Search

Interleukin-2-inducible tyrosine kinase (ITK) is a crucial cytoplasmic protein in the T-cell signaling pathway. Here, we aimed to demonstrate the anti-inflammatory effect of the selective IL-2-induced tyrosine kinase inhibitor BMS-509744 (BMS) on Graves' orbitopathy (GO) in an in vitro model. ITK mRNA expression in orbital tissues from GO and normal controls was compared using real-time polymerase chain reaction (RT-PCR) and immunohistochemistry. Primary cultured orbital fibroblasts from each group were pretreated with BMS and stimulated with interleukin (IL)-1β to induce inflammatory reaction. ITK mRNA expression was evaluated using western blotting, and inflammatory cytokine production and downstream transcription factor expression were analyzed after pretreatment with BMS. ITK mRNA expression in GO tissues was significantly higher than that in normal control tissues. After stimulation with IL-1β, ITK phosphorylation significantly increased in both GO orbital and normal control tissues. BMS inhibited IL-1β-induced IL-8 expression in the GO orbital fibroblasts. BMS pretreatment significantly suppressed NF-κB phosphorylation in both GO and normal controls. The selective ITK inhibitor attenuates proinflammatory cytokine production and proinflammatory transcription factor phosphorylation in in vitro model of GO.

Background/aim: Interferon-induced trans-membrane protein 1 (IFITM1) is known to be involved in breast cancer progression. We aimed to investigate its role in estrogen receptor (ER)-positive breast cancer cells with wild-type p53 and tamoxifen-resistant breast cancer cells., Materials and Methods: The ER-positive breast cancer cell lines, MCF-7 with wild-type p53 and T47D with mutant p53, were used. We established an MCF-7-derived tamoxifen-resistant cell line (TamR) by long-term culture of MCF-7 cells with 4-hydroxytamoxifen., Results: IFITM1 inhibition in MCF-7 cells significantly decreased cell growth and migration. MCF-7 cells with suppression of IFITM1 using siRNA or ruxolitinib showed reduced cell viability after tamoxifen treatment compared with that in the control MCF-7 cells. Unexpectedly, mRNA and protein levels of IFITM1 were decreased in TamR cells compared with those in MCF-7 cells. TamR cells with suppression of IFITM1 using siRNA or ruxolitinib showed no change in cell viability after treatment with tamoxifen. P53 knockdown using siRNA reduced the mRNA levels of IRF9 and increased mRNA and protein levels of SOCS3 in MCF-7 cells, suggesting that loss or mutation of p53 can affect the induction of IFITM1 via the JAK/STAT signaling pathway in breast cancer. Furthermore, MCF-7 cells with p53 knockdown using siRNA showed no decrease in cell viability after tamoxifen treatment or IFITM1 inhibition, indicating that p53 status may be important for cell death after tamoxifen treatment or IFITM1 inhibition., Conclusion: IFITM1 inhibition may enhance the sensitivity to tamoxifen based on p53-dependent enhancement of IFN signaling in wild-type p53, ER-positive breast cancer cells., (Copyright © 2024, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.)

The present study focused on Rosmarinus officinalis Linn. leaves extract (ROE) mediated synthesis of silver nanoparticles (AgNPs), selenium nanoparticles (SeNPs), reduced graphene oxide (rGO) and silver and selenium nanoparticles decorated on rGO nanomaterials (Ag&SeNPs@rGONM's) for its antibacterial and antifungal in silico mechanistic insight applications. In addition, the toxicity of the synthesized nanomaterials was evaluated using Artemia salina. The formation of AgNPs, SeNPs, rGO and Ag&SeNPs@rGONM's was completed within 1.0, 140, 120 and 144 h, respectively. Various optical and microscopic examinations were evident in the nanomaterial's synthesis. Further, the average size and stability of the synthesized nanomaterials were conformed through dynamic light scattering (DLS) and zeta potential analyzer, respectively. The synthesized Ag&SeNPs@rGONM's were pronounced promising results against Gram-negative bacteria of Escherichia coli and the results achieved from the route of entry and action, reactive oxygen species (ROS), and antioxidant nature of nanoparticles were evidence of its properties. Computational studies further supported these findings, indicating much of the phytochemicals present in ROE well interact with the bacterial surface proteins. Similarly, the synthesized Ag&SeNPs@rGONM's was effective against Fusarium graminearum and Alternaria alternata in a dose dependent manner than its original nanomaterials. In addition, the docking study also confirmed that rosmarinic acid and caffeic acid prominently interacted with the fungal proteins. Interestingly, Ag&SeNPs@rGONM's pronounced less toxic effect compared to AgNPs and SeNPs against Artemia salina, which shows its biocompatibility., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

Background: Graves' orbitopathy (GO) is an autoimmune condition that causes serious ocular symptoms; its treatment strategies are limited. Physalin A is a phytosterol that has shown various therapeutic properties, including anti-inflammatory and anti-fibrotic effects. In this study, we investigated whether physalin A could inhibit inflammation, fibrosis, hyaluronan (hyaluronic acid) production, and adipogenesis, which are crucial to the pathogenesis of GO., Methods: Orbital tissue explants were obtained from patients with GO during orbital decompression surgery and healthy controls. Orbital fibroblasts (OFs) were isolated and treated with different concentrations of physalin A. Using western blot and ELISA analyses, we determined the effects of physalin A on OFs., Results: Physalin A treatment suppressed the production of interleukin (IL)-1β-induced prostaglandin E2 (PGE2) and pro-inflammatory molecules, including cyclooxygenase (COX)-2, IL-6, IL-8, and intercellular adhesion molecule (ICAM)-1. We discovered that physalin A attenuated hyaluronan production induced by IL-1β or insulin-like growth factor (IGF)-1. Moreover, physalin A reduced lipid droplet formation and production of peroxisome proliferator activator (PPAR) γ, CCAAT-enhancer-binding protein (C/EBP) α, C/EBP β, sterol regulatory element binding protein (SREBP)-1, leptin, and adiponectin proteins. Physalin A suppressed the phosphorylation of extracellular signal-related kinase (ERK), nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB), and suppressor of mothers against decapentaplegic (SMAD) 2 signaling protein., Conclusions: Our study suggests that the major mechanisms by which physalin A suppresses GO include reducing inflammation, fibrosis, hyaluronan production, and adipogenesis in OFs. The findings of this study provide evidence of the therapeutic effect of physalin A in GO.

Graves' orbitopathy (GO), a manifestation of Graves' disease, is characterized by orbital fibroblast‑induced inflammation, leading to fibrosis or adipogenesis. Histone deacetylase (HDAC) serves a central role in autoimmune diseases and fibrosis. The present study investigated HDAC inhibition in orbital fibroblasts from patients with GO to evaluate its potential as a therapeutic agent. Primary cultured orbital fibroblasts were treated with an HDAC inhibitor, panobinostat, under the stimulation of IL‑1β, TGF‑β or adipogenic medium. Inflammatory cytokines, and fibrosis‑ and adipogenesis‑related proteins were analyzed using western blotting. The effects of panobinostat on HDAC mRNA expression were measured in GO orbital fibroblasts, and specific HDACs were inhibited using small interfering RNA transfection. Panobinostat significantly reduced the IL‑1β‑induced production of inflammatory cytokines and TGF‑β‑induced production of fibrosis‑related proteins. It also suppressed adipocyte differentiation and adipogenic transcription factor production. Furthermore, it significantly attenuated HDAC7 mRNA expression in GO orbital fibroblasts. In addition, the silencing of HDAC7 led to anti‑inflammatory and anti‑fibrotic effects. In conclusion, by inhibiting HDAC7 gene expression, panobinostat may suppress the production of inflammatory cytokines, profibrotic proteins and adipogenesis in GO orbital fibroblasts. The present in vitro study suggested that HDAC7 could be a potential therapeutic target for inhibiting the inflammatory, adipogenic and fibrotic mechanisms of GO.

