Search

YKL-40, a glycoprotein involved in cell differentiation, has been associated with neurodevelopmental disorders, angiogenesis, neuroinflammation and glioblastomas. We evaluated YKL-40 protein distribution in the early human forebrain using double-labeling immunofluorescence and immunohistochemistry. Immunoreactivity was detected in neuroepithelial cells, radial glial end feet, leptomeningeal cells and choroid plexus epithelial cells. The subpial marginal zone was YKL-40-positive, particularly in the hippocampus, from an early beginning stage in its development. Blood vessels in the intermediate and subventricular zones showed specific YKL-40 reactivity confined to pericytes. Furthermore, a population of YKL-40-positive, small, rounded cells was identified in the ventricular and subventricular zones. Real-time quantitative RT-PCR analysis showed strong YKL-40 mRNA expression in the leptomeninges and the choroid plexuses, and weaker expression in the telencephalic wall. Immunohistochemistry revealed a differential distribution of YKL-40 across the zones of the developing telencephalic wall. We show that YKL-40 is associated with sites of the brain barrier systems and propose that it is involved in controlling local angiogenesis and access of peripheral cells to the forebrain via secretion from leptomeningeal cells, choroid plexus epithelium and pericytes. Furthermore, we suggest that the small, rounded, YKL-40-positive cells represent a subpopulation of astroglial progenitors, and that YKL-40 could be involved in the differentiation of a particular astrocytic lineage.

BACKGROUND: Genome instability plays fundamental roles in human evolution and phenotypic variation within our population. This instability leads to genomic rearrangements that are involved in a wide variety of human disorders, including congenital and neurodevelopmental disorders, and cancers. Insight into the molecular mechanisms governing such genomic rearrangements may increase our understanding of disease pathology and evolutionary processes. Here we analyse 17 carriers of non-recurrent deletions in the NRXN1 gene, which have been associated with neurodevelopmental disorders, e.g. schizophrenia, autism and epilepsies.METHODS: 17 non-recurrent NRXN1 deletions identified by GWA were sequenced to map the breakpoints of each. Meme … etc. was used to identify shared patterns between the deletions and compare these were previously studies on non-recurrent deletions.RESULTS: We discovered two novel sequence motifs shared between all 17 NRXN1 deletions and a significantly higher AT nucleotide content at the breakpoints, compared to the overall nucleotide content on chromosome 2. We found different alteration of sequence at the breakpoint; small insertions and duplications giving rise to short microhomology sequences.CONCLUSIONS: No single mechanism seems to be implicated in the deletion events, but the results suggest that NHEJ, FoSTeS or MMBIR is implicated. The two novel sequence motifs together with a high AT content in all in NRXN1 deletions may lead to increased instability leading to a increase susceptibility to a single stranded structures. This favours potentially repaired by NHEJ mechanism of double strand breaks or may leading to replication errors. © 2013 Wiley Periodicals, Inc.

Background: The voltage-gated, rapid-delayed rectifier current (IKr) is important for repolarization of the heart, and mutations in the genes coding for the K+-ion channel conducting this current, i.e., KCNH2 for the α-subunit HERG and KCNE2 for the β-subunit MiRP1, cause acquired and congenital long Q-T syndrome (LQTS) and other cardiac arrhythmias.Methods: We developed a robust single-strand conformation polymorphism-heteroduplex screening analysis, with identical thermocycling conditions for all PCR reactions, covering all of the coding exons in KCNH2 and KCNE2. The method was used to screen 40 unrelated LQTS patients.Results: Eleven mutations, of which six were novel, were found in KCNH2. Interestingly, six mutations were found in the region of the gene coding for the Per-Arnt-Sim (PAS) and PAS-S1 regions of the HERG protein, stressing the need to examine the entire gene when screening for mutations. No mutations were found in KCNE2, suggesting that direct involvement of MiRP1 in LQTS is rare. Furthermore, four novel single-nucleotide polymorphisms (SNPs) and one amino acid polymorphism (R1047L) were identified in KCNH2, and one novel SNP and one previously known amino acid polymorphism (T8A) were found in KCNE2.Conclusions: The potential role of rare polymorphisms in the HERG/MiRP1 K+-channel should be clarified with respect to drug interactions and susceptibility to arrhythmia and sudden death.

During the final phases of deck erection and surfacing of the suspended spans of the Storebaelt bridge, vertical deck oscillations of low frequency were observed by workers and supervision staff. The results of on-site monitoring of the oscillations and wind speed measurements at the nearby island of Sprogo correlated well with wind-tunnel test results obtained during design, indicating that the observed oscillations were due to periodic von Karman type vortex shedding in the wake of the girder. The present paper discusses the results of the on-site structural and wind monitoring programme, correlation to wind-tunnel tests and the design and erection of guide vanes to the main span girder for mitigation of the oscillations. The vortex-induced oscillations were found to be harmless from a structural point of view but unacceptable considering possible physiological impact on users of the bridge.

This paper presents the results of aerodynamic studies of the Lions’ Gate Bridge – 3 lane renovation. The studies are divided into two parts: In the first part results of wind tunnel tests on a section model are compared to the results from two-dimensional numerical simulations based on the discrete vortex method. In the second part, changes in aerodynamic behaviour due to design revisions and changed mass and stiffness properties are studied by means of numerical simulations only. This was made possible because the numerical simulations had been calibrated with the results from wind tunnel testing in the first part of the studies and compared favourably. The numerical simulations proved both time and cost efficient. The studies undertaken are exclusively for the renovation of the suspension bridge.

