter pylori have been described as a risk factor for duodenal ulcer development in some populations. Polymorphic gene dupA can be divided into two groups, intact dupA1 (long or short type based on the presence or absence of 615-bp extra sequences at the 5′ region) having complete reading frame and other truncated dupA2 having frame-shift mutation. This study was aimed to elucidate the role of dupA of H. pylori and their clusters in the disease manifestation of Indian population. A total of 170 H. pylori strains were screened for the presence of dupA, dupA alleles and dupA cluster by PCR and sequencing. Pro-inflammatory cytokine (IL-8) with different dupA variant H. pylori stimulated gastric epithelial cells (AGS cells) was measured by ELISA. A total of 50 strains (29.4%) were positive for dupA among the tested 170 strains. The prevalence of dupA1 in duodenal ulcer (DU) and non-ulcer dyspepsia (NUD) populations was found to be 25.5% (25/98) and 11.1% (8/72), respectively and 16.4% (28/170) of the tested strains had dupA1, cagA and vacAs1m1 positive. The distribution of long and short type dupA1 has not been significantly associated with the disease outcome. The dupA cluster analysis showed that 10.2% (10/98) and 8.3% (6/72) strains were positive among DU and NUD, respectively. IL-8 production was significantly higher in dupA1+ , cagA +, vacA + (902.5 ± 79.01 pg/mL) than dupA2 + , cagA + , vacA + (536.0 ± 100.4 pg/mL, P = 0.008) and dupA −, cagA +, vacA + (549.7 ± 104.1 pg/mL, P = 0.009). Phylogenetic analysis of dupA indicated that the Indian H. pylori strains clustered with East Asian strains but distinct from Western strains. This is the first known genetic element of Indian H. pylori that is genetically closer to the East Asian strains but differed from the Western strains. The intact dupA1 was significantly associated with DU than NUD (P = 0.029) but the dupA1 cluster has no role in the disease manifestation at India (P = 0.79). Thus, dupA1 can be considered as a biomarker for DU patients in India.

Helicobacter pylori cag pathogenicity island (PAI) is a major determinant of gastric injury via induction of several matrix metalloproteinases (MMPs). In the present study, we examined the influence of the cag PAI on gastric infection and MMP-9 production in mice and in cultured cells. A new mouse colonizing Indian H. pylori strain (AM1) that lacks the cag PAI was used to study the cag PAI importance in inflammation. Groups of C57BL/6 mice were inoculated separately with H. pylori strains AM1 and SS1 (cag+), gastric tissues were histologically examined, and bacterial colonization was scored by quantitative culture. Mice infected with either cag+ or cag- H. pylori strains showed gastric inflammation and elevated MMP-3 production. Significant up-regulation of pro-MMP-9 secretion and gene expression in H. pylori infected gastric tissues indicate dispensability of cag PAI for increased pro-MMP-9 secretion and synthesis in mice. In agreement, cell culture studies revealed that both AM1 and SS1 were equipotent in pro-MMP-9 induction in human gastric epithelial cells. Both strains showed moderate increase in MMP-2 activity in vivo and in vitro. In addition, increased secretion of tumor necrosis factor (TNF)-alpha, interleukin (IL)-1beta, and IL-6 induced pro-MMP-9 secretion and synthesis in AM1 or SS1 strain-infected mice suggesting elicitation of pro-inflammatory cytokines by both cag- and cag+ genotype. Moreover, tissue inhibitors of metalloproteinase-1 expression were decreased with increase in pro-MMP-9 induction. These data show that H. pylori may act through different pathways other than cag PAI-mediated for gastric inflammation and contribute to up-regulation of MMP-9 via pro-inflammatory cytokines.

