Search

Phylogenetic analyses of chloroplast gene (rbcL, matK), intron (rpl16, rps16, rpoC1) and nuclear ribosomal DNA internal transcribed spacer (ITS) sequences and chloroplast DNA restriction sites, with supplementary data from variation in size of the chloroplast genome inverted repeat, have been used to elucidate major clades within Apiaceae (Umbelliferae) subfamily Apioideae Drude. This paper summarizes the results of previously published molecular cladistic analyses and presents a provisional classification of the subfamily based on taxonomic congruence among the data sets. Ten tribes (Aciphylleae M. F. Watson & S. R. Downie, Bupleureae Spreng., Careae Baill., Echinophoreae Benth., Heteromorpheae M. F. Watson & S. R. Downie, Oenantheae Dumort., Pleurospermeae M. F. Watson & S. R. Downie, Pyramidoptereae Boiss., Scandiceae Spreng. and Smyrnieae Spreng.) are erected or confirmed as monophyletic, with Scandiceae comprising subtribes Daucinae Dumort., Scandicinae Tausch and Torilidinae Dumort. Seven additional clades are also recognized but have yet to be treated formally, and at least 23 genera examined to date are of dubious tribal or clade placement. The utility of these different molecular markers for phylogenetic inference in Apioideae is compared based on maximum parsimony analyses of subsets of previously published molecular data sets. Of the six loci sequenced, the ITS region is seen to be evolving most rapidly and rbcL is the most conservative. Intermediate in rate of evolution are matK and the three chloroplast introns; with rpl16 and rps16 evolving slightly faster than matK or rpoC1. The analysis of restriction sites, however, provided 2–4 times more parsimony informative characters than any single DNA locus sequenced, with estimates of divergence just slightly lower than that of the ITS region. The trees obtained from separate analyses of these reduced data sets are consistent with regard to the major clades inferred and the relationships among them. Similar phylogenies are obtained by combining data or combining trees, representing the supermatrix and supertree approaches to phylogenetic analysis, respectively. The inferred relationship among the tribes and informally recognized major clades within Apioideae is presented.

Nucleotide sequences of a chloroplast rDNA region including 8 bp from the 3" end of 23S rDNA–ITS2–4.5S rDNA–ITS3–5S rDNA–ITS4 (approximately 800 bp) were determined in 25 species of Lycopodiaceae and two species of the genus Isoetes. The rate of molecular evolution of spacers significantly varied in different Lycopsida taxa. A phylogenetic analysis by the neighbor-joining (NJ) method revealed that the family Lycopodiaceae is monophyletic. The topology of phylogenetic trees suggests the isolation of four or probably five genera in family Lycopodiaceae. For these genera, synapomorphic indels were detected. The obtained data were compared with the results of phylogenetic analysis of Lycopsida with regard to other sequences. The relationships of taxa within the family Lycopodiaceae is discussed.

We present the results of spectral studies of thermal microwave emission from a cloudy atmosphere at 37 and 85 GHz. The experimental data are interpreted on the basis of modeling of microwave radiation transfer in the mixed-type clouds containing ice crystals of different shapes and supercooled water drops. All orders of scattering are taken into account. It is shown that polarization radiometric measurements allow one to separately determine ice-water and liquid-water contents of the clouds and also to diagnose the cloud microstructure (crystal shapes and characteristic sizes).

We present the results of an experimental studies of the microwave radiation of the cloudy atmosphere indicating the presence of significant polarization contrasts in the radiation of the winter-spring clouds. The interpretation of the experimental data is made on the basis of a model of microwave radiation transfer in mixed-type clouds consisting of crystals and supercooled water drops.