Jervell and Lange-Nielsen syndrome (JLNS) is an autosomal recessive syndrome characterised by profound congenital sensorineural deafness and prolongation of the QT interval on the electrocardiogram, representing abnormal ventricular repolarisation. In a study of ten British and Norwegian families with JLNS, we have identified all of the mutations in the KCNQ1 gene, including two that are novel. Of the nine mutations identified in this group of 10 families, five are nonsense or frameshift mutations. Truncation of the protein proximal to the recently identified C-terminal assembly domain is expected to preclude assembly of KCNQ1 monomers into tetramers and explains the recessive inheritance of JLNS. However, study of a frameshift mutation, with a dominant effect phenotypically, suggests the presence of another assembly domain nearer to the N-terminus.

This article takes a new approach to understanding the aerodynamics failure mechanism responsible for the collapse of the Tacoma Narrows Bridge 60 years ago. It is demonstrated that the instability...

In a four-generation family with long QT syndrome, syncopes and torsades de pointes ventricular tachycardia (TdP) were elicited by abrupt awakening in the early morning hours. The syndrome was associated with a novel KCNH2 missense mutation, G572R, causing the substitution of a a glycine residue at position 572, at the end of the S5 transmembrane segment of the HERG K + -channel, with an arginine residue. This segment is involved in the channel pore and the mutation may cause a reduction in the rapidly activating delayed rectifier K + current (I kr ), or changed gating properties of the ion channel, leading to prolonged cardiac repolarization. The electrocardiograms of affected persons showed prolonged QT interval and notched T waves. Despite treatment with atenolol, 200 mg twice daily, the proband still experienced TdP episodes. Three untreated relatives of the proband died suddenly, and unexpectedly, at 18, 32, and 57 years of age. The G572R mutation is thus associated with a high mortality rate, and the clinical presentation illustrates that some mutations may not be controllable by just β-blockade.

The AGG interspersion pattern and flanking microsatellite markers and their association with instability of the FMR1 (CGG) n repeat, involved in the fragile X syndrome, were analyzed in DNA from filter-paper blood spots randomly collected from the Danish newborn population. Comparison of DXS548-FRAXAC1 haplotype frequencies in the normal population and among fragile X patients suggested strong linkage disequilibrium between normal alleles and haplotype 7-3 and between fragile X alleles and haplotype 2-1 and 6-4. Comparison of the AGG interspersion pattern in 143 alleles, ranging in size from 34-62 CGG, and their associated haplotypes indicates the existence of at least three mutational pathways from normal alleles toward fragile X alleles in the Danish population. Two subgroups of normal alleles, with internal sequences of (CGG) 10 AGG(CGG) 19 and (CGG) 9 AGG(CGG) 12 AGG(CGG) 9 , possibly predisposed for expansion, were identified in the data set. When alleles larger than 34 CGG were investigated, comparing the length of 3' uninterrupted CGG triplets (uCGG), we found that alleles associated with haplotype 2-1 and 6-4 contain significantly longer stretches of uCGG than alleles associated with haplotype 7-3. Thus, the data support that (CGG) n instability is correlated to the length of uCGG.

Mutations in the cardiac β -myosin heavy chain gene ( MYH7 ), and other genes encoding cardiac sarcomere proteins may cause familial hypertrophic cardiomyopathy (F-HCM), an autosomal dominant disease, characterized by myocardial hypertrophy. We analysed the MYH7 gene in three generations of a family with one borderline and four clinically verified cases of hypertrophic cardiomyopathy, and identified a mutation in exon 7 changing the 190 arginine residue into a threonine residue. The mutation is located in the ATP-binding region of the myosin head and alters the charge in the F-helix close to the phosphate-binding P-loop. The mutation may thus interfere with the coupling between ATP-hydrolysis and the transition into mechanical energy. In conclusion, the novel Arg190Thr mutation in exon 7 of the MYH7 gene is associated with the development of symptomatic myocardial hypertrophy in adults.

Genetic diagnosis of an inherited disease or cancer often involves analysis for unknown point mutations in several genes; therefore, rapid and automated techniques that can process a large number of samples are needed. We describe a method for high-throughput single-strand conformation polymorphism (SSCP) analysis using automated capillary electrophoresis. The operating temperature of a commercially available capillary electrophoresis instrument (ABI PRISM 310) was expanded by installation of a cheap in-house designed cooling system, thereby allowing us to perform automated SSCP analysis at 14–45°C. We have used the method for detection of point mutations associated with the inherited cardiac disorders long QT syndrome (LQTS) and hypertrophic cardiomyopathy (HCM). The sensitivity of the method was 100% when 34 different point mutations were analyzed, including two previously unpublished LQTS-associated mutations (F157C in KVLQT1 and G572R in HERG), as well as eight novel normal variants in HERG and MYH7. The analyzed polymerase chain reaction (PCR) fragments ranged in size from 166 to 1,223 bp. Seventeen different sequence contexts were analyzed. Three different electrophoresis temperatures were used to obtain 100% sensitivity. Two mutants could not be detected at temperatures greater than 20°C. The method has a high resolution and good reproducibility and is very robust, making multiplex SSCP analysis and pattern-based identification of known allelic variants as single nucleotide polymorphisms (SNPs) possible. These possibilities, combined with automation and short analysis time, make the method suitable for high-throughput tasks, such as genetic screening. Hum Mutat 13:318–327, 1999. © 1999 Wiley-Liss, Inc.

An efficient large eddy simulation model (LES) using finite element method (FEM) is presented. The Navier–Stokes equations are solved using an implicit procedure. The three-dimensional LES model could capture the drag crisis phenomena for a circular cylinder. Only 2% of the grid point used by Tamura is used to capture the drag crisis. This is possible because of the use of accurate approximation of convection term using FEM which reduces the numerical diffusion. This model is used to study the flow over Great Belt East Bridge. The computed drag and Strouhal number are in reasonable agreement with wind tunnel measurement.