Introduction: Bruton's tyrosine kinase (BTK) and interleukin (IL)-2 Inducible T-cell Kinase (ITK) inhibitors have anti-inflammatory properties. We investigated the therapeutic effect of ibrutinib, an orally bioavailable BTK/ITK inhibitor, in a mouse model of Graves' orbitopathy (GO)., Methods: Genetic immunization was performed through intramuscular administration of the recombinant plasmid, pCMV6-hTSHR cDNA, to 8-week-old female BALB/c mice. Serum levels of T3, T4, and thyroid-stimulating hormone receptor (TSHR) antibodies (TRAbs) were quantified using enzyme-linked immunosorbent assay. Histopathological changes in orbital tissues were examined using immunohistochemistry (IHC) staining for TSHR and various inflammatory markers. Following successful genetic immunization, ibrutinib was orally administered daily for 2 weeks in the GO model mice. After treatment, the mRNA and protein expression levels of BTK, ITK, IL-1β, and IL-6 in orbital tissues were evaluated using real-time PCR and Western blotting., Results: In total, 20 mice were sacrificed to confirm successful genetic immunization. The GO mouse group exhibited significantly increased serum T3, T4, and TRAb levels. IHC revealed increased expression of TSHR, IL-1β, IL-6, transforming growth factor-β1, interferon-γ, CD40, CD4, BTK, and ITK in the GO mouse model. The orbital inflammation was significantly attenuated in ibrutinib-treated mice. The mRNA and protein expression levels of BTK, ITK, IL-1β, and IL-6 in orbital tissue were lower in ibrutinib-treated GO mouse group compared to the phosphate-buffered saline-treated GO mouse group., Conclusion: The GO mouse model demonstrated enhanced BTK and ITK expression. Ibrutinib, a BTK/ITK inhibitor, suppressed the inflammatory cytokine production. These findings highlight the potential involvement of BTK/ITK in the inflammatory pathogenesis of GO, suggesting its role as a novel therapeutic target., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Kim, Park, Choi, Jun, Chung, Park, Yoon, Yang and Jang.)

Serum erythropoietin (sEPO) is an initial screening tool for distinguishing polycythemia vera (PV) from secondary erythrocytosis (SE), but defining 'subnormal' sEPO levels for PV diagnosis remains contentious, complicating its clinical utility. This study compares the diagnostic performance of sEPO across established subnormal limits, including reference interval (RI), clinical decision limit (CDL), and functional reference limit. sEPO levels were analyzed in 393 healthy donors (HDs) and 90 patients (41 PV and 49 SE), who underwent bone marrow biopsy and genetic tests due to erythrocytosis. The RI (2.5-97.5 percentile from HDs) of sEPO was 5.3-26.3 IU/L. A CDL of 3.1 IU/L, determined by ROC analysis in erythrocytosis patients, had a sensitivity of 80.5% and specificity of 87.8% for diagnosing PV. A functional reference limit of 7.0 IU/L, estimated based on the relationship between sEPO and hemoglobin, hematocrit, and WBC, increased sensitivity to 97.6% but decreased specificity to 46.7%. Using 5.3 IU/L as a 'subnormal' limit identified all three JAK2-negative PV cases, increasing the sensitivity and negative predictive value to 97.6% and 97.0%, respectively. Combining the RI, CDL, and functional reference limit may improve PV diagnostic accuracy.

Bovine hemolytic anemia has a negative impact on animal welfare and productivity due to its associated clinical symptoms. Hemolysis is generally known to cause reticulocytosis, increased indirect bilirubin, decreased concentration of haptoglobin, and increased lactate dehydrogenase. Additionally, tissue hypoperfusion due to concomitant anemia increases blood lactate concentration. However, few studies have reported the correlation between these indicators and hemolytic anemia in cattle. We expected that alterations in hematological and biochemical parameters could identify cattle with hemolytic anemia. Therefore, in addition to reporting differences in indicators according to hemolytic anemia, this study aimed to derive indicators and set criteria for identification of bovine hemolytic anemia. In cattle with hemolytic anemia, reticulocytosis, increased indirect bilirubin, and increased L-lactate were observed, and the correlation of these indicators with hematocrit (HCT) was confirmed. And since HCT alone has limitations in identifying hemolytic anemia, we suggest additional criteria to identify hemolytic anemia in cattle., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Jung, Ku, Kim, Kim, So, Piao, Yoon and Park.)

Home oxygen therapy (HOT) is prescribed to patients with pulmonary dysfunction to improve survival and quality of life. However, ignition of oxygen can lead to burns with significant morbidity and mortality. Providers who routinely treat this patient population face an ethical issue: balancing the obligation to provide beneficial treatment to a patient with the responsibility to protect that patient from suffering avoidable burn injuries. A thorough review was conducted to assess the literature regarding ethical considerations involved in managing patients who have been burned while smoking on HOT and who continue to smoke. Various aspects of this problem and potential approaches to address it were analyzed with respect to 4 core ethical principles of health care: beneficence, nonmaleficence, autonomy, and justice. For patients who repeatedly present with burns acquired secondary to smoking while on oxygen, the authors consider it ethically unacceptable to withhold standard-of-care intervention for acute burns because refusal to treat acute burns conflicts with all 4 ethical principles. A preventive strategy would encourage a more judicious prescription of HOT, supporting the principles of nonmaleficence and beneficence. Additional preventive strategies include upstream solutions such as longitudinal patient education about smoking cessation and the risks of smoking on HOT. Physicians are tasked with the responsibility of both providing optimal care for this patient population and preventing future burn injuries. They may be able to address this challenging situation by thinking more critically about potential solutions while bearing in mind key ethical considerations and obligations., (© The Author(s) 2024. Published by Oxford University Press on behalf of the American Burn Association. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)

Objective: To quantify the observed decrease in orbital decompressions being performed at one tertiary care institution and to determine the rate and predictive factors of orbital decompression surgery following treatment with teprotumumab for thyroid eye disease., Methods: Epic's SlicerDicer program was used to analyze recent trends in the overall number of thyroid eye disease (TED) patients evaluated in the oculoplastic surgery department, as well as usage trends of CPT codes 67445 (lateral orbitotomy with bone removal for decompression) and 67414 (orbitotomy with removal of bone for decompression). A retrospective chart review of active moderate-to-severe TED patients treated with teprotumumab was performed at a single tertiary care center. The main outcome measure was whether or not patients underwent bony orbital decompression surgery following treatment with teprotumumab. The SlicerDicer search demonstrated stable usage of CPT codes 67445 and 67414 from 2016 to 2019, followed by a significant decrease from 2020 to 2023, over a background of increasing numbers of TED patients evaluated in clinic. Following teprotumumab therapy, 25% of patients and 18% of orbits underwent bony decompression. Surgically decompressed patients had higher pre- and post-teprotumumab exophthalmometry measurements compared with patients who did not undergo bony decompression. Average time to decompression following conclusion or cessation of teprotumumab therapy was 12.6 months., Conclusion: While the number of TED patients treated at one tertiary care center has risen over recent years, the number of orbital decompression surgeries has declined. Orbital decompression, however, is still needed in select patients after treatment with teprotumumab., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Objective: To investigate the risk of cardiovascular disease (CVD) associated with increasing dose of a non-steroidal anti-inflammatory drug (NSAID) in patients with ankylosing spondylitis (AS)., Methods: Using the Korean National Health Insurance database, patients newly diagnosed with AS without prior CVD between 2010 and 2018 were included in this nationwide cohort study. The primary outcome was CVD, a composite outcome of ischaemic heart disease, stroke or congestive heart failure. Exposure to NSAIDs was evaluated using a time-varying approach. The dose of NSAIDs was considered in each exposure period. Cox proportional hazard regression was used to investigate the risk of CVD associated with NSAID use., Results: Of the 19 775 patients (mean age, 36 years; 75% were male), 19 706 received NSAID treatment. During follow-up period of 98 290 person-years, 1663 cases of CVD occurred including 1157 cases of ischaemic heart disease, 301 cases of stroke and 613 cases of congestive heart failure. Increasing dose of NSAIDs was associated with incident CVD after adjusting for confounders (adjusted HR (aHR) 1.10; 95% CI 1.08 to 1.13). Specifically, increasing dose of NSAIDs was associated with incident ischaemic heart disease (aHR 1.08; 95% CI 1.05 to 1.11), stroke (aHR 1.09; 95% CI 1.04 to 1.15) and congestive heart failure (aHR 1.12; 95% CI 1.08 to 1.16). The association between NSAID dose and higher CVD risk was consistent in different subgroups., Conclusion: In a real-world AS cohort, higher dose of NSAID treatment was associated with a higher risk of CVD, including ischaemic heart disease, stroke and congestive heart failure., Competing Interests: Competing interests: None declared., (© Author(s) (or their employer(s)) 2024. No commercial re-use. See rights and permissions. Published by BMJ on behalf of EULAR.)