We studied phagocytic activity of macrophages towards hybrid molecular nanosomal compositions consisting of 150-800-nm nanoliposomes containing oxidized dextrans with a molecular weight of 35 and 60 kDa obtained by chemical ("permanganate") and radiochemical oxidation of dextran conjugated with isonicotinic acid hydrazide (dextrazides, intracellular prolonged antituberculous drugs). Phagocytic activity of macrophages towards hybrid molecular nanosomal compositions containing dextrazides obtained by chemical oxidation of dextrans is higher than activity towards hybrid molecular nanosomal compositions containing dextrazides prepared by radiochemical oxidation and depends on the size of hybrid molecular nanosomal compositions and molecular weight of oxidized dextrans.

For the first time it is carried out an analysis of aperture antennas radiation pattern along field, taking into account an influence of wave appearance fluctuation angle. We have derived formulas for average RP along field, taking into account angle bias of irradiation maximum direction.

The lichen family Umbilicariaceae is accepted by most lichenologists as consisting of two genera, Lasallia and Umbilicaria. The monophyly of these two genera was examined by phylogenetic analyses of nucleotide sequences of ITS 1 and ITS2 rDNA. Sequences of these regions from three Lasallia and 17 Umbilicaria species were aligned to those of seven representatives of the outgroup taxa including Eurotiales, Onygenales and Caliciales (Mycocaliciaceae) and subjected to maximum parsimony, maximum likelihood and neighbour-joining analyses. The resulting phylogenetic hypotheses supported the monophyly of the representative species of Lasallia. However, the species of Umbilicaria did not form a monophyletic sistergroup to Lasallia due to the basal placement of other Umbilicaria species in some analyses. Based on these analyses, if Lasallia is recognized as a separate genus then Umbilicaria appears to be paraphyletic. Although further taxon sampling is required to resolve the monophyly of Umbilicaria, for the present we recommend retaining the current treatment of Lasallia as separate from Umbilicaria.

We performed combined radiometric and radar measurements of the integral water content of a small-drop fraction of rain cloud systems with allowance for the multiple scattering phenomena. The contribution of rain to emission of the “cloud-rain” system was calculated on the basis of the vector equation of radiation transfer, which enabled us to allow for all orders of multiple scattering by spherical rain drops within the framework of the model of statistically independent particles. It was found that the maximum of the integral water content of overcooled water in clouds does not correspond to the maximum of precipitation intensity. The characteristic values of the integral and specific water contents of a small-drop water fraction in cloud systems with precipitation are measured.

We studied the dependence of in vitro dextran biocompatibility on the method of oxidation of 35-kDa dextran. The biocompatibility of dextran oxidized with potassium permanganate was higher compared to that obtained by radiochemical oxidation. It was related to the formation of peroxide compounds during radiochemical oxidation.

Evolutionary relationships among 116 representatives (80 genera) ofApiaceae (Umbelliferae) subfam.Apioideae were investigated by comparative sequencing of the two internal transcribed spacers of the 18S–26S nuclear ribosomal DNA repeat. The resultant phylogenies, inferred using maximum parsimony and neighbor-joining methods, clarified the relationships of several genera whose phylogenetic placements have heretofore been problematic. Comparisons between the phylogenies inferred and the distribution of several phytochemical (coumarins, flavonoids, and phenylpropenes) and morphological (stomates, pollen, and cotyledonary shape) characters were also made, revealing that many of these characters (like those morphological and anatomical characters of the fruit) are highly homoplastic. It is not surprising then that systems of classification ofApioideae based on these characters, particularly with regard to tribal and subtribal designations and relationships, are unsatisfactory. The results of recent serological investigations of the subfamily support several relationships proposed herein using molecular data.

We apply the tensor transfer equation for downward radio emission in a weakly anisotropic medium and a generalized analysis of the generation conditions for such radiation to develope a unified approach to the solution of the problem on reconstruction of the atmospheric temperature prifile over a wide altitude range (from theoustasche layer to the mesosphere) using ground-based measurements of thermal radio emission. Radio emission in the oxygen spin—rotational band centered at the wavelength 5 mm was measured with radiometer equipment of various spectral resolutions. The capabilities of the remote sounding are illustrated by the results of the temperature profile reconstruction in theoustasche layer and troposphere using the radiometric measurements of the atmospheric radio emission, as well as by the results of numerical simulations of the radiometric experiment for the upper layers of the atmosphere. Trends in development of ground-based remote sounding of the temperature are discussed.