Background: Genetic screening requires methods for mutation detection that are sensitive, precise, and robust. In population screening for complex genetic diseases in which large genes and/or several genes may be affected, automation of the mutation detection analysis is desirable. Methods and Results: The combined use of Cleavase nuclease and analysis of the DNA cleavage pattern by capillary electrophoresis was evaluated with respect to sensitivity, reproducibility, and dependency of experimental conditions in detecting mutations in the human genes MYH7 and KVLQT1 (KCNA9). The cleavage patterns obtained by capillary electrophoresis were very reproducible and robust. Conclusions: The combination of a sensitive enzymatic mutation detection method and capillary electrophoresis may prove to be a useful system for automated, large-scale genetic screening.

A common assumption in wind engineering is that the flow around bluff and sharp edged bodies is independent of Reynolds Number, Re. An important practical implication of this assumption is that aerodynamic parameters such as Strouhal number, lift and drag coefficients may be obtained from low speed wind tunnel model tests and applied directly to the prototype structure. Tests conducted in a pressurised wind tunnel capable of reproducing typical model scale (Re≈105) and prototype conditions (Re≈107) revealed pronounced Re effects in the flow around a bluff and sharp edged bridge girder cross section. Similar Re effects are well known from the flow around circular cylinders. Pressurised wind tunnel observations of the Strouhal Number at high and low Re for the bridge girder cross section in question was supported by observations of vortex induced vibrations of the prototype bridge girder and the corresponding 1 : 80 scale section model tested in a conventional low speed wind tunnel.

Cross-section shape is an important parameter for the wind response and aeroelastic stability of long span suspension and cable-stayed bridges. Numerical simulation methods have now been developed to a stage where assessment of the effect of practical cross-section shapes on bridge response is possible. The present paper reviews selected numerical simulations carried out for a long-span suspension bridge using finite difference and discrete vortex methods. Comparison of simulations to existing wind tunnel data is discussed. Further, the paper addresses the aerodynamics and structural response of four generic cross-section shapes developed from the well-known plate girder section of the first Tacoma Narrows Bridge. Finally a case study involving the wind response of a 400 m main span cable-stayed bridge is discussed.

During erection of long-span suspension bridges the stiffening girder lacks torsional continuity. Thus, it becomes important to consider flutter-type aeroelastic instabilities. During the early stages of deck erection, the critical wind speed for onset of flutter becomes particularly low and in this case it may prove interesting to consider flutter control by provision of eccentric ballast. The present paper extends standard bridge flutter routines based on measured aerodynamic derivatives to include the effect of eccentric deployment of ballast. The potential enhancement of the critical wind speed by this method is discussed and the importance of applying actual measured aerodynamic derivatives for the bridge section in question is emphasised as opposed to the use of theoretical “flat plate” aerodynamic derivatives.

Fragile X syndrome is caused by expansion of a (CGG)n trinucleotide repeat within the 5' untranslated region of the FMR1 gene transcript. The disease is reliably diagnosed by Southern blotting, but this method constitutes a significant workload and requires large samples. Therefore, for large research or screening projects in which a large majority of the samples will be normal, a more rapid and less expensive method is needed. We present a method for accurate, high-throughput analysis of the FRAXA (CGG)n region in the normal and premutation range. The method is based on polymerase chain reaction (PCR) amplification of DNA extracted from whole blood or eluted from dried blood spots on filter-paper, followed by automated capillary electrophoresis and detection by multicolour fluorescence. This method allows a throughput of 144 samples in 48 h, with an intra-assay accuracy in size determination of 0.2-1.8 bp. We performed a blind reanalysis of samples from 30 patients, previously analysed by Southern blotting or PCR with radioactive labelling. In this study normal and premutation alleles, ranging from 28-121 (CGG)n repeats, were correctly determined with respect to number of (CGG)n repeats. All full-mutation alleles and one large premutation allele in a sample of a heterozygote failed to amplify. The method was used to determine the distribution of FRAXA (CGG)n repeats in the Danish population.

Two-dimensional viscous incompressible flow past bridge girder cross-sections are simulated using the discrete vortex method. The flow around stationary cross-sections as well as cross-sections undergoing cross-wind vertical (bending) and rotary (torsional) motions are investigated for assessment of drag coefficient, Strouhal number and aerodynamic derivatives for application in aeroelastic analyses. Good to excellent agreement with wind tunnel test results is demonstrated for analyses of forced wind loading, flutter wind speed and vertical vortex-induced response of four practical girder cross-sections. The success of the simulations is attributed to the bluff nature of the cross-sections and to the two-dimensional (2-D) nature of flow around bridge girders.

The present paper proposes a one degree of freedom (1DOF) non-linear model of self limiting cyclic wind loads for application in finite element method analyses of light structures subjected to vortex shedding excitation under lock-in conditions. Being empirical by nature, the model includes three independent parameters to be determined from response tests with representative aero-elastic wind tunnel models or prototypes. The paper discusses methods for parameter identification from response data. The paper also evaluates the proposed load model versus other 1DOF empirical vortex shedding models which have found some acceptance in wind engineering.