Purpose: Orbital fibroblasts play key roles in the pathogenesis of Graves' orbitopathy (GO), and previous findings have shown that endoplasmic reticulum (ER) stress and autophagy also contribute to GO. In this study, we investigated the presently unclear roles of inositol-requiring enzyme 1 (IRE1) and related autophagy processes in the pro-fibrotic mechanism of GO., Materials and Methods: Orbital adipose/connective tissues were obtained from eight GO patients and six normal individuals during surgery. GO fibroblasts were transfected with IRE1 small-interfering RNA and treated with bafilomycin A1 (Baf-A1) to evaluate the inhibitory effects of ER stress and autophagy, and protein-expression levels were analyzed through western blotting after stimulation with transforming growth factor (TGF)-β., Results: TGF-β stimulation upregulated IRE1 in GO orbital fibroblasts, whereas silencing IRE1 suppressed fibrosis and autophagy responses. Similarly, Baf-A1, an inhibitor of late-phase autophagy, decreased the expression of pro-fibrotic proteins., Conclusion: IRE1 mediates autophagy and the pro-fibrotic mechanism of GO, which provides a more comprehensive interpretation of GO pathogenesis and suggests potential therapeutic targets., Competing Interests: The authors have no potential conflicts of interest to disclose., (© Copyright: Yonsei University College of Medicine 2024.)

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10 -9 - 200 × 10 -9  M), detection limit (1.0 × 10 -9  M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Thrombin, which plays a crucial role in hemostasis, is also implicated in cancer progression. In the present study, the effects of the thrombin‑targeting recombinant tyrosine‑sulfated madanin‑1 on cancer cell behavior and signaling pathways compared with madanin‑1 wild‑type (WT) were investigated. Recombinant madanin‑1 2 sulfation (madanin‑1 2S) and madanin‑1 WT proteins were generated using Escherichia coli . SKOV3 and MDA‑MB‑231 cells were treated with purified recombinant proteins with or without thrombin stimulation. Migration and invasion of cells were analyzed by wound healing assay and Transwell assay, respectively. Thrombin markedly increased cell migration and invasion in both SKOV3 and MDA‑MB‑231 cells, which were significantly suppressed by madanin‑1 2S (P<0.05). Madanin‑1 2S also significantly suppressed thrombin‑induced expression of phosphorylated (p)‑Akt and p‑extracellular signal‑regulated kinase in both cell lines (P<0.05), whereas madanin‑1 WT had no effect on the expression levels of these proteins in MDA‑MB‑231 cells. Furthermore, madanin‑1 2S significantly reversed the effects of thrombin on E‑cadherin, N‑cadherin and vimentin expression in MDA‑MB‑231 cells (P<0.05), whereas madanin‑1 WT did not show any effect. In conclusion, madanin‑1 2S suppressed the migration and invasion of cancer cells more effectively than madanin‑1 WT. It is hypothesized that inhibiting thrombin via the sulfated form of madanin‑1 may be a potential candidate for enhanced cancer therapy; however, further in vivo validation is required.

Dermatophytic pseudomycetoma (DPM), which is a deeper dermal and/or subcutaneous infection of dermatophytes, has been rarely reported in Domestic Korean Short Hair Cats. A 3-year-old, spayed female, domestic Korean Short Hair Cat presented with a history of crusts, nodules, and pruritus for 1 year. At the initial presentation, multifocal ulcerative nodules covered with yellowish grains were noted on her ventral thorax, abdomen, flank, and left hindlimb. Cytology of ulcerative nodules revealed degenerative neutrophils, macrophages, multinucleated giant cells, and hyphae. Histological examination of nodules revealed pyogranulomatous dermatitis with fungal plaques, and Microsporum canis and Staphylococcus aureus were identified in the culture. Therefore, the cat was diagnosed with DPM with secondary pyoderma. Oral itraconazole (10 mg/kg, once a day) was administered, but no significant improvement was observed. Therefore, intralesional (IL) injection of amphotericin B (0.6 mg/nodule) and oral administration of terbinafine (30 mg/kg, twice a day) were administered to the cat. With these medications, ulceration and the number and size of nodules decreased significantly, although large dome-shaped nodules remained. Skin lesions were treated with oral terbinafine and itraconazole administration for 5 months. However, after 6 months, recurrence of multifocal ulcerative nodules was observed, and the cat died 10 months after initial presentation. In this case, IL amphotericin B and oral terbinafine administration were partially effective in DPM treatment, suggesting that this may be an option for DPM treatment. Further studies to determine dose and frequency of IL amphotericin B in the management of DPM are warranted., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Cho, Park, Park and Yoon.)

Baker's cysts (BCs) are known to be associated with intra-articular pathologies. BCs can be classified into 2 types: simple and complicated. Although some studies have focused on BC using magnetic resonance imaging (MRI), which is the gold standard examination, no study has compared knee MRI features in patients with simple and complicated BCs. To assess the relationship between the type of BC (simple vs complicated) and other knee pathologies using MRI. Seventy patients who underwent knee MRI examination due to symptomatic knee were retrospectively recruited from April 2011 to April 2021 at a single hospital. In the knee MRI images, the following were assessed: type (simple or complicated), morphology, volume of BCs, thickness of the suprapatellar recess, presence of synovial proliferation of the suprapatellar recess, grade of knee joint effusion, presence of meniscal tear, and extent of meniscal extrusion. The patients were classified into 2 groups according to the type of BC: simple BC and complicated BC. The differences between the 2 groups were evaluated for all variables. Finally, 52 patients were included in this study, 15 were classified as "simple BC" group and 37 as "complicated BC" group. The volume of complicated BC (median: 4.6, interquartile range - IQR: 1.6-12.4) was significantly greater than that of simple BC (median: 0.7, IQR: 0.3-3.7; P = .007). The presence of synovial proliferation in the suprapatellar recess was significantly higher in complicated BC (91.9%) than that in simple BC (46.7%; P = .001). The thickness of the suprapatellar recess was significantly greater in complicated BC (median: 7.5, IQR: 5.8-10.7) than that in simple BC (median: 4.3, IQR: 2.3-7.6; P = .020). The medial meniscus extrusion was greater in complicated BC (median: 4.1, IQR: 2.8-5.1) than that in simple BC (median: 2.5, IQR: 1.8-4.4; P = .037). After adjusting these P-values using the Holm method, only the presence of synovial proliferation in the suprapatellar recess remained significant (P = .010). Using knee MRI images, we demonstrated that complicated BCs are more associated with intra-articular pathologies than simple BCs; such as cyst volume, amount of the knee joint effusion, synovial proliferation and medial meniscal extrusion. Among them, the presence of synovial proliferation was the most significant factor associated with complicated BCs., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Thyroid eye disease (TED) is the most common extrathyroidal manifestation of Graves disease. There has been no effective medication to prevent proptosis in thyroid eye disease until 2020 when the anti-insulin-like growth factor 1 receptor (anti-IGF-1R) antibody, Teprotumumab, was approved by the US Food and Drug Administration, sparking increased interest in immune-based drug development. This study aims to review the newly developed drug therapy as well as conventional treatment for TED. Treatment of TED has traditionally been high-dose steroids and orbital radiotherapy, but recently there has been a paradigm shift in the treatment of TED in the United States with the introduction of the therapeutic agent teprotumumab, which dramatically reduces proptosis. However, concerns remain about the development of hearing impairment as a potentially fatal complication and long-term safety. Recently, several clinical trials are underway to assess the efficacy and safety of novel drugs targeting mammalian target of rapamycin complex 1, interleukin-6, fragment crystallizable receptor, and IGF-1R in treating TED. With the explosive increase in interest from academia and pharmaceutical companies in TED, there is anticipation for the development of drugs that are equivalent or superior to teprotumumab while being safer.