We study the dynamics of heat and mass transfer through a water-air interface on the basis of laboratory radiometric measurements of the time dependence of thermal radio emission of water at a frequency of 60 GHz, which is related to air turbulization above its surface by a fan. We recover the dynamics for the temperature profile in water and in a viscous sublayer of air as well as for the heat flux through the water-air interface. The flux components related to evaporation and heat exchange and the rate of evaporation from a unit surface are determined. An equation for determining the thickness of the viscous sublayer in the air from the heat flux value is obtained;this thickness is about 2 mm under the experimental conditions. The process dependence on the water turbulence is established and methods for determining the thermal film thickness are proposed. In the absence of turbulence in unstable stratified water we observed the development of a periodic convective process from the time the critical value of the Rayleigh number was reached. The heat exchange dependence on the presence of petroleum film on the water surface is studied. It is found that for a film thickness of 5 μm the heat exchange rate decreases by a factor of 3 because of the petroleum presence.

The various classes of plant 21 - to 24-nt siRNAs derive from long dsRNA precursors that are processed by the ribonuclease Dicer-like (DCL). The species of ta-siRNA were originally discovered in Arabidopsis thaliana. Four gene families have been identified in Arabidopsis that each produces a number of ta-siRNAs: TAS1, TAS2, TAS3 and TAS4. The TAS3 genes encode tasiR-ARF species which target the mRNA of three Auxin Response Factor (ARF) genes (ARF2, ARF3/ETT and ARF4) for subsequent degradation. The function of TAS3 precursor RNA is controlled by two miR390 target sites flanking tandem of ta-siARF sequences. In this paper, we have studied the presence ofta-siARF RNA genes in the representatives of subtribe Senecioninae. Senecioneae is the largest tribe of Asteraceae, comprised of ca. 150 genera and 3,000 species which include many common succulents of greenhouses. Approximately one-third of species are placed in genus Senecio, making it one of the largest genera of flowering plants. However, there was no information on the structure of TAS genes in these plants. We revealed that the TAS3 species (TAS3-Sen1) in Senecio representatives was actively transcribed, and its homologues are distributed among many Asteracea plants and found to be similar to Arabidopsis AtTAS3a gene. We revealed several prematurely terminated transcripts of TAS3-Sen1. Finding the alternative shortened transcripts of TAS3-Sen1 lacking the 3'-terminal site cleaved by miR390 and retaining the 5'-terminal miR390 non-cleaved site suggested their using as decoys for the modulation of miR390 activity to regulate synthesis of ta-siARF RNAs in different Senecioninae species.

PCR-based approach was used as a phylogenetic profiling tool to probe genomic DNA samples from representatives of evolutionary distant moss taxa, namely, classes Bryopsida, Tetraphidopsida, Polytrichopsida, Andreaeopsida, and Sphagnopsida. We found relatives of allPhyscomitrella patensmiR390 and TAS3-like loci in these plant taxa excluding Sphagnopsida. Importantly, cloning and sequencing ofMarchantia polymorphagenomic DNA showed miR390 and TAS3-like sequences which were also found among genomic reads ofM. polymorphaat NCBI database. Our data suggest that the ancient plant miR390-dependent TAS molecular machinery firstly evolved to target AP2-like mRNAs in Marchantiophyta and only then both ARF- and AP2-specific mRNAs in mosses. The presented analysis shows that moss TAS3 families may undergone losses of tasiAP2 sites during evolution toward ferns and seed plants. These data confirm that miR390-guided genes coding for ARF- and AP2-specific ta-siRNAs have been gradually changed during land plant evolution.