TGFβ signaling extensively cross-talks with Hh, Wnt and RTK signaling to control cell proliferation, migration and differentiation, and when aberrantly regulated leads to developmental defects and cancer. TGFβ signaling is activated through the internalization of TGFβ receptors via clathrin-dependent endocytosis (CDE), at which the receptor activates Smad transcription factors. Here we investigated the relationship between TGFβ signaling and primary cilia in fibroblasts and in EC and human embryonic stem cells during their differentiation into cardiomyocytes and neurons using transcriptomics, imaging and molecular biology tools. During cardiomyocyte differentiation, expression of TGFβ receptors and Smad proteins were up-regulated and targeted to the pocket region of primary cilia, at which the receptor colocalized with clathrin-coated pits and vesicles to activate Smad2/3. This activation was blocked by receptor antagonists or by Ift20 knockdown. In contrast, neuronal differentiation was associated with a loss of ciliary TGFβ signaling. In mouse embryonic fibroblasts (MEFs) and human foreskin fibroblasts (hFFs), TGFβ stimulation increased the targeting of TGFβ receptors to the ciliary pocket region followed by activation of Smad signaling to promote cell cycle entry. In Tg737orpk MEFs there was a major reduction in TGFβ-induced Smad2/3 phosphorylation, and this was associated with reduced activity of clathrin-dependent endocytosis at stumpy primary cilia. Similarly, inhibition of CDE blocked activation of Smad2/3 at the ciliary pocket region in hFFs. Our results suggest that the ciliary pocket region functions as a unique site for regulation of TGFβ signaling and potentially in cross-talking with other signaling pathways during development and in tissue homeostasis.

The secreted glycoprotein YKL-40 participates in cell differentiation, inflammation, and cancer progression. High YKL-40 expression is reported during early human development, but its functions are unknown. Six human embryonic stem cell (hESC) lines were cultured in an atmosphere of low or high oxygen tension, in culture medium with or without basic fibroblast growth factor, and on feeder layers comprising mouse embryonic fibroblasts or human foreskin fibroblasts to evaluate whether hESCs and their progeny produced YKL-40 and to characterize YKL-40 expression during differentiation. Secreted YKL-40 protein and YKL-40 mRNA expression were measured by enzyme-linked immunosorbent assay (ELISA) and quantitative RT-PCR. Serial-sectioned colonies were stained for YKL-40 protein and for pluripotent hESC (OCT4, NANOG) and germ layer (HNF-3β, PDX1, CD34, p63, nestin, PAX6) markers. Double-labeling showed YKL-40 expression in OCT4-positive hESCs, PAX6-positive neuroectodermal cells, and HNF-3β-positive endodermal cells. The differentiating progeny showed strong YKL-40 expression. Abrupt transition between YKL-40 and OCT4-positive hESCs and YKL-40-positive ecto- and neuroectodermal lineages was observed within the same epithelial-like layer. YKL-40-positive cells within deeper layers lacked contact with OCT4-positive cells. YKL-40 may be important in initial cell differentiation from hESCs toward ectoderm and neuroectoderm, with retained epithelial morphology, whereas later differentiation into endoderm and mesoderm involves a transition into the deeper layers of the colony.

Recurrent copy number variants (CNVs) are found in a significant proportion of patients with congenital heart disease (CHD) and some of these CNVs are associated with other developmental defects. In some syndromic patients, CHD may be the first presenting symptom, thus screening of patients with CHD for CNVs in specific genomic regions may lead to early diagnosis and awareness of extracardiac symptoms. We designed a multiplex ligation-dependent probe amplification (MLPA) assay specifically for screening of CHD patients. The MLPA assay allows for simultaneous analysis of CNVs in 25 genomic regions previously associated with CHD. We screened blood samples from 402 CHD patients and identified 14 rare CNVs in 13 (3.2%) patients. Five CNVs were de novo and six where inherited from a healthy parent. The MLPA screen led to early syndrome diagnosis in two of these patients. We conclude that the MLPA assay detects clinically relevant CNVs and suggest that it could be used within pediatric cardiology as a first tier screen to detect clinically relevant CNVs and identify syndromic patients at an early stage. (C) 2012 Wiley Periodicals, Inc. (Less)

Congenital heart disease (CHD) affects 1% of the population. The aetiology of CHD is complex and largely unknown, comprising both environmental and genetic components. Recent progress in molecular cytogenetics has led to the identification of rare genomic copy number variants (CNVs) in a significant proportion of CHD patients. These novel results imply new diagnostic possibilities and may aid in the identification of novel disease genes.