The development of novel compounds for tissue-specific targeting and imaging is often impeded by a lack of lead compounds and the availability of reliable chemistry. Automated chemical synthesis systems provide a potential solution by enabling reliable, repeated access to large compound libraries for screening. Here we report an integrated solid-phase combinatorial chemistry system created using commercial and customized robots. Our goal is to optimize reaction parameters, such as varying temperature, shaking, microwave irradiation, aspirating and dispensing large-sized solid beads, and handling different washing solvents for separation and purification. This automated system accommodates diverse chemical reactions such as peptide synthesis and conventional coupling reactions. To confirm its functionality and reproducibility, 20 nerve-specific contrast agents for biomedical imaging were systematically and repeatedly synthesized and compared to other nerve-targeted agents using molecular fingerprinting and Uniform Manifold Approximation and Projection, which lays the foundation for creating reliable and reproductive chemical libraries in bioimaging and nanomedicine., Competing Interests: There are no conflicts to declare., (This journal is © The Royal Society of Chemistry.)

Key Message: 111 PHD genes were newly identified in rye genome and ScPHD5's role in regulating cold tolerance and flowering time was suggested. Plant homeodomain (PHD)-finger proteins regulate the physical properties of chromatin and control plant development and stress tolerance. Although rye (Secale cereale L.) is a major winter crop, PHD-finger proteins in rye have not been studied. Here, we identified 111 PHD genes in the rye genome that exhibited diverse gene and protein sequence structures. Phylogenetic tree analysis revealed that PHDs were genetically close in monocots and diverged from those in dicots. Duplication and synteny analyses demonstrated that ScPHDs have undergone several duplications during evolution and that high synteny is conserved among the Triticeae species. Tissue-specific and abiotic stress-responsive gene expression analyses indicated that ScPHDs were highly expressed in spikelets and developing seeds and were responsive to cold and drought stress. One of these genes, ScPHD5, was selected for further functional characterization. ScPHD5 was highly expressed in the spike tissues and was localized in the nuclei of rye protoplasts and tobacco leaves. ScPHD5-overexpressing Brachypodium was more tolerant to freezing stress than wild-type (WT), with increased CBF and COR gene expression. Additionally, these transgenic plants displayed an extremely early flowering phenotype that flowered more than two weeks earlier than the WT, and vernalization genes, rather than photoperiod genes, were increased in the WT. RNA-seq analysis revealed that diverse stress response genes, including HSPs, HSFs, LEAs, and MADS-box genes, were also upregulated in transgenic plants. Our study will help elucidate the roles of PHD genes in plant development and abiotic stress tolerance in rye., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Freezing temperature during overwintering often kills plants; plants have thus, developed a defense mechanism called 'cold acclimation', in which a number of genes are involved in increasing cell protection and gene expression. Mitogen-activated protein kinase (MAPK) controls proteins' activities by phosphorylation and is involved in numerous metabolic pathways. In this study, we identified the protein interaction between TaMAPK3 and the proteins in the cold response pathway, ICE41, ICE87, and CBFIVd-D9. The subcellular localization and bimolecular fluorescence complement (BiFC) assays revealed that these proteins interact in the nucleus or in the plasma membrane. Furthermore, MAPK3-mediated phosphorylation of ICE41, ICE87, and CBFIVd-D9 was verified using an in vitro phosphorylation assay. TaMAPK3-overexpressing transgenic Brachypodium showed a lower survival rate upon freezing stress and lower proline content during cold acclimation, compared to wild-type plants. Furthermore, cold response gene expression analysis revealed that the expression of these genes was suppressed in the transgenic lines under cold treatment. It was further elucidated that MAPK3 mediates the degradation of ICE and CBF proteins, which implies the negative impact of MAPK3 on the freezing tolerance of plants. This study will help to elucidate the molecular mechanisms of cold tolerance and the activity of MAPK3 in wheat., Competing Interests: Declaration of competing Interest The authors declare that they have no competing interests., (Copyright © 2024 Elsevier GmbH. All rights reserved.)

A rechargeable battery that employs a Li metal anode requires that Li be plated in a uniform fashion during charging. In "anode-free" configurations, this plating will occur on the surface of the Cu current collector (CC) during the initial cycle and in any subsequent cycle where the capacity of the cell is fully accessed. Experimental measurements have shown that the plating of Li on Cu can be inhomogeneous, which can lower the efficiency of plating and foster the formation of Li dendrites. The present study employs a combination of first-principles calculations and sessile drop experiments to characterize the thermodynamics and adhesive ( i.e. , wetting) properties of interfaces involving Li and other phases present on or near the CC. Interfaces between Li and Cu, Cu 2 O, and Li 2 O are considered. The calculations predict that both Cu and Cu 2 O surfaces are lithiophilic. However, sessile drop measurements reveal that Li wetting occurs readily only on pristine Cu. This apparent discrepancy is explained by the occurrence of a spontaneous conversion reaction, 2 Li + Cu 2 O → Li 2 O + 2 Cu, that generates Li 2 O as one of its products. Calculations and sessile drop measurements show that Li does not wet (newly formed) Li 2 O. Hence, Li that is deposited on a Cu CC where surface oxide species are present will encounter a compositionally heterogeneous substrate comprising lithiophillic (Cu) and lithiophobic (Li 2 O) regions. These initial heterogeneities have the potential to influence the longer-term behavior of the anode under cycling. In sum, the present study provides insights into the early stage processes associated with Li plating in anode-free batteries and describes mechanisms that contribute to inefficiencies in their operation.

Background: Proton pump inhibitors (PPI) are frequently used in patients with cirrhosis., Aims: This study aimed to determine whether PPI use is associated with the prognosis of cirrhotic patients., Methods: We conducted a multicentre retrospective cohort study involving 1485 patients who had experienced hepatic encephalopathy (HE) from 7 referral centres in Korea. The primary outcome was overall survival and secondary outcomes included the development of cirrhotic complications, including recurrent HE, spontaneous bacterial peritonitis (SBP), hepatorenal syndrome (HRS), and gastrointestinal bleeding. Patients treated with PPI with a mean defined daily dose (mDDD) ≥0.5 (high-dose PPI group) were compared to those treated with PPI of an mDDD < 0.5 (No or low-dose PPI group) for each outcome., Results: Among 1485 patients (median age, 61 years; male, 61%), 232 were assigned to the high-dose PPI group. High-dose PPI use was independently associated with a higher risk of death (adjusted HR [aHR] = 1.71, 95% confidence interval [CI] = 1.38-2.11, p < 0.001). This result was reproducible after propensity score-matching (PSM) (aHR = 1.90, 95% CI = 1.49-2.44, p < 0.001). High-dose PPI use was an independent risk factor of recurrent HE (before PSM: aHR = 2.04, 95% CI = 1.66-2.51, p < 0.001; after PSM: aHR = 2.16, 95% CI = 1.70-2.74, p < 0.001), SBP (before PSM: aHR = 1.87, 95% CI = 1.43-2.43, p < 0.001; after PSM: aHR = 1.76, 95% CI = 1.31-2.36, p = 0.002), HRS (before PSM: aHR = 1.48, 95% CI = 1.02-2.15, p = 0.04; after PSM: aHR = 1.47, 95% CI = 0.95-2.28, p = 0.09), and gastrointestinal bleeding (before PSM: aHR = 1.46, 95% CI = 1.12-1.90, p = 0.006; after PSM: aHR = 1.74, 95% CI = 1.28-2.37, p < 0.001)., Conclusions: The use of high-dose PPI was independently associated with increased risks of mortality and cirrhotic complications., (© 2024 John Wiley & Sons Ltd.)