We report the results of thermal radio emission measurements of oil spills on lakes and soil and of thin lake ice at wavelengths of 0.8 and 3 cm from an MI-8 helicopter in oil fields in Western Siberia. Methods of oil-film and ice thickness determination by measurements based on thermal radiation interference in a two-layer medium are developed.

Results of temperature profile measurements at altitude range 0+600 m and total water content measurements during total (Kislovodsk, 2006; Novosibirsk, 2008) and partial (Moscow, 2011) solar eclipse by the using of microwave radiometer data presented in the report. Terrestrial consequences of solar eclipse (especially the total ones) are noticeable and important. Eclipses support unique, specific conditions which give the opportunity to numerous varied meteorological researches. The most important indicator of thermodynamical processes during solar eclipse is air temperature in the different altitudes in the atmospheric boundary layer (ABL). The ABL air temperature depends in general on the flux of solar radiation and on some features of the ground (albedo, absorptivity and emissivity) and the features of the air (mainly humidity).

We studied phagocytic activity of macrophages against molecular-liposome hybrid compositions consisting of liposomes (diameter 200-450 nm) containing oxidized dextrans with a molecular weight of 35 or 60 kDa conjugated with the basic antituberculosis preparation isonicotinic acid hydrazide (dextrazides) during modeling of various disturbances of endocytosis function of phagocytic cells in vitro. Preincubation of macrophages with trypsin, colchicine, or sodium azide did not change the parameters of adhesion of molecular-liposome hybrid compositions to macrophages. It was found that preincubation of cells with colchicine or sodium azide reduced parameters of phagocytosis of the molecular-liposome hybrid compositions; this reduction did not depend on the molecular weight of dextrans entering the composition of the molecular-liposome hybrid compositions.

The effects of molecular liposomal hybrid compositions consisting of liposomes (200-450 nm) containing oxidized dextrans (dextranals; 35-60 kDa) conjugated with isonicotinic acid hydrazide (dextrazides), their components, and native dextrans on the production of granulocytic macrophage CSF by peritoneal macrophages were studied in vitro. Dextranals proved to be more potent inductors of granulocytic macrophage CSF than native dextrans. Conjugation of nicotinic acid hydrazide with dextranals did not modify their capacity to stimulate the production of granulocytic macrophage CSF. Liposomes in the molecular liposomal hybrid compositions did not attenuate the dextrazide capacity to stimulate the production of granulocytic macrophage CSF. Molecular liposomal compositions containing 60 kDa dextrazide exhibited the most potent stimulatory effect on macrophage production of granulocytic macrophage CSF.

TAS loci in plant genomes encode transacting small interfering RNAs (ta-siRNAs) that regulate expression of a number of genes. The function of TAS3 precursor inArabidopsis thalianais controlled by two miR390 target sites flanking two ta-siARF sequences targeting mRNAs of ARF transcription factors. Cleavage of the3′-miR390-site initiates ta-siRNAs biogenesis. Here we describe the new method for identification of plant ta-siRNA precursors based on PCR with oligodeoxyribonucleotide primers mimicking miR390. The method was found to be efficient for dicotiledonous plants, cycads, and mosses. Based on sequences of amplified loci and a database analysis, a novel type of miR390-dependent TAS sequences was identified in dicots. These TAS loci are characterized by a smaller distance between miR390 sites compared to TAS3, a single copy of ta-siARF, and a sequence conservation pattern pointing to the possibility that processing of novel TAS-like locus is initiated by cleavage of the5′-terminal miR390 target site.

The effects of molecular nanosomal hybrid compositions consisting of nanoliposomes with oxidized dextrans (mol. weights 35 and 60 kDa) conjugated with isonicotinic acid hydrazine (dextrazides) on peritoneal macrophages were studied in vitro. Incubation of peritoneal cells with molecular nanosomal hybrid compositions modified the immunological phenotype of macrophage populations, which reflected an increase in their functional activity. Molecular nanosomal hybrid compositions containing dextrazide with 60-kDa dextran more effectively activated macrophages.