A cross-sectional study of 431 6-9 years old urban Bengalee Hindu schoolgirls of Kolkata, India, was undertaken to study age trends in anthropometric characteristics including regional and subcutaneous adiposity. The anthropometric variables measured included height, weight, sitting height (SH), waist (WC), hip (HPC), thigh (TC), mid-upper arm (MUAC) and medial calf (MC) circumferences as well as triceps (TSF), biceps (BSF), subscapular SUBSF), suprailliac (SUPSF) and medial calf (MCASF) skinfolds. The results revealed, that there was a significant increasing age trend for all the anthropometric variables including the two derived variables: body mass index (BMI) and subischial leg length (SLL). For all variables, the lowest and the highest means were observed at the age of 6 and 9 years, respectively. The maximum increase in weight, BMI, all linear measurements, WC and HPC were observed during the period 6-7 years of age. In general, all skinfolds recorded similar yearly increments. More importantly, this study clearly indicated that among Bengalee girls aged 6-9 years, the highest amount of linear growth (height, SH and SLL) was observed at 6 years of age. The overall adiposity (BMI) also recorded the maximum increment during this period. The unique data presented here can be used as reference values for urban Bengalee Hindu girls aged 6-9 years.

Vibrio fluvialis is a halophilic Vibrio species associated with acute diarrhoeal illness in humans. It has the potential to cause outbreaks and has an association with paediatric diarrhoea. In this study, 11 V. fluvialis strains isolated from hospitalized patients with acute diarrhoea at the Infectious Diseases Hospital, Kolkata were extensively characterized. All the strains showed growth in peptone broth containing 7 % NaCl. The strains showed variable results in Voges–Proskauer test and to a vibriostatic agent. There was also variation in their antibiograms, and some of the strains were multidrug resistant. Among the 11 strains, two showed only a single band difference in their PFGE profile and the remaining strains showed nine different PFGE patterns. However, unlike PFGE, the strains exhibited close matches and clustering in their ribotype patterns. The haemolytic effect on sheep red blood cells varied with strains. Partial sequence analysis revealed that the V. fluvialis haemolysin gene has 81 % homology with that of the El Tor haemolysin of Vibrio cholerae. A striking finding was the capability of all the strains to evoke distinct cytotoxic and vacuolation effects on HeLa cells.

Background: Efficient and accurate detection of Helicobacter pylori infection as well as identification of virulence-associated alleles are important for the treatment of gastroduodenal diseases caused by this gastric pathogen. The present study was performed to test the efficiency of gastric juice polymerase chain reaction (PCR) method for the rapid detection of H. pylori infection and to determine the bacterial genotypes without the need for culture, which is often not feasible especially in developing countries. Methods: DNA was extracted from gastric juice samples collected from 45 subjects and was used to amplify urease B gene (ureB) for H. pylori. Results obtained from this method were further confirmed by rapid urease test (RUT), histology and culture. Genotypes of the infected strains predicted from gastric juice PCR were compared to the genotype data obtained from the isolated strains. Results: Among 45 cases, 32 were positive by RUT, 37 by histological examination, 25 by gastric juice PCR method, while culture yielded positive results for 19 samples. Except for one case, all the 19 culture-positive strains gave the same genotype with the gastric juice PCR result. It was found that the gastric juice PCR is more efficient for detection of multiple-strain infection as compared to genotype data obtained from strains isolated as pooled culture. Conclusions: This moderately sensitive technique could be employed with good efficiency, particularly in cases where it is difficult to obtain biopsy. Moreover, with this method bacterial genotype could be obtained.

Salmonella enterica serovar Weltevreden and Vibrio fluvialis were identified as etiological agents of a foodborne gastroenteritis outbreak after an Iftar feast in North Dumdum. Of the 278 cases admitted to the Infectious Diseases Hospital, Kolkata, 44 stool samples were tested for the enteric pathogens. Six were positive for Salmonella Weltevreden, 5 for Vibrio fluvialis, and 8 contained both of the pathogens. Consumption of mutton-ghogni might have been the likely vehicle of this outbreak. In the pulsed-field gel electrophoresis, Salmonella Weltevreden was identified as a single clone but the V. fluvialis strains were heterogeneous.