F hypertrophic cardiomyopathy (FHC) is a phenotypically and genetically heterogenous myocardial disease with an autosomal dominant pattern of inheritance. FHC is a frequent cause of sudden death in young people. Knowledge of morbidity and mortality associated with different mutations in the different sarcomere genes associated with FHC may prove to be of importance for clinical decisions concerning treatment, thus, leading to improved patient management. Hence, based on genotype-phenotype analyses, mutations in the MYBPC3 encoding the cardiac myosin-binding protein C gene have generally been associated with a low morbidity and mortality early in life.1 Mutations in the TNNT2 gene encoding cardiac troponin T have been associated with a high incidence of sudden death at young age,2,3 whereas the prognosis associated with different mutations in the MYH7 gene encoding the cardiac b-myosin heavy chain (bMHC) have been more variable.2 FHC families often have their own “private” mutation, and the prognosis of FHC may vary between, as well as within, families with the same mutation, thereby compromising the value of the genotyping. The ValMet mutation is often presented as the prototype of a “benign” MYH7 gene mutation.4–7 We report the unfavorable prognosis in a family with FHC associated with the ValMet mutation in the MYH7 gene and provide cumulated data on the incidence of sudden death at young age based on the present and previously published studies. • • • From a consecutive cohort of 70 families with FHC, family JO of Danish origin was included in the present study at the The Heart Center, Rigshospitalet, University of Copenhagen. After informed consent was given (Local Science Ethics Committee, Copenhagen. Protocol No. KF V92213), patient and family histories were obtained, and physical examination, electrocardiography, and transthoracic echocardiography were performed. The clinical diagnosis of FHC in relatives was based on: (1) electrocardiographic criteria: pathologic Q-waves or signs of left ventricular hypertrophy,8,9 and/or (2) echocardiographic criteria: a maximal left ventricular wall thickness of $13 mm,8,9 in the absence of evidence of other specific heart muscle diseases.10 For family members with disease, clinical records, family histories, or both were obtained whenever available. The clinical diagnosis was made before molecular genetic analysis. Blood samples were collected from probands and family members. Genomic DNA was extracted using a QIAamp DNA purification kit (Qiagen, Hilden, Germany). Mutation analysis of the MYH7 gene was performed using single-strand conformation polymorphism-heteroduplex (SSCP-HD) formation analysis on exons 3–23.11 Specifically for exon 16 the primers were 16F, GTGATGCTCTCTCCTGCTTCCTCA, and 16R, CCGGGAGCCTCAGTCCCTACTT. DNA preparations from 100 randomly selected Guthriecards were used as controls (Local Science Ethics Committee, Copenhagen. Protocol No. 01 to 119/99). Nucleotide sequence determination was performed by cycle sequencing using a Dye Deoxy Terminator Cycle Sequencing kit (Perkin Elmer, Foster City, California) on an ABI373 DNA sequencer (Perkin Elmer). The presently reported family, JO, were also screened for mutations in 7 other cardiac sarcomere genes known to be associated with FHC. The pedigree of family JO is shown in Figure 1. The proband (V:1, 45 years of age) was diagnosed at the age of 15 years. His previously asymptomatic son (VI:1) died suddenly at the age of 14 years. Postmortem examination confirmed the diagnosis of severe hypertrophic cardiomyopathy. The family history revealed 2 additional sudden deaths at young age (I:1 before 30 years of age and IV:1 at the age of 16 years). No additional information concerning these deaths was available. The proband’s sister (V:3, 40 years of age) has FHC, but only with few symptoms, despite pronounced septal hypertrophy and atrial fibrillation. Neither the proband’s mother nor father was available for inclusion in the study. The proband’s 2 daughters (VI:2, 23 years of age and VI:3, 16 years of age) both developed FHC during adolescence. Reports of syncope, nonsustained ventricular tachycardia on Holter monitoring, or abnormal blood pressure response during exercise, and the present family history, led to From the Department of Medicine B, The Heart Centre, Rigshospitalet, University of Copenhagen; and Department of Clinical Biochemistry, Statens Serum Institut, Copenhagen, Denmark. The study was supported by grants from The Danish Heart Foundation; The “Kong Christian den Tiendes Fond”; The Novo Nordisk Foundation; Director Emil C. Hertz and Inger Hertz’s Foundation; Danish Medical Association Research Foundation; and H:S—Copenhagen Hospital Corporation, Copenhagen, Denmark. Dr. Christiansen’s address is: Department of Clinical Biochemistry, Statens Serum Institut, 5 Artillerivej, DK-2300 S., Copenhagen, Denmark. E-mail: mic@ssi.dk. Manuscript received October 8, 2000; revised manuscript received and accepted December 28, 2000.

Passengers using public transport systems often experience waiting times when transferring between two scheduled services. We propose a planning approach which seeks to obtain a favorable trade-off between the conflicting objectives passenger service and operating cost, by allowing some moderate modifications of the timetable during the vehicle scheduling phase. This planning approach is referred to as the Simultaneous Vehicle Scheduling and Passenger Service Problem (SVSPSP). The SVSPSP is solved using a large neighbourhood search metaheuristic. The proposed framework is tested on data inspired by the express-bus network in the Greater Copenhagen Area. The results are encouraging and indicate a potential decrease of passenger waiting times in the network of 10-20%, with the vehicle scheduling costs remaining largely unaffected.

The present paper presents a review of simple analytical models available in the literature for assessment of structural dynamic and aerodynamic performance of suspension bridges. Analytical predictions are compared to results obtained from structural FEM-models and comprehensive wind tunnel tests carried out for a box girder suspension bridge of 1624 meter main span. Satisfactory correlation is obtained for basic natural frequencies and for flutter and buffeting predictions. A modification to the Selberg formula is suggested which accounts for the enhancement of aerodynamic stability through a windward shift of the section centre of gravity.

Aberrant organ development is associated with a wide spectrum of disorders, from schizophrenia to congenital heart disease, but systems-level insight into the underlying processes is very limited. Using heart morphogenesis as general model for dissecting the functional architecture of organ development, we combined detailed phenotype information from deleterious mutations in 255 genes with high-confidence experimental interactome data, and coupled the results to thorough experimental validation. Hereby, we made the first systematic analysis of spatio-temporal protein networks driving many stages of a developing organ identifying several novel signaling modules. Our results show that organ development relies on surprisingly few, extensively recycled, protein modules that integrate into complex higher-order networks. This design allows the formation of a complicated organ using simple building blocks, and suggests how mutations in the same genes can lead to diverse phenotypes. We observe a striking temporal correlation between organ complexity and the number of discrete functional modules coordinating morphogenesis. Our analysis elucidates the organization and composition of spatio-temporal protein networks that drive the formation of organs, which in the future may lay the foundation of novel approaches in treatments, diagnostics, and regenerative medicine., Eunice Kennedy Shriver National Institute of Child Health and Human Development (U.S.) (RO1 grant HD055150-03)