Purpose: To explore if orbital fat-to-muscle ratio (FMR) is predictive of whether surgical decompression or teprotumumab leads to greater proptosis reduction in thyroid eye disease (TED)., Methods: A single-center retrospective cohort study comparing surgical decompression with teprotumumab according to FMR. All TED patients completing an 8-dose course of teprotumumab between January 2020 and September 2022 and all patients undergoing bony orbital decompression from January 2017 to December 2019 were included. Subjects were excluded if they were <18 years, received both surgical decompression and teprotumumab, or lacked orbital imaging. The primary exposure variable was teprotumumab or surgical decompression. The secondary exposure variable was baseline FMR. The primary outcome measure was change in proptosis (mm)., Results: Thirty-eight patients, mean age 53.5 years (±11.4), were included in the teprotumumab group and 160 patients, mean age 48 years (±11.1), in the surgical group. Average proptosis reduction after teprotumumab and surgical decompression was 3 mm (±1.44) and 5 mm (±1.75), respectively. The FMR was stratified at the median of 1.80. In subjects with FMR < 1.80, teprotumumab showed equivalent proptosis reduction compared to surgical decompression, -0.33 mm (SE 1.32) p  = .802. In subjects with FMR ≥ 1.80, surgical decompression led to significantly more proptosis reduction than teprotumumab, 3.01 mm (SE 0.54), p  < .001., Conclusions: Baseline FMR can be used to counsel patients as to proptosis reduction with teprotumumab versus surgery. Subjects with low FMR obtain comparable proptosis reduction with teprotumumab or surgery, whereas high FMR is associated with more significant proptosis reduction following surgery over teprotumumab.

Introduction: Although statin therapy reduces cardiovascular events, statin use is associated with the risk of new-onset diabetes mellitus (NODM). Using a linked dataset, we evaluated the effect of statin treatment on vascular outcomes and NODM development in patients with ischemic stroke., Methods: From the dataset, we identified 20,250 patients with acute ischemic stroke who had neither a prior history of DM nor a previous history of statin use before the index stroke. Patients were divided into statin users and non-users. The outcomes were NODM and vascular outcomes, including recurrent ischemic stroke and acute myocardial infarction (AMI)., Results: Of the 20,250 patients, 13,706 (67.7%) received statin treatment after the index stroke. For the risk of NODM, a time-response relationship was observed between the use of statins and NODM; a longer post-stroke follow-up duration substantially increased the risk of NODM. Among those with ischemic stroke exceeding 3 years, statin users had an approximately 1.7-fold greater risk of NODM than statin non-users. Statin therapy significantly reduced the risk of recurrent ischemic stroke by 54% (HR 0.46, 95% CI, 0.43-0.50, P < 0.001) across all stroke subtypes., Conclusion: Statin therapy following ischemic stroke increased the occurrence of NODM in patients over a period of 3 years. Despite the increased risk of NODM, statin therapy shows a beneficial effect in reducing major cardiovascular events such as recurrent ischemic stroke and AMI in patients with ischemic stroke., (S. Karger AG, Basel.)

Purpose: To identify the effects of Rho Kinase (ROCK) inhibitor medications on human orbital adipogenesis, fibroblast proliferation, and fibrosis., Methods: Orbital adipose tissue was obtained from patients with Graves' ophthalmopathy (GO) as well as controls (non-GO or normal) after informed consent was done. These tissue samples were cultured and adipogenesis was initiated. Levels of Rho Kinase as well as cellular mediators of orbital inflammation and fibrosis. The same cultures and measurements were then repeated with the use of a ROCK inhibitor (KD025-ROCK2) to assess for changes in adipogenesis as well as markers associated with inflammation and fibrosis., Results: Rho Kinase levels in GO tissue were more highly expressed than in controls. These levels were suppressed with the use of the ROCK inhibitor KD025. There was a dose-dependent reduction in differentiation of orbital adipocytes with the use of KD025. KD025 reduced the levels of fibrosis-related gene expression. Finally, there was a significant reduction of transforming growth factor beta mediated phosphorylation signaling pathways in the KD025-treated GO tissue., Conclusion: This study shows that the ROCK inhibitor, KD025, helps to reduce the expression of ROCK in GO tissue along with reducing orbital adipocyte differentiation as well as cell mediators involved in fibrosis that occurs in GO., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2023 The American Society of Ophthalmic Plastic and Reconstructive Surgery, Inc.)

Objective: Three-dimensional (3D) modeling technology aids the reconstructive surgeon in designing and tailoring individualized implants for the reconstruction of complex craniofacial fractures. Three-dimensional modeling and printing have traditionally been outsourced to commercial vendors but can now be incorporated into both private and academic craniomaxillofacial practices. The goal of this report is to present a low-cost, standardized office-based workflow for restoring bony orbital volume in traumatic orbital fractures., Methods: Patients with internal orbital fractures requiring open repair were identified. After the virtual 3D models were created by iPlan 3.0 Cranial CMF software (Brainlab), the models were printed using an office-based 3D printer to shape and modify orbital plates to correctly fit the fracture defect. The accuracy of the anatomic reduction and the restored bony orbital volume measurements were determined using postoperative computed tomography images and iPlan software., Results: Nine patients fulfilled the inclusion criteria: 8 patients had unilateral fractures and 1 patient had bilateral fractures. Average image processing and print time were 1.5 hours and 3 hours, respectively. The cost of the 3D printer was $2500 and the average material cost to print a single orbital model was $2. When compared with the uninjured side, the mean preoperative orbital volume increase and percent difference were 2.7 ± 1.3 mL and 10.9 ± 5.3%, respectively. Postoperative absolute volume and percent volume difference between the orbits were -0.2 ± 0.4 mL and -0.8 ± 1.7%, respectively., Conclusions: Office-based 3D printing can be routinely used in the repair of internal orbital fractures in an efficient and cost-effective manner to design the implant with satisfactory patient outcomes., Competing Interests: The authors report no conflicts of interest., (Copyright © 2024 by Mutaz B. Habal, MD.)

The development of a non-invasive method to analyze cytokine expression in the skin will provide further understanding of inflammatory skin disorders. This study aimed to evaluate cytokine expression in the skin through cerumen swabbing in dogs with otitis externa (OE) and to investigate whether increased cytokine expression in infected OE reflects the inflammatory status of the ear canal. Three groups consisting of control dogs ( n  = 24), dogs with ceruminous Malassezia OE ( n  = 25), and dogs with suppurative bacterial OE ( n  = 15) were included in the study. The concentrations of keratinocyte-derived cytokines including Interleukin (IL)-8/chemokine ligand (CXCL)8, IL-10, IL-6, Tumor necrosis factor (TNF)-α, and IL-1ß in the cerumen of the ear canal of the included patients were analyzed using commercial ELISA kits. Additionally, correlations between cytokine levels and cytology scores (of Malassezia yeasts, cocci/rod-shaped bacteria, and inflammatory cells) were assessed. IL-8/CXCL8 concentrations were significantly higher in dogs with ceruminous Malassezia OE and dogs with suppurative bacterial OE than in control dogs. Furthermore, IL-8/CXCL8 concentrations positively correlated with Malassezia scores in dogs with ceruminous OE ( r  = 0.630) and with bacterial scores in dogs with suppurative OE ( r  = 0.601). In addition, increased expression of IL-6 and IL-1ß were detected in dogs with suppurative bacterial OE compared to those with Malassezia OE and control dogs, and showed positive correlation with inflammatory cell scores IL-6 r  = 0.520, IL-1ß; r  = 0.680). Therefore, keratinocyte-derived cytokines could be evaluated using non-invasive methods such as cerumen swabbing in dogs with OE., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The handling editor DY declared a past co-authorship with the authors JP and J-SY., (Copyright © 2024 Yoon and Park.)