Insights into bacterium-host interactions and genome evolution can emerge from comparisons among related species. Here we studied Helicobacter acinonychis (formerly H. acinonyx ), a species closely related to the human gastric pathogen Helicobacter pylori . Two groups of strains were identified by randomly amplified polymorphic DNA fingerprinting and gene sequencing: one group from six cheetahs in a U.S. zoo and two lions in a European circus, and the other group from a tiger and a lion-tiger hybrid in the same circus. PCR and DNA sequencing showed that each strain lacked the cag pathogenicity island and contained a degenerate vacuolating cytotoxin ( vacA ) gene. Analyses of nine other genes ( glmM , recA , hp519 , glr , cysS , ppa , flaB , flaA , and atpA ) revealed a ∼2% base substitution difference, on average, between the two H. acinonychis groups and a ∼8% difference between these genes and their homologs in H. pylori reference strains such as 26695. H. acinonychis derivatives that could chronically infect mice were selected and were found to be capable of persistent mixed infection with certain H. pylori strains. Several variants, due variously to recombination or new mutation, were found after 2 months of mixed infection. H. acinonychis ' modest genetic distance from H. pylori , its ability to infect mice, and its ability to coexist and recombine with certain H. pylori strains in vivo should be useful in studies of Helicobacter infection and virulence mechanisms and studies of genome evolution.

To the Editor: The etiologic agent of the sixth pandemic of cholera was classical biotype of Vibrio cholerae O1. The ongoing seventh pandemic is caused by El Tor biotype. The biotypes are differentiated by phenotypic and genotypic characteristics. However, this differentiation blurred when V. cholerae O1 strains were detected in Matlab, Bangladesh, in 2006, in which characteristics were mixed. Genetically, the differences occurred in tcpA, which encodes the major adherence antigen rstR that regulates site-specific recombination of CTXϕ phage and ctxB that encodes the B subunit of cholera toxin. These genes had the characteristics of classical biotype in Matlab variants of El Tor strains. Later, various types of El Tor variants were reported in Southeast Asia, Africa, and Haiti. Differentiating features also occur in repeat toxin A gene (rtxA), chromosomal location of CTXϕ, the number of heptad repeats in ToxR binding region, and the occurrence of vibrio seventh pandemic islands I and II (1,2).

Virulence-associated genes and neutral DNA markers of Helicobacter pylori strains from the Santhal and Oroan ethnic minorities of West Bengal, India, were studied. These people have traditionally been quite separate from other Indians and differ culturally, genetically, and linguistically from mainstream Bengalis, whose H. pylori strains have been characterized previously. H. pylori was found in each of 49 study participants, although none had peptic ulcer disease, and was cultured from 31 of them. All strains carried the cag pathogenicity island and potentially toxigenic s1 alleles of vacuolating cytotoxin gene ( vacA ) and were resistant to at least 8 μg of metronidazole per ml. DNA sequence motifs in vacA mid-region m1 alleles, cagA , and an informative insertion or deletion motif next to cagA from these strains were similar to those of strains from ethnic Bengalis. Three mobile elements, IS 605 , IS 607 , and IS Hp608 , were present in 29, 19, and 10%, respectively, of Santhal and Oroan strains, which is similar to their prevalence in Bengali H. pylori. Thus, there is no evidence that the gene pools of H. pylori of these ethnic minorities differ from those of Bengalis from the same region. This relatedness of strains from persons of different ethnicities bears on our understanding of H. pylori transmission between communities and genome evolution.

Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori . We found 6 tetracycline-resistant (Tet r ) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tet r isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA 965-967 [ Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA 965-967 ; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tet r phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tet r parents; (iii) each of 10 Tet r mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti- H. pylori agent) contained the normal AGA 965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tet r 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori 's great genetic diversity.