We studied the in vitro effect of hybrid molecular-nanosomal biocompatible compositions on cultured peritoneal cells. The compositions consisted of oxidized dextrans with a mean molecular weight of 35 and 60 kDa, which were obtained by chemical and radiochemical oxidation of dextran. Hybrid nanoliposomal compositions of chemically oxidized dextran (permanganate method) had greater biocompatibility and tropic activity to macrophages compared to nanoliposomes of radiochemically oxidized dextran.

This paper is a survey of the current state of molecular studies on bryophyte phylogeny. Molecular data have greatly contributed to developing a phylogeny and classification of bryophytes. The previous traditional systems of classification based on morphological data are being significantly revised. New data of the authors are presented on phylogeny of Hypnales pleurocarpous mosses inferred from nucleotide sequence data of the nuclear DNA internal transcribed spacers ITS1-2 and the trnL-F region of the chloroplast genome.

Basal glume rot, caused by Pseudomonas syringae pv. atrofaciens (PSA), has emerged as a major bacterial disease of wheat, barley, and rye in Russia. Forty-nine suspect strains of PSA isolated from diseased cereal plants from dif- ferent regions of Russia were tentatively identified by production of a fluorescent pigment and confirmed by pathogenicity tests on the host of origin. Each strain was then grouped according to LOPAT (levan, oxidase, potato rot, arginine dihydrolase, and tobacco hypersensitivity) assays. Ten strains were assigned to LOPAT group 1a, 13 to group 1b, 5 to group 2, 4 to group 3, and 16 to group 5. Strains of each group were then characterized by 16S-23S rRNA Intergenic Transcribed Region (ITR) sequencing and fingerprinted by restriction fragment length polymorphism of ITR, and repetitive PCR using REP, ERIC, and BOX primers. A phylogenetic tree constructed from ITR sequence data revealed two discrete clusters, designated "syringae" and "fluorescens". ERIC-PCR did not work well. However, BOX PCR produced very useful differential genomic fingerprints. There was a high correlation between LOPAT group 1a and BOX PCR patterns. The remaining groups showed a low correlation to BOX PCR patterns and a high level of genetic diversity.

Microwave radiometry is a spectral measurement technique for resolving the electromagnetic radiation of matter when its temperature is above absolute zero. The radio-thermometer utilises this technique and consequently can provide temperature distributions in subcutaneous biological tissues. A new phantom was proposed that imitates a mammary gland tumour, and the brightness temperature was observed using radio-thermometers operated at different frequencies, 1.75GHz and 3GHz. The proposed phantom, simulating heat diffusion propagated by tissues around real tumours, revealed that the thermal characteristics of the tumour imitator were well matched to the heat transfer properties of a real tumour and a proportional linear relationship between the location of the tumour imitator and the brightness temperature in a homogenous medium was established. From experiments using the proposed mammary gland tumour phantom and a clinical trial on patients with breast cancer, it could be concluded that a radio-thermometer with a short wavelength (lambda = 10cm, i.e. f= 3GHz) is useful to resolve a thermal anomaly at a shallow depth in an homogenous medium such as a breast.

Results of the ground based radiometric observations, indicating the presence of significant polarization differences in thermal microwave radiation of the cloudy winter-spring atmosphere are reported. An interpretation of the observational data is carried out on the basis of polarized radiative transfer modeling in mixed-phase clouds, containing ice crystals and supercooled water drops.

Partial sequences of the rpoC1 gene from two species of angiosperms and three species of gymnosperms (8330 base pairs) were determined and compared. The data obtained support the hypothesis that angiosperms and gymnosperms are monophyletic and none of the recent groups of the latter is sister to angiosperms.