Purpose: Rehabilitative orbital decompression treats disfiguring exophthalmos in patients with Graves' orbitopathy (GO). This study aimed to identify risk factors associated with the postoperative recurrence of proptosis after orbital decompression., Design: Retrospective, case-control study., Methods: This retrospective review included patients with GO who underwent rehabilitative orbital decompression for disfiguring proptosis in an inactive state with a low clinical activity score (0-2) between January 2017 and December 2020 by a single surgeon. Exophthalmos was measured using a Hertel exophthalmometer, and recurrence was defined as an increase of 2 mm or more after decompression during the follow-up period. The association between preoperative variables and proptosis recurrence was analyzed using multivariable logistic regression., Results: Of the total 217 patients, 11 (5.1%) developed recurrence of proptosis during the follow-up period (range, 3-30; mean, 15.6 months). Univariate logistic regression analysis identified thyroid-stimulating hormone receptor antibody (TRAb) and thyroid-stimulating immunoglobulin (TSI) as significant factors for recurrence, with age, sex, smoking, disease duration, orbital radiotherapy, and total thyroidectomy history being nonsignificant. TRAb remained significant in a multivariate logistic regression analysis (odds ratio, 1.06; P = .014). Receiver operating characteristic curve analysis revealed an area under the curve of 0.86 with a sensitivity of 90.9% and specificity of 82.0% at a TRAb level of 7.96 IU/L., Conclusion: Preoperative TRAb and TSI are valuable markers to predict proptosis recurrence after orbital decompression. These results may help surgeons to decide the optimal timing for orbital decompression to lessen the risk of postoperative recurrence of proptosis., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Objective: To examine the risk of cardiovascular disease associated with long-term use of non-steroidal anti-inflammatory drugs (NSAIDs) in a large real-world ankylosing spondylitis (AS) cohort., Methods: This nationwide population-based cohort study used data from the Korean National Health Insurance Database. Patients aged ≥18 years old who were newly diagnosed with AS without prior cardiovascular disease between January 2010 and December 2018 were included in this study. Controls without AS were randomly selected by age, sex, and index year. The primary outcome was cardiovascular disease, a composite outcome of ischemic heart disease, stroke, or congestive heart failure. Long-term use of NSAIDs was defined as use of NSAIDs for >365 cumulative defined daily doses. The association between long-term use of NSAIDs and incident cardiovascular disease was examined in both AS and non-AS populations., Results: Among 19 775 patients with AS and 59 325 matched controls without AS, there were 1,663 and 4,308 incident cases of cardiovascular disease, showing an incidence of 16.9 and 13.8 per 1,000 person-years, respectively. Long-term use of NSAIDs was associated with increased risk of cardiovascular disease in non-AS controls (adjusted hazard ratio [aHR], 1.64; 95% CI, 1.48-1.82). In contrast, long-term use of NSAIDs did not increase the risk of cardiovascular disease in AS patients (aHR, 1.06; 95% CI, 0.94-1.20; adjusted for age, sex, socioeconomic status, body mass index, smoking status, hypertension, diabetes, hyperlipidemia, and tumor necrosis factor inhibitor use)., Conclusion: Prolonged NSAID treatment in AS patients may not be as harmful as in the general population regarding cardiovascular risk., (© The Author(s) 2024. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For permissions, please email: journals.permissions@oup.com.)

Background: Diabetes is associated with an increased risk of Parkinson's disease dementia (PDD); however, it is unknown whether this association is dependent on continuous hyperglycemia, hypoglycemic events, or glycemic variability. We aimed to investigate the relationship between visit-to-visit fasting glucose variability and PDD development in patients with Parkinson's disease (PD)., Methods: Using data from the Korean National Health Insurance Service, we examined 9,264 patients aged ≥40 years with de novo Parkinson's disease (PD) who underwent ≥3 health examinations and were followed up until December 2019. Glucose variability was measured using the coefficient of variation, variability independent of the mean, and average real variability. Fine and Gray competing regression analysis was performed to determine the effect of glucose variability on incident PDD., Results: During the 9.5-year follow-up period, 1,757 of 9,264 (19.0%) patients developed PDD. Patients with a higher visit-to-visit glucose variability had a higher risk of future PDD. In the multivariable adjusted model, patients with PD in the highest quartile (subdistribution hazard ratio [SHR] = 1.50, 95% CI 1.19 to 1.88), quartile 3 (SHR = 1.29, 95% CI 1.02 to 1.62), and quartile 2 (SHR = 1.30, 95% CI 1.04 to 1.63) were independently associated with a higher risk of PDD than those in the lowest quartile., Conclusion: We highlighted the effect of long-term glucose variability on the development of PDD in patients with PD. Furthermore, our findings suggest that preventive measures for constant glucose control may be necessary to prevent PDD., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Kang, Choi, Chung, Moon, Kim, Kim, Oh, Yoon, Seo, Cho and Koh.)

Backgruound: Phospholipase C-γ (PLC-γ) plays a crucial role in immune responses and is related to the pathogenesis of various inflammatory disorders. In this study, we investigated the role of PLC-γ and the therapeutic effect of the PLC-specific inhibitor U73122 using orbital fibroblasts from patients with Graves' orbitopathy (GO)., Methods: The expression of phospholipase C gamma 1 (PLCG1) and phospholipase C gamma 2 (PLCG2) was evaluated using polymerase chain reaction in GO and normal orbital tissues/fibroblasts. The primary cultures of orbital fibroblasts were treated with non-toxic concentrations of U73122 with or without interleukin (IL)-1β to determine its therapeutic efficacy. The proinflammatory cytokine levels and activation of downstream signaling molecules were determined using Western blotting., Results: PLCG1 and PLCG2 mRNA expression was significantly higher in GO orbital tissues than in controls (P<0.05). PLCG1 and PLCG2 mRNA expression was significantly increased (P<0.05) in IL-1β, tumor necrosis factor-α, and a cluster of differentiation 40 ligand-stimulated GO fibroblasts. U73122 significantly inhibited the IL-1β-induced expression of proinflammatory molecules, including IL-6, IL-8, monocyte chemoattractant protein-1, cyclooxygenase-2, and intercellular adhesion molecule-1 (ICAM-1), and phosphorylated protein kinase B (p-Akt) and p38 (p-p38) kinase in GO fibroblasts, whereas it inhibited IL-6, IL-8, and ICAM-1, and p-Akt and c-Jun N-terminal kinase (p-JNK) in normal fibroblasts (P<0.05)., Conclusion: PLC-γ-inhibiting U73122 suppressed the production of proinflammatory cytokines and the phosphorylation of Akt and p38 kinase in GO fibroblasts. This study indicates the implications of PLC-γ in GO pathogenesis and its potential as a therapeutic target for GO.

Purpose: Our study aimed to illustrate the positional relationship of the two branches of the saphenous nerve: the infrapatellar branch of the saphenous nerve (IPBSN) and medial crural cutaneous nerve (MCCN), as well as the anatomical landmarks using high-resolution ultrasound (HRUS) to help prevent iatrogenic nerve injury., Methods: We used HRUS to explore the positional relationships among the anatomical landmarks, IPBSN, and MCCN in 40 knees of 20 participants. The distances from these branches to key reference points were recorded. Using the ultrasound caliper mode, we measured the depth from the skin surface to the nerves at four distinct points., Results: The average distances between IPBSN and medial border of patella (MBP) and IPBSN and medial border of patellar ligament (MBPL) were 47 ± 7 mm and 42 ± 9 mm, respectively. MCCN showed mean distances of 94 ± 9 mm and 96 ± 9 mm to MBP and MBPL, respectively. The mean distance from the upper edge of pes anserine to IPBSN at the patellar apex (PA) level was 24 ± 10 mm and to MCCN was 34 ± 9 mm., Conclusion: We used high-resolution ultrasound to evaluate IPBSN and MCCN and their positions relative to anatomical landmarks. The study results offer valuable insights into the course of these nerves, which can help establish a safety zone to prevent accidental nerve injuries during knee surgeries and injections., (© 2023. The Author(s), under exclusive licence to Springer-Verlag France SAS, part of Springer Nature.)