Inflammatory bowel disease (IBD) is a multifactorial disorder with an unknown aetiology. The aim of this study is to employ a murine model of IBD to identify pathways and genes, which may play a key role in the pathogenesis of IBD and could be important for discovery of new disease markers in human disease. Here, we have investigated severe combined immunodeficient (SCID) mice, which upon adoptive transfer with concanavalin A-activated CD4(+) T cells develop inflammation of the colon with predominance in rectum. Mice with increasing level of inflammation was studied. RNA from rectum of transplanted and non-transplanted SCID mice was investigated by a genome-wide gene expression analysis using the Affymetrix mouse expression array 430A (MOE430A) including 22,626 probe sets. A significant change in gene expression (P = 0.00001) is observed in 152 of the genes between the non-transplanted control mice and colitis mice, and among these genes there is an overrepresentation of genes involved in inflammatory processes. Some of the most significant genes showing higher expression encode S100A proteins and chemokines involved in trafficking of leucocytes in inflammatory areas. Classification by gene clustering based on the genes with the significantly altered gene expression corresponds to two different levels of inflammation as established by the histological scoring of the inflamed rectum. These data demonstrate that this SCID T-cell transfer model is a useful animal model for human IBD and can be used for suggesting candidate genes involved in the pathogenesis and for identifying new molecular markers of chronic inflammation in human IBD.

Primary cilia assemble as solitary organelles in most mammalian cells during growth arrest and are thought to coordinate a series of signal transduction pathways required for cell cycle control, cell migration, and cell differentiation during development and in tissue homeostasis. Recently, primary cilia were suggested to control pluripotency, proliferation, and/or differentiation of stem cells, which may comprise an important source in regenerative biology. We here provide a method using a P19.CL6 embryonic carcinoma (EC) stem cell line to study the function of the primary cilium in early cardiogenesis. By knocking down the formation of the primary cilium by nucleofection of plasmid DNA with siRNA sequences against genes essential in ciliogenesis (IFT88 and IFT20) we block hedgehog (Hh) signaling in P19.CL6 cells as well as the differentiation of the cells into beating cardiomyocytes (Clement et al., 2009). Immunofluorescence microscopy, western blotting, and quantitative PCR analysis were employed to delineate the molecular and cellular events in cilia-dependent cardiogenesis. We optimized the nucleofection procedure to generate strong reduction in the frequency of ciliated cells in the P19.CL6 culture.

Cleft lip and/or palate (CL/P) is a common congenital malformation with a complex etiology which is not fully elucidated yet. Epidemiological studies point to different etiologies in the cleft lip and palate subgroups, isolated cleft lip (CL), isolated cleft palate (CP) and combined cleft lip and palate (CLP). In order to understand the biological basis in these cleft lip and palate subgroups better we studied the expression profiles in human tissue from patients with CL/P. In each of the CL/P subgroups, samples were obtained from three patients and gene expression analysis was performed. Moreover, selected differentially expressed genes were analyzed by quantitative RT-PCR, and by immunohistochemical staining of craniofacial tissue from human embryos. Osteopontin (SPP1) and other immune related genes were significantly higher expressed in palate tissue from patients with CLP compared to CP and immunostaining in palatal shelves against SPP1, chemokine receptor 4 (CXCR4) and serglycin (PRG1) in human embryonic craniofacial tissue were positive, supporting a role for these genes in palatal development. However, gene expression profiles are subject to variations during growth and therefore we recommend that future gene expression in CL/P studies should use tissue from the correct embryonic time and place if possible, to overcome the biases in the presented study.

This chapter examines the evolution of research on dynamic vehicle routing problems (DVRP). We de?ne the DVRP and show how it is di?erent from the traditional static vehicle routing problem. We then illustrate the technological environment required. Next, we discuss important characteristics of the problem, including the degree of dynamism, elements relevant for the system objective, and evaluation methods for the performance of algorithms.The chapter then summarizes research prior to 2000 and focuses on developments from 2000 to present. Finally, we o?er our conclusions and suggest directions for future research.

Hedgehog (HH) signaling plays a critical role during embryogenesis and regulates early development of multiple tissues and organs, including the central nervous system. Although much has been revealed of the diverse functions of the HH signaling pathway, it is still unclear how the effects of altered HH signaling are interpreted by specific cell types. We have investigated the role of the HH transcription factor glioma-associated oncogene homolog 1 (GLI1) in the human Ntera2/D1 (NT2) embryonal carcinoma stem cell line. The study revealed that expression of GLI1 and its direct transcriptional target Patched (PTCH) is downregulated in the early stages of retinoic acid-induced neuronal differentiation of NT2 cells. To identify transcriptional targets of the HH transcription factor GLI1 in NT2 cells, we performed global expression profiling following GLI1 RNA interference (RNAi). Of the 8500 transcripts represented on the microarrays, expression of 88 genes was downregulated and expression of 26 genes was upregulated. Nineteen of these genes are involved in cell cycle and proliferation. Further, GLI1 RNAi leads to a significant decrease in NT2 proliferation and changes expression of G1 phase cyclins. In conclusion, our results suggest that GLI1 is involved in cell cycle and proliferation control in the embryonal carcinoma stem cell line NT2.

The COWI Team prepared in 2007 Basic Design and construction cost estimates for Hålogaland Bridge. The bridge is arranged as a single span suspension bridge with A-shaped concrete pylons, inclined cable planes and a closed steel box girder as bridge deck. The combination of a slender bridge and 2.2m high safety railings to prevent would-be-suicides jumping on impulse from the bridge poses a severe design challenge to fulfil the aerodynamic stability requirement of 56m/s at bridge deck level. The issue of vortex induced vibrations for closed steel box bridge decks poses another design challenge. The box section is arranged in such a way that the slope of the lower inclined side plates is at 15.8 degrees in relation to the horizontal bottom plate. Wind tunnel tests carried out in smooth flow have proved that vortex induced vibrations will not occur, thus saving the costs of installation and maintenance of mitigation measures.

We present a dynamic airline scheduling technique that is able to change departure times and reassign aircraft types during the booking process to meet fluctuating passenger demands. The procedure is tested on several different days before departure, resulting in a significant profit increase for a major European airline. The results also indicate that applying dynamic airline scheduling close to departure yields the largest potential.