We determined the sequence of the region of the chloroplast DNA inverted repeat spanning from the 3′-terminus of the 23S rRNA gene to the 5′-terminus of the tRNAArg(ACG) gene (about 700 bp) from 25 bryophytes and from the charophycean alga Chara australis. Phylogenetic analysis of these sequences using the neighbor-joining method suggests an early dichotomy of bryophytes and their paraphyly relative to the tracheophyte lineage. A monophyly of liverworts (Marchantiidae plus Jungermanniidae), a deep divergence of Metzgeriales among Jungermanniidae and a close affinity of the two subclasses of mosses, Sphagnidae and Andreaeidae, are evident. The branching pattern observed is consistent with the phylogenetic distribution of several prominent indels observed in the alignment.

We developed PCR primers against highly conserved regions of the rRNA operon located within the inverted repeat of the chloroplast genome and used these to amplify the region spanning from the 3' terminus of the 23S rRNA gene to the 5' terminus of the 5S rRNA gene. The sequence of this roughly 500-bp region, which includes the 4.5S rRNA gene and two chloroplast intergenic transcribed spacer regions (cpITS2 and cpITS3), was determined from 20 angiosperms, 7 gymnosperms, and 16 ferns (21,700 bp). Sequences for the large subunit of ribulose bisphosphate carboxylase/oxygenase (rbcL) from the same or confamilial genera were analyzed in both separate and combined data sets. Due to the low substitution rate in the inverted repeat region, noncoding sequences in the cpITS region are not saturated with substitutions, in contrast to synonymous sites in rbcL, which are shown to evolve roughly six times faster than noncoding cpITS sequences. Several length polymorphisms with very clear phylogenetic distributions were detected in the data set. Results of phylogenetic analyses provide very strong bootstrap support for monophyly of both spermatophytes and angiosperms. No support for a sister group relationship between Gnetales and angiosperms in either cpITS or rbcL data was found. Rather, weak bootstrap support for monophyly of gymnosperms studied and for a basal position for the aquatic angiosperm Nymphaea among angiosperms studied was observed. Noncoding sequences from the inverted repeat region of chloroplast DNA appear suitable for study of land plant evolution.

5S rRNAs from 12 species of free living and parasitic platyhelminthes were sequenced. In the phylogenetic analysis, attention was focused on the statistical estimates of the trees corresponding to existing phylogenetic hypotheses. The available 5S rRNA data agree well with widely accepted views on the relationships between the Acoela, Polycladida, Tricladida, and Neorhabdocoela; our analysis of the published 18S rRNA sequences also demonstrated good correspondence between these views and molecular data. With available 5S rRNA data the hypothesis that the dalyellioid turbellarians is the sister group of the Neodermata is less convincing than the hypotheses proposing the Neodermata as the sister group of the Neorhabdocoela, or of the Seriata, or of the branch uniting them. A relatively low rate of base replacement in parasitic flatworms, probably, accounts for the uncertain position of the Neodermata, while a relatively high rate in planarians may explain a relatively too early divergence of the Tricladida in several published phylogenetic trees constructed from various rRNA data.

Phylogeny of the genus Barbilophozia inferred from ITS1-2 nrDNA, trn L-F and trn G-intron cpDNA provides different evolutionary scenarios within the genus. ITS1-2 tree placed B. barbata and B. lycopodioides in sister position, whereas from both cpDNA loci morphologically quite distinctive B. barbata is separated from B. hatcheri and B. lycopodioides. The significant differences in nucleotide sequences suggest that B. lycopodioides and B. hatcheri are clearly separated species. The poorly known species— B. rubescen s—has originated through hybridization of B. barbata and B. hatcheri. The occurrence of both two parental types of ITS in hybrid accessions indicate a non-completeness of concerted evolution in these cases. The highest haplotype diversity is found for ITS1-2 that could be caused by recombination, whereas trn L-F and trn G are characterized only by several haplotypes. The haplotypes distribution is weakly supported from geographical evidence.

computational facilities, necessary for implementing the correlational algorythm,are approximately the same both for the Radon transforms and the tomographic images,but when working with the Radon transforms, we omit the step of reconstruction.In result, we make the conclusion, that for the situations discussed above itis better to work directly with the Radon transforms. This conclusion can obviouslybe extended to the more general situation with more than two alternatives.