Background: In Graves' orbitopathy (GO), localized orbital inflammation within the fixed orbit often leads to a fibrotic phenotype resulting in restrictive myopathy or refractory proptosis. However, the molecular pathways related to the transition from inflammation to fibrosis in GO are less understood. Yes-associated protein (YAP) and its homolog, transcriptional coactivator with PDZ-binding motif (TAZ; a Hippo pathway effector), are critical mechanosensors of mechanical stimuli and activate signaling cascades for cell proliferation, differentiation, and transformation. In this study, we aimed to examine the role of YAP in both inflammatory and fibrotic GO pathogenesis. Methods: Based on RNA sequencing performed on freshly obtained orbital adipose tissue from patients with GO and healthy individuals, Gene Ontology analysis and gene set-enrichment analysis were performed to analyze gene-expression differences between GO and normal orbital tissues. The role of YAP in GO-related inflammation and fibrosis was studied in primary cultured orbital fibroblasts. The effects of interleukin-1β (IL-1β)-induced inflammation and transforming growth factor-beta (TGF-β)-induced fibrosis on YAP expression were evaluated using real-time polymerase chain reaction and Western blotting analyses. The effects of YAP on inflammatory and fibrotic responses were also examined by YAP silencing or treatment with pharmacological YAP inhibitors. Results: RNA sequencing revealed enhanced YAP expression in GO orbital tissues. Gene Ontology analysis indicated that "response to mechanical stimulus"-related genes were overexpressed in GO orbital tissues, along with those enriched for the "adipose proliferation," "inflammatory responses," and "hormone stimulus responses" terms. IL-1β did not enhance YAP expression, and YAP silencing decreased IL-1β-induced IL-6 expression while increasing prostaglandin-endoperoxide synthase 2 expression, leading to paradoxical pro-inflammatory effects. Conversely, TGF-β enhanced YAP expression, and YAP silencing and pharmacological YAP inhibitor (cerivastatin, verteporfin, TED-347, and CA3) treatment significantly reduced TGF-β-induced myofibroblast differentiation and collagen formation. Conclusion: YAP, a mechanotransducer responding to mechanical stimuli, was strongly expressed in GO orbital tissues, and YAP was induced by TGF-β in orbital fibroblasts. Our study establishes YAP as a novel mediator of GO pathobiology, potentially mediating the transition from early inflammation to chronic fibrosis in GO. The finding that YAP inhibition suppressed TGF-β-induced fibrotic response suggests YAP as a therapeutic target against the fibrotic mechanism of GO.

This study aimed to evaluate factors that predict lymph node metastasis (LNM) in papillary thyroid cancer (PTC). This retrospective cross-sectional study compared the demographic, clinical, and ultrasonographic findings of patients with PTC with and without LNM. Subgroup analysis was conducted for micro-PTCs (<1 cm). Among total (n = 512; mean age, 47.3 ± 12.7 years) and micro-PTC patients (n = 312), 35.7% and 19.6% had LNM, respectively. Younger age, male sex, tumor size, bilaterality, and suspicious ultrasound features of the tumor were associated with LNM. In multiple logistic regression analysis, among all patients, age, tumor size, and extrathyroidal extension were independent risk factors for LNM (all p<0.05). In the micro-PTC subgroup, age, extrathyroidal extension, bilaterality of tumor, and presence of autoimmune thyroid disease were independent risk and protective factors for LNM (all p<0.05). In the receiver operating characteristic analysis, the accuracy of the multivariable logistic regression model for predicting LNM among all patients and micro-PTC was acceptable (area under the curve = 0.729 and 0.733, respectively). Age, sex, tumor size, and extrathyroidal extension can assist in predicting LNM in PTC patients. Additionally, the bilaterality of tumors and presence of autoimmune thyroid disease can assist in predicting LNM in micro-PTCs., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2023 Song et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Background and Objectives: As of January 1, 2021, all US hospitals are required by the Hospital Price Transparency Final Rule (HPTFR) to publish standard charges for all items and services, yet the state of price transparency for cervical spinal fusion is unknown. Here, we assess the nationwide price transparency landscape for cervical spinal fusion among high-performing spine centers in the United States., Methods: In this cross-sectional economic evaluation, we queried publicly available price transparency websites of 332 "high-performing" spine centers, as defined by the US News and World Report. We extracted variables including gross charges for cervical spinal fusion, payor options, price reporting methodology, and prices relevant to consumers including listed cash prices and minimum and maximum negotiated charges., Results: While nearly all 332 high-performing spine surgery centers (99.4%) had an online cost estimation tool, the HPTFR compliance rate was only 8.4%. Gross charges for cervical spinal fusion were accessible for 68.1% of hospitals, discounted cash prices for 46.4% of hospitals, and minimum and maximum charges for 10.8% of hospitals. There were large IQRs for gross charges ($48 491.98-$99 293.37), discounted cash prices ($26 952.25-$66 806.63), minimum charges ($10 766.11-$21 248.36), and maximum charges ($39 280.49-$89 035.35). There was geographic variability in the gross charges of cervical spinal fusion among high-performing spine centers within and between states. There was a significant association between "excellent" discharge to home status and lower mean gross charges., Conclusion: Although online cost reporting has drastically increased since implementation of the HPTFR, data reported for cervical spinal fusion remain inadequate and difficult to interpret by both providers and patients., (Copyright © Congress of Neurological Surgeons 2023. All rights reserved.)

Background: The Kellgren-Lawrence (KL) grading system is the most widely used method to classify the severity of osteoarthritis (OA) of the knee. However, due to ambiguity of terminology, the KL system showed inferior inter- and intra-observer reliability. For a more reliable evaluation, we recently developed novel deep learning (DL) software known as MediAI-OA to extract each radiographic feature of knee OA and to grade OA severity based on the KL system., Methods: This research used data from the Osteoarthritis Initiative for training and validation of MediAI-OA. 44,193 radiographs and 810 radiographs were set as the training data and used as validation data, respectively. This AI model was developed to automatically quantify the degree of joint space narrowing (JSN) of medial and lateral tibiofemoral joint, to automatically detect osteophytes in four regions (medial distal femur, lateral distal femur, medial proximal tibia and lateral proximal tibia) of the knee joint, to classify the KL grade, and present the results of these three OA features together. The model was tested by using 400 test datasets, and the results were compared to the ground truth. The accuracy of the JSN quantification and osteophyte detection was evaluated. The KL grade classification performance was evaluated by precision, recall, F1 score, accuracy, and Cohen's kappa coefficient. In addition, we defined KL grade 2 or higher as clinically significant OA, and accuracy of OA diagnosis were obtained., Results: The mean squared error of JSN rate quantification was 0.067 and average osteophyte detection accuracy of the MediAI-OA was 0.84. The accuracy of KL grading was 0.83, and the kappa coefficient between the AI model and ground truth was 0.768, which demonstrated substantial consistency. The OA diagnosis accuracy of this software was 0.92., Conclusions: The novel DL software known as MediAI-OA demonstrated satisfactory performance comparable to that of experienced orthopedic surgeons and radiologists for analyzing features of knee OA, KL grading and OA diagnosis. Therefore, reliable KL grading can be performed and the burden of the radiologist can be reduced by using MediAI-OA., (© 2023. The Author(s).)