YKL-40 is a growth factor for chondrocytes and fibroblasts. The aim was to evaluate YKL-40 expression in the musculoskeletal system during early human development. We studied sections from 15 human embryos [weeks 5.5-8; 7- to 31-mm crown-rump length (CRL)] and 68 fetuses (weeks 9-14; 33- to 105-mm CRL) for YKL-40 protein expression by immunohistochemistry. YKL-40 mRNA expression was evaluated in two human embryos (days 41 and 51). Initially YKL-40 is expressed in all germ layers: ecto-, meso-, and endoderm. YKL-40 mRNA and protein expression are found in tissues of the ecto-, meso-, and endoderm, and YKL-40 protein expression is present during development of cartilage, bone, joints, and muscles. At the cellular level, YKL-40 protein expression is high in tissues characterized by rapid proliferation, marked differentiation, and undergoing morphogenetic changes. Examples of rapid cell proliferation include the chondrogenic inner layer of perichondrium and the osteogenic inner layer of periosteum. Differences in YKL-40 expression during differentiation are found in the chondrogenic and osteogenic cell lineages. The initial shaping of cartilage and bone models and joints is concomitant with a strong outline of YKL-40-positive cells. This indicates that YKL-40 is associated with cell proliferation, differentiation, and tissue morphogenesis during development of the human musculoskeletal system.

This protocol describes capillary array electrophoresis single-strand conformation polymorphism (CAE-SSCP), a screening method for detection of unknown and previously identified mutations. The method detects 98% of mutations in a sample material and can be applied to any organism where the goal is to determine genetic variation. This protocol describes how to screen for mutations in 192 singleplex or up to 768 multiplex samples over 3 days. The protocol is based on the principle of sequence-specific mobility of single-stranded DNA in a native polymer, and covers all stages in the procedure, from initial DNA purification to final CAE-SSCP data analysis, as follows: DNA is purified, followed by PCR amplification using fluorescent primers. After PCR amplification, double-stranded DNA is heat-denatured to separate the strands and subsequently cooled on ice to avoid reannealing. Finally, samples are analyzed by capillary electrophoresis and appropriate analysis software.

Background: Fragile X syndrome is caused by the expansion of a CGG trinucleotide repeat at the 5′ untranslated region of the fragile X mental retardation 1 gene (FMR1). When expanded to >200 repeats (full mutation), the repeat region and the adjacent promoter CpG island become hypermethylated, rendering FMR1 transcriptionally inactive. Conventional molecular diagnosis of fragile X syndrome involves determination of the CGG repeat number by Southern blot analysis. Methods: A homogeneous methylation-specific melting curve analysis (MS-MCA) assay for methylation status of the FMR1 promoter region was developed on the LightCycler platform. Genomic DNA was treated with sodium bisulfite, and a region containing 8 CpG sites was amplified in the presence of SYBR Green I, using primers that do not differentiate between methylated and unmethylated FMR1 molecules. After amplification, the samples were melted at 0.05 °C/s, and fluorescence melting curves were recorded. We studied samples, previously characterized by Southern blot analyses, from 10 female and 10 male donors with normal numbers of CGG trinucleotide repeats, 9 male donors who were premutation carriers, 4 male donors who carried both a premutation and a full mutation, and 25 patients with fragile X syndrome. Results: Samples from all 20 male patients with fragile X syndrome showed a high melting peak corresponding to fully methylated FMR1, whereas samples from healthy males showed a single low melting peak corresponding to unmethylated FMR1. Of 24 samples from affected males, 9 (38%) showed 2 melting peaks, suggesting that cellular methylation mosaicism is common in fragile X syndrome. Conclusions: MS-MCA allows rapid and reliable identification of fragile X syndrome in male patients.

Congenital heart disease (CHD) affects nearly 1% of the population, but only few genes involved in human CHD are presently known. Germ-line mutations in the zinc finger transcription factor GATA4 have been associated with familial cases of atrial and ventricular septal defects and pulmonary stenosis. We have screened 99 unrelated Danish patients with different CHD phenotypes to evaluate the prevalence of GATA4 mutations in CHD. No pathogenic mutations were found among the patients, suggesting that GATA4 mutations are relatively rare among CHD patients. Thus, the diagnostic importance of GATA4 mutations may be confined to familial cases or specific subgroups of CHD phenotypes.

Mutations in one of the ion channels shaping the cardiac action potential can lead to action potential prolongation. However, only in a minority of cardiac arrest cases mutations in the known arrhythmia-related genes can be identified. In two patients with arrhythmia and cardiac arrest, we identified the point mutations P91L and E33V in the KCNA5 gene encoding the Kv1.5 potassium channel that has not previously been associated with arrhythmia. We functionally characterized the mutations in HEK293 cells. The mutated channels behaved similarly to the wild-type with respect to biophysical characteristics and drug sensitivity. Both patients also carried a D85N polymorphism in KCNE1, which was neither found to influence the Kv1.5 nor the Kv7.1 channel activity. We conclude that although the two N-terminal Kv1.5 mutations did not show any apparent electrophysiological phenotype, it is possible that they may influence other cellular mechanisms responsible for proper electrical behaviour of native cardiomyocytes.