Complete or partial nucleotide sequences of five different rRNA species, coded by nuclear (18S, 5.8S, and 5S) or chloroplast genomes (5S, 4.5S) from a number of seed plants were determined. Based on the sequence data, the phylogenetic dendrograms were built by two methods, maximum parsimony and compatibility. The topologies of the trees for different rRNA species are not fully congruent, but they share some common features. It may be concluded that both gymnosperms and angiosperms are monophyletic groups. The data obtained suggest that the divergence of all the main groups of extant gymnosperms occurred after the branching off of the angiosperm lineage. As the time of divergence of at least some of these gymnosperm taxa is traceable back to the early Carboniferous, it may be concluded that the genealogical splitting of gymnosperm and angiosperm lineages occurred before this event, at least 360 million years ago, i.e., much earlier than the first angiosperm fossils were dated. Ancestral forms of angiosperms ought to be searched for among Progymnospermopsida. Genealogical relationships among gymnosperm taxa cannot be deduced unambiguously on the basis of rRNA data. The only inference may be that the taxon Gnetopsida is an artificial one, and Gnetum and Ephedra belong to quite different lineages of gymnosperms. As to the phylogenetic position of the two Angiospermae classes, extant monocotyledons seem to be a paraphyletic group located near the root of the angiosperm branch; it emerged at the earliest stages of angiosperm evolution. We may conclude that either monocotyledonous characters arose independently more than once in different groups of ancient Magnoliales or that monocotyledonous forms rather than dicotyledonous Magnoliales were the earliest angiosperms. Judging by the rRNA trees, Magnoliales are the most ancient group among dicotyledons. The most ancient lineage among monocotyledons leads to modern Liliaceae.

5.8 S rRNA from the gymnosperm Ephedra kokanica Regl. (EMBL Data Library accesion No. X15676) has been sequenced. It is 161 nucleotides long and contains three 2′-O-methylated residues - two adenosines and one guanosine. No pseudouridine have been detected. E. kokanica 5.8 S rRNA, as those from other plant species, can form a secondary structure with paired 5′- and 3′-terminal regions. 5.8 S rRNAs of seed plants differ from the moss Mnium rugicum 5.8 S rRNA in that they have longer variable ‘GC-rich’ hairpins with insertions in the loop region. 5.8 S rRNA of E. kokanica reveals 69 and 82% of homology with that of moss and five angiosperm species, respectively. The posttranscriptional modification pattern of plant 5.8 S rRNAs is not strictly conservative.

The complete nucleotide sequence of chloroplast 4.5 S rRNA from the moss Mnium rugicum was determined to be OHUAAGGUGACGGCAAGACUAGCCGUUUAUCAUCACGAUAGGUGCCAAGUGGAAGUGCAGUAAUGUAUGCAGCUGAGGCAUCCUAACAGACCGAGAGAUUUAAACOH. The sequence differs from that of a fern Dryopteris acuminata and of angiosperms 4.5 S rRNA by 8 and 9–14%, respectively. The strong conservation of 4.5 S rRNA in the course of evolution ensures its use for reconstruction of the phylogenetic relations between the higher taxa of plants.

1H, 2H, 7Li and 23Na ENDOR spectra of radical anion of anthraquinone in the matrix of 2.10−4 M alkaline (NaOH or LiOH) frozen solution of methanol were found and studied at 100°K.

A possibility has been considered to generate asymmetrical interference fringes in light reflected by a two-mirror interferometer. The front mirror has high absorption and represents a combination of a very thin ≪ λ absorbing film and a dielectric multilayer coating. By varying the imaginary part of the film surface admittance and the parameters of the dielectric layers, fringe asymmetry can be controlled over a wide range. The suitable formulas have been given for a mirror with a dielectric multilayer looking inside the interferometer. The curves have been plotted illustrating a fringe shape calculated for one particular case. The experimental results supporting the asymmetry control principle and a method for its calculation have been described.