We compared putative molecular markers of virulence ( vacA , cagA , and iceA ) of Helicobacter pylori strains isolated from 52 adult duodenal ulcer patients from West Bengal, India, with those of H . pylori strains isolated from 48 adult healthy volunteers from the same region. On the basis of genotyping by PCR, we conclude that the H. pylori strains isolated from the two study groups were indistinguishable and that there are geographic variations in the association of certain putative H. pylori virulence genes with clinical status.

Nitazoxanide (NTZ) is a redox-active nitrothiazolyl-salicylamide prodrug that kills Helicobacter pylori and also many anaerobic bacterial, protozoan, and helminthic species. Here we describe development and use of a spectrophotometric assay, based on nitroreduction of NTZ at 412 nm, to identify H. pylori enzymes responsible for its activation and mode of action. Three enzymes that reduce NTZ were identified: two related NADPH nitroreductases, which also mediate susceptibility to metronidazole (MTZ) (RdxA and FrxA), and pyruvate oxidoreductase (POR). Recombinant His-tagged RdxA, FrxA, and POR, overexpressed in nitroreductase-deficient Escherichia coli , each rapidly reduced NTZ, whereas only FrxA and to a lesser extent POR reduced nitrofuran substrates (furazolidone, nitrofurantoin, and nitrofurazone). POR exhibited no MTZ reductase activity either in extracts of H. pylori or following overexpression in E. coli ; RdxA exhibited no nitrofuran reductase activity, and FrxA exhibited no MTZ reductase activity. Analysis of mutation to rifampin resistance (Rif r ) indicated that NTZ was not mutagenic and that nitrofurans were only weakly mutagenic. Alkaline gel DNA electrophoresis indicated that none of these prodrugs caused DNA breakage. In contrast, MTZ caused DNA damage and was strongly mutagenic. We conclude that POR, an essential enzyme, is responsible for most or all of the bactericidal effects of NTZ against H. pylori . While loss-of-function mutations in rdxA and frxA produce a Mtz r phenotype, they do not contribute much to the innate susceptibility of H. pylori to NTZ or nitrofurans.

Objective: Recurrent Clostridium difficile infection (CDI) and the emergence of strains with reduced susceptibility to metronidazole and vancomycinwarrants alternative therapy. Hence, we tested the potential efficacy of the natural compound berberine hydrochloride (BBRHCl) against toxigenicC. difficile.Methods: Three representative polymerase chain reaction confirmed, toxin-positive strains were included in the study. Pulsed-field gel electrophoresis(PFGE) profile and antibiogram of the strains were analyzed along with 10 other toxin positive isolates. Efficacy of BBRHCl against toxigenic C. difficilewas determined using agar diffusion by punch well method.Results: PFGE grouped the test strains into three clusters with unique susceptibility pattern toward standard antibiotics. BBRHCl was efficaciousagainst the test strains at a concentration ranging between 6.25 μg/ml and 10 mg/ml. BBRHCl’s breakpoint point inhibitory zone diameter wasequivalent (p

A new member of the IS 605 transposable element family, designated IS Hp608 , was found by subtractive hybridization in Helicobacter pylori . Like the three other insertion sequences (ISs) known in this gastric pathogen, it contains two open reading frames ( orfA and orfB ), each related to putative transposase genes of simpler (one-gene) elements in other prokaryotes; orfB is also related to the Salmonella virulence gene gipA . PCR and hybridization tests showed that IS Hp608 is nonrandomly distributed geographically: it was found in 21% of 194 European and African strains, 14% of 175 Bengali strains, 43% of 131 strains from native Peruvians and Alaska natives, but just 1% of 223 East Asian strains. IS Hp608 also seemed more abundant in Peruvian gastric cancer strains than gastritis strains (9 of 14 versus 15 of 45, respectively; P = 0.04). Two IS Hp608 types differing by ∼11% in DNA sequence were identified: one was widely distributed geographically, and the other was found only in Peruvian and Alaskan strains. Isolates of a given type differed by ≤2% in DNA sequence, but several recombinant elements were also found. IS Hp608 marked with a resistance gene was found to (i) transpose in Escherichia coli ; (ii) generate simple insertions during transposition, not cointegrates; (iii) insert downstream of the motif 5"-TTAC without duplicating target sequences; and (iv) require orfA but not orfB for its transposition. IS Hp608 represents a widespread family of novel chimeric mobile DNA elements whose further analysis should provide new insights into transposition mechanisms and into microbial population genetic structure and genome evolution.