This chapter discusses important characteristics seen within dynamic vehicle routing problems. We discuss the differences between the traditional static vehicle routing problems and its dynamic counterparts. We give an in-depth introduction to the degree of dynamism measure which can be used to classify dynamic vehicle routing systems. Methods for evaluation of the performance of algorithms that solve on-line routing problems are discussed and we list some of the most important issues to include in the system objective. Finally, we provide a three-echelon classification of dynamic vehicle routing systems based on their degree of dynamism and the system objective

Introduction The human VANGL1 genes has been predicted to be associated with idiopathic scoliosis, as a mutation (c.676C > T, L226F) was identified in a family with dominant inheritance of the disease. A previous investigation of the gene revealed the candidate to segregate, with all but one family member (Sharma, et al. ASHG 2012 Annual Meeting Program Guide. 2012). Adolescent idiopathic scoliosis (AIS) is generally considered multigenetic, but the determining genes remain yet to be characterized. In this study, we have examined VANGL1 as a contributor to the phenotype of AIS. Materials and Methods We have conducted automated Sanger sequencing of the seven coding exons of VANGL1 gene in a disease cohort of 170 AIS patients ( n = 340) and 177 controls ( n = 354). Localization of mutated VANGL1 proteins was investigated in cell systems using immunofluorescence microscopy. Results Two novel mutations, each in separate individuals within the considered disease cohort, were identified. One mutation is situated in the third coding exon, which encodes the transmembrane parts of the VANGL1 protein. This mutation is a c.407T > A (I136N) conversion, for which the patient is heterozygotes. Furthermore, this mutation was also identified in the dizygotic unaffected twin of the patient. The second mutation was found in the seventh coding exon, which encodes the C-terminal of the VANGL1 protein. This mutation is a c.1318T > G (F440V) conversion, for which the patient is also heterozygotes. Neither of the identified mutations was present in the sequenced controls or in 2000 Danish exomes (Lohmueller et al. Am J Hum Genet 2013;93:1072–1086). The F440V mutation results in altered localization of the VANGL1 protein, from very clear membrane association to a cytoplasmic distribution, with possible retainment in endoplasmic reticulum and the Golgi apparatus, near the cell nucleus. Conclusion Our results show that mutations in the VANGL1 gene can cause AIS and suggest that defects in planar cell polarity may be an underlying cause of AIS. Examination of the expression of VANGL1 in juvenile or adult stages of life is wanted, as well as examinations of effects on downstream targets of mutated VANGL1 and polarity in affected cells.

Fragile X syndrome (FXS) is the most prevalent cause of inherited mental retardation, and calculations show that there are approximately 700 non-diagnosed cases in Denmark. Since the disease is severe, screening for FXS should be considered in order to improve genetic counselling. International experience indicates that efforts should initially be on active case finding among persons with learning difficulties and subsequently on cascade screening to identify carriers. Prenatal screening programmes may be an option when reliable high-throughput diagnostic methods are available.

Mutation screening is widely used for molecular diagnostics of inherited disorders. Furthermore, it is anticipated that the present and future identification of genetic risk factors for complex disorders will increase the need for high-throughput mutation screening technologies. Capillary array electrophoresis (CAE) SSCP analysis is a low-cost, automated method with a high throughput and high reproducibility. Thus, the method fulfills many of the demands to be met for application in routine molecular diagnostics. However, the need for performing the electrophoresis at three temperatures between 18 degrees C and 35 degrees C for achievement of high sensitivity is a disadvantage of the method. Using a panel of 185 mutant samples, we have analyzed the effect of sample purification, sample medium and separation matrix on the sensitivity of CAE-SSCP analysis to optimize the method for molecular diagnostic use. We observed different effects from sample purification and sample medium at different electrophoresis temperatures, probably reflecting the complex interplay between sequence composition, electrophoresis conditions and sensitivity in SSCP analysis. The effect on assay sensitivity from three different polymers was tested using a single electrophoresis temperature of 27 degrees C. The data suggest that a sensitivity of 98-99% can be obtained using a 10% long chain poly-N,N-dimethylacrylamide polymer.

Several methods have been developed for amplification of RNA, making it possible to use cDNA microarrays for analysis of samples limited in amount of total RNA. The most widely used amplification protocol, the Eberwine method, amplifies RNA in a linear manner through in vitro transcription (IVT). However, when starting material is limited to nanogram amounts of total RNA, several rounds of amplification are necessary, making this method both expensive and labor-intensive. Amplification by PCR is robust and is able to amplify extremely limiting material. However, it is possible that the nonlinear nature of PCR could result in reduced reproducibility of the amplification compared with IVT. We have evaluated two methods that use a combination of PCR and IVT for amplification of nanogram amounts of total RNA. We have compared microarray results obtained by these methods with results obtained by two established methods: indirect labeling of 20 microg total RNA and Eberwine amplification of 1 microg total RNA. Starting from as little as 5 ng of total RNA, both methods yielded results in concordance with the Eberwine method.

Fine mapping of chromosomal deletions and genotype–phenotype comparisons of clinically well-defined patients can be used to confirm or reveal loci and genes associated with human disorders. Eleven patients with cytogenetically visible deletions involving the terminal region of chromosome 5q have been described, but the extent of the deletion was determined only in one case. In this study we describe a 15-year-old boy with Ebstein anomaly, atrial septal defect (ASD), atrioventricular (AV) conduction defect, and microcephaly. He had an apparently balanced paracentric inversion of chromosome 5, with the karyotype 46, XY,inv(5)(q13q35) de novo. Further mapping of the chromosome breakpoints using fluorescence in situ hybridization (FISH) revealed a 2.2 Mb microdeletion at the 5q35 breakpoint, which spans 16 genes, including the cardiac homeobox transcription factor gene NKX2-5. The current data suggest that haploinsufficiency of NKX2-5 cause Ebstein anomaly and support previous results showing that NKX2-5 mutations cause ASD and AV conduction defect. Furthermore, we suggest presence of a new microcephaly locus within a 2.2 Mb region at 5q35.1–q35.2. © 2006 Wiley-Liss, Inc.