Background: Graves' disease (GD), one of the most common forms of autoimmune thyroid disorders, is characterized by hyperthyroidism caused by antibodies (Abs) against the extracellular A-subunit of the thyrotropin receptor (TSHR). Various approaches have been used to create mouse models of GD, including transfected fibroblasts and immunization with plasmids or adenoviruses expressing human TSHR A-subunit (hTSHR A-subunit). These models, however, require repeated immunization and produce inconsistent results. In this study, we established a novel Cre-loxP system-based mouse model that is able to generate the hTSHR A-subunit, mimicking human GD, and characterized the histological changes in Graves' orbitopathy (GO) progression after a single injection. Materials and Methods: A Cre-loxP system-based mouse model was constructed by inserting the CAG-loxP-STOP-loxP-hTSHR A-subunit cassette into the Rosa26 locus of the mouse genome. Conditional expression of the hTSHR A-subunit was successfully achieved by intramuscular injection of the transactivator of transcription-Cre recombinase (GD mice). Blood tests for anti-TSHR Abs and the total thyroxine (T4) level were performed. Magnetic resonance imaging (MRI) was used to monitor morphological changes in the eyes. A histological examination of the thyroid gland and retrobulbar tissues was performed to observe pathological changes. Results: Twenty-four (8 control and 16 GD) mice were investigated. All GD mice exhibited higher levels of TSHR Abs compared with the control group. Moreover, more than 80% of the mouse models showed elevated T4 levels accompanied by thyroid goiter. MRI analysis revealed an increased volume of retrobulbar tissue, while immunohistochemical staining of orbital tissues exhibited macrophage infiltration and muscle fibrosis in the GD mice, contrasting with the control group. Conclusions: Our novel mouse model for GD, which showed the histological features of GO, was successfully established using the Cre-loxP system. This animal model offers improved insights and contributes to advancing methodological developments for GD and GO.

Purpose: The morphometry of the hepatic portal vein is of clinical importance, particularly in pre-operative assessments, surgical management, and diagnoses of liver conditions. This systematic review and meta-analysis aimed to characterize the morphometry of the normal portal vein in both pediatric and adult patients., Methods: The study, conducted using the PRISMA guidelines and registered with PROSPERO, utilized the MEDLINE, EMBASE, SCOPUS and Web of Science databases up to May 2020, and updated to May 2023. All studies reporting extractable data on diameter, length, and cross-sectional area (CSA) of the main, left, and right portal veins (PV, LPV, RPV, respectively) were included. The AQUA Tool was used to assess the quality of the included studies. Data analysis included subgroup analyses based on geographical location, sex, age, and imaging modality., Results: A total of 122 studies with 11,637 subjects were eligible for inclusion. Overall, the pooled mean diameter of the PV (PVD) was 10.09 mm (95% CI: 9.56-10.62). Significant differences in diameter were found between pediatric (6.60 mm; 95% CI: 5.38-7.82) and adult (10.72 mm; 95% CI: 10.25-11.19) subjects. Additionally, there was a significantly larger PVD measurement from computed tomography (CT) than other imaging modalities: CT, 13.28 mm (95% CI: 11.71-14.84); magnetic resonance imaging (MRI), 10.50 mm (95% CI: 9.35-11.66) and ultrasound (US), 9.81 mm (95% CI: 9.47-10.16). The mean diameters of the LPV and RPV were 8.27 mm (95% CI: 6.78-9.77) and 8.33 mm (95% CI: 6.70-9.95), respectively. Mean PV length in adults is 48.63 mm (95% CI: 35.63-61.64). Mean CSA of the PV was 1.09 cm 2 ., Conclusions: The study obtained aim to improve the understanding of portal vein anatomy, especially with relevance to surgical interventions of the liver in both pediatric and adult patients. Measurements from ultrasound imaging closely approximates the generated pooled PVD mean for pediatric and adult patients. CT imaging, however, significantly exceeded the established 13 mm threshold for adults. For pediatric patients, a threshold of 8 mm is proposed as a diagnostic upper limit for a normal PVD. Although not significant, the PVD decreased from the portal confluence towards its bifurcation., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023. Published by Elsevier B.V.)

Pathological markers that can monitor the progression of gastric cancer (GC) may facilitate the diagnosis and treatment of patients with diffuse GC (DGC). To identify microRNAs (miRNAs) that can differentiate between early and advanced DGC in the gastric mucosa, miRNA expression profiling was performed using the NanoString nCounter method in human DGC tumors. Ectopic expression of miR-199a and miR-199b (miR-199a/b) in SNU601 human GC cells accelerated the growth rate, viability, and motility of cancer cells and increased the tumor volume and weight in a mouse xenograft model. To study their clinicopathological roles in patients with GC, miR-199a/b levels were measured in human GC tumor samples using in situ hybridization. High miR-199a/b expression level was associated with enhanced lymphovascular invasion, advanced T stage, and lymph-node metastasis. Using the 3'-untranslated region (UTR) luciferase assay, Frizzled-6 (FZD6) was confirmed to be a direct target of miR-199a/b in GC cells. siRNA-mediated depletion of FZD6 enhanced the motility of SNU601 cells, and addback of FZD6 restored cancer cell motility stimulated by miR-199a/b. In conclusion, miR-199a/b promotes DGC progression by targeting FZD6, implying that miR-199a/b can be used as prognostic and diagnostic biomarkers for the disease., (© 2023. Springer Nature Limited.)

Nudivirus-infected Korean rhinoceros beetles (Trypoxylus dichotomus) were first identified in 2015, and while a complete genome sequence of the virus has long been uploaded to the NCBI database, it has not been examined in detail. Here, we describe the genomic characteristics of Trypoxylus dichotomus nudivirus (TdNV), which represents a new Oryctes rhinoceros nudivirus (OrNV) strain, isolated from infected T. dichotomus in the Republic of Korea. We examined factors derived by the cross-species infection of OrNV from nucleotide levels to the whole genome level. Our genomic analysis study suggests that TdNV-Korea is highly conserved with other OrNVs in terms of genomic structures and genome size. Our investigation of the genomic structure revealed that TdNV-Korea has the least number of open reading frames (ORFs) of all available OrNV genomes; three hypothetical genes were notably absent only in TdNV-Korea. In addition, the genomic alteration of the nudivirus core genes discloses that various amino acid mutations caused by single-nucleotide polymorphism and short indels (insertion/deletion) were found in most of the nudivirus core genes of TdNV-Korea. Our findings provide a valuable resource for those seeking a greater understanding of cross-species nudivirus transmission and will certainly provide valuable insight for reconstruction and reinterpretation of future and previously identified OrNV strains., Competing Interests: Declaration of Competing Interest The authors declare that they have no competing financial interests, (Copyright © 2023 The Authors. Published by Elsevier B.V. All rights reserved.)

Background: To the best of our knowledge, there have been no investigations of longitudinal asthma trajectories based on asthma exacerbation frequency and medications required for asthma control in children., Objective: To investigate longitudinal asthma trajectories based on the exacerbation frequency throughout childhood and asthma medication ranks., Methods: A total of 531 children aged 7 to 10 years were enrolled from the Korean childhood Asthma Study. Required asthma medications for control of asthma from 6 to 12 years of age and asthma exacerbation frequency from birth to 12 years of age were obtained from the Korean National Health Insurance System database. Longitudinal asthma trajectories were identified on the basis of asthma exacerbation frequency and asthma medication ranks., Results: Four asthma clusters were identified: lesser exacerbation with low-step treatment (8.1%), lesser exacerbations with middle-step treatment (30.7%), highly frequent exacerbations in early childhood with small-airway dysfunction (5.7%), and frequent exacerbations with high-step treatment (55.6%). The frequent exacerbations with high-step treatment cluster were characterized by a high prevalence of male sex, increased blood eosinophil (counts) with fractional exhaled nitric oxide, and high prevalence of comorbidities. The highly frequent exacerbation in early childhood with small-airway dysfunction cluster was characterized by recurrent wheeze in preschool age, with high prevalence of acute bronchiolitis in infancy and a greater number of family members with small-airway dysfunction at school age., Conclusion: The present study identified 4 longitudinal asthma trajectories on the basis of the frequency of asthma exacerbation and asthma medication ranks. These results would help clarify the heterogeneities and pathophysiologies of childhood asthma., (Copyright © 2023 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.)