Cholera is an acute diarrheal disease and a major public health problem in many developing countries in Asia, Africa, and Latin America. Since the Bay of Bengal is considered the epicenter for the seventh cholera pandemic, it is important to understand the genetic dynamism of Vibrio cholerae from Kolkata, as a representative of the Bengal region. We analyzed whole genome sequence data of V. cholerae O1 isolated from cholera patients in Kolkata, India, from 2007 to 2014 and identified the heterogeneous genomic region in these strains. In addition, we carried out a phylogenetic analysis based on the whole genome single nucleotide polymorphisms to determine the genetic lineage of strains in Kolkata. This analysis revealed the heterogeneity of the Vibrio seventh pandemic island (VSP)-II in Kolkata strains. The ctxB genotype was also heterogeneous and was highly related to VSP-II types. In addition, phylogenetic analysis revealed the shifts in predominant strains in Kolkata. Two distinct lineages, 1 and 2, were found between 2007 and 2010. However, the proportion changed markedly in 2010 and lineage 2 strains were predominant thereafter. Lineage 2 can be divided into four sublineages, I, II, III and IV. The results of this study indicate that lineages 1 and 2-I were concurrently prevalent between 2007 and 2009, and lineage 2-III observed in 2010, followed by the predominance of lineage 2-IV in 2011 and continued until 2014. Our findings demonstrate that the epidemic of cholera in Kolkata was caused by several distinct strains that have been constantly changing within the genetic lineages of V. cholerae O1 in recent years., Author summary Seven cholera pandemics have been recorded throughout history, and the sixth, and presumably earlier pandemics, emerged from the Bay of Bengal. The seventh pandemic strain also appeared and spread from this area to different area of the world. Thus, the Bay of Bengal has always been considered the epicenter of cholera pandemics. In this report, we characterized the V. cholerae strains isolated from patients with cholera in Kolkata as a representative area of the Bay of Bengal between 2007 and 2014. The analysis revealed that the cholera epidemics were caused by several distinct V. cholerae O1 strains and that the predominant strains have genetically changed several times in recent years.

Campylobacterspeciesinfectionistheleadingcauseofbacterialenteritis worldwide. MostCampylobacterinfections cause acute, selflimiting diarrheal disease. However, patients with more severe disease and immunologically compromised patients need antibiotic treatment (1). The most common antimicrobial agents used inthetreatmentofCampylobacterinfectionsarefluoroquinolones and macrolides. In India, fluoroquinolone resistance has increased markedly (more than 85%) in recent years (2, 3). Resistance toward macrolides varies from place to place. In northern India, the macrolide resistance was 6.1% during 2005 (4) and reached 22.2% in 2013 (2). From 2008 to 2010, macrolide resistance was only 0.7% in eastern India (3). Onehundredsixty-sixCampylobacterjejunistrainsisolatedfrom pediatric diarrhea cases (children of 5 years) at B. C. Roy Children’s Hospital, Kolkata, India, from 2010 to 2012 were tested for macrolide resistance. About 4% of the isolates (6/166) were macrolide resistant by the disc diffusion method. The Etest (Biomeriux) assay with azithromycin indicated that five isolates were resistant to concentrations up to 256 g/ml. When tested by the dilutionmethod(5),twoisolateswereresistanttoazithromycinat 1,000 g/ml and three others had azithromycin MICs between 500 and 1,000 g/ml. Macrolide resistance in Campylobacter is associated mainly with a point mutation(s) occurring within the peptidyltransferaseregionindomainVofthe23SrRNAgene,the target of macrolides. Sequencing analysis of a 552-bp amplicon of the V region of the 23S rRNA gene using primers F2-Campy-23S (AATTGATGGGGTTAGCATTAGC)(6)and2420R-Campy-23S (AGAACCACCGGATCACTAAGA) revealed the presence of an

An outbreak of cholera struck Bihar, an Indian state, in August 2008 following a massive flood. Here we report the phenotypic and genotypic characteristics of Vibrio cholerae strains isolated from patients with diarrhea. Rectal swabs were obtained from patients with diarrhea who were admitted to medical camps or the hospital, and the strains were biochemically and serologically characterized. V. cholerae was isolated from 21 (65.6%) of 32 rectal swabs. Serological studies revealed that all the 21 isolates belonged to V. cholerae O1 Ogawa. Mismatch amplification mutation assay (MAMA)-PCR showed that the isolates belonged to El Tor variant group, and pulsed-field gel electrophoresis (PFGE) proved that these isolates were of a different lineage than the conventional El Tor variant strains. These isolates were resistant to several drugs, including ampicillin, streptomycin, tetracycline, nalidixic acid, and furazolidone. The uniqueness of the current report arises from the fact that records of cholera in Bihar are availiable for the early 1960s but not for the next 4 decades. Moreover, the present study is the first to report a cholera outbreak in Bihar that was caused by an El Tor variant strain.

A total of 178 strains of V. parahaemolyticus isolated from 13,607 acute diarrheal patients admitted in the Infectious Diseases Hospital, Kolkata has been examined for serovar prevalence, antimicrobial susceptibility and genetic traits with reference to virulence, and clonal lineages. Clinical symptoms and stool characteristics of V. parahaemolyticus infected patients were analyzed for their specific traits. The frequency of pandemic strains was 68%, as confirmed by group-specific PCR (GS-PCR). However, the prevalence of non-pandemic strains was comparatively low (32%). Serovars O3:K6 (19.7%), O1:K25 (18.5%), O1:KUT (11.2%) were more commonly found and other serovars such as O3:KUT (6.7%), O4:K8 (6.7%), and O2:K3 (4.5%) were newly detected in this region. The virulence gene tdh was most frequently detected in GS-PCR positive strains. There was no association between strain features and stool characteristics or clinical outcomes with reference to serovar, pandemic/non-pandemic or virulence profiles. Ampicillin and streptomycin resistance was constant throughout the study period and the MIC of ampicillin among selected strains ranged from 24 to >256 µg/ml. Susceptibility of these strains to ampicillin increased several fold in the presence of carbonyl cyanide-m-chlorophenyldrazone. The newly reported ESBL encoding gene from VPA0477 was found in all the strains, including the susceptible ones for ampicillin. However, none of the strains exhibited the β-lactamase as a phenotypic marker. In the analysis of pulsed-field gel electrophoresis (PFGE), the pandemic strains formed two different clades, with one containing the newly emerged pandemic strains in this region., Author Summary Vibrio parahaemolyticus has been associated with several epidemics of foodborne diarrheal infection. Recent observations in several counties have shown the emergence of pandemic strains of V. parahaemolyticus with unique genetic features and their role in diarrheal outbreaks. Unlike other enteric pathogens, the appearance of pandemic strains of V. parahaemolyticus has not been associated with the economic/hygiene status of the population. The pandemic strains of V. parahaemolyticus continue to prevail in Kolkata, India since its appearance during 1996. The present communication describes not only the prevalence of pandemic serovars of V. parahaemolyticus, but also the appearance of novel serovars under the pandemic strain category. In addition, the trh gene was detected in some of the pandemic strains for the first time. In the newly emerged serovars genetic changes have occurred, as evidenced from the PFGE analysis. Overall, the antimicrobial susceptibility of pandemic strains remains unchanged for the past 20 years. The observations made in this study re-emphasize the importance of this pathogen and shows the recent genetic and serovar changes in the epidemiology of V. parahaemolyticus-mediated diarrhea.