Search

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea.

Osteoarthritis (OA) is a degenerative chronic disease that affects various tissues surrounding the joints, such as the subchondral bone and articular cartilage. The onset of OA is associated with uncontrolled catabolic and anabolic remodeling processes of the joints, including the cartilage and subchondral bone, to adapt to local biological and biochemical signals. In this study, we determined whether 70% ethanolic (EtOH) extract of Litsea japonica fruit (LJFE) had beneficial effects on the articular cartilage, including structural changes in the tibial subchondral bone, matrix degradation, and inflammatory responses, in OA by using a rat model of monosodium iodoacetate-induced OA. Our results showed that administration of LJFE increased the bone volume and cross-section thickness, but the mean number of objects per slice in this group was lower than that in the OA control (OAC) group. In addition, the LJFE decreased the expression of inflammatory cytokines. Compared to the OAC group, the group treated with high doses of LJFE (100 and 200 mg/kg) showed a more than 80% inhibition of the expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases. Our results suggest that LJFE can be used as a potential anti-osteoarthritic agent.

We measured critical current densities (Jcb) at a [001]-tilt grain boundary (GB) of a bicrystalline Sm1Ba2Cu3O7 film under various magnetic fields (Halpha) applied obliquely. The mis-orientation angle, thetas, of the [001] tilt GB was 30deg. Halpha was varied between -0.65 KOe and +0.65 KOe. The angle, phi, between the applied fields and the film surface was varied from 0deg to 90deg. The curves of Jcb vs. Halpha at the different phi s were qualitatively explained by a simple formula suggested in [8]. The formula was expressed by multiplication of the two factors which include the effects of Hperp and Hpar. One fitting parameter, alpha, in this formula was large for the sample of thetas = 30deg in our previous paper. On the contrast, alpha for the present sample in this paper is almost zero. The absolute values of Jcb for this sample are larger than those for the previous sample by one order of magnitude. These results indicate that the parameter, alpha, closely related to the quality of GB: alpha gets smaller as the film quality at GB become better.

We obtained the complete mitochondrial genome of the Ussuri white-toothed shrew Crocidura lasiura (Insectivora, Soricidae) at 17 362 base pairs (bp) containing 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a non-coding control region. Its gene order is identical to that of other vertebrates. Several repeat elements were identified in the non-coding control region (D-loop). Phylogenetic tree using mt protein-coding gene sequences showed that C. lasiura was closely related to C. attenuata. The reports of mt genome sequences of Crocidura were not enough to study phylogenetic relationships in genome levels. However, this report may help us to understand the phylogenetic relationships and evolutionary history of Crocidura.

The volume of datasets to be handled by scientific applications is increasing abruptly. Data-intensive sciences challenged by the big data problems need more elastic and scalable computing infrastructure than traditional infrastructure adhesive to compute-intensive computing applications. Cloud computing is rising alternative to existing compute-intensive high performance computing infrastructures. In this work we present an astronomical time series data analysis on cloud computing as a typical data-intensive scientific application. We implemented a private IaaS cloud which is virtual resource provision service to data analysis applications. We utilize OpenNebula as a virtual machine man- ager and implemented virtual cluster service which gives virtual private cluster instances based on user demand. Detecting variable bright stars from SuperWASP time series data is successfully done in our virtual clusters, which shows the viability of cloud computing for data-intensive sciences.

Cloud computing is a model for the delivery of IT resources as a service than a product. One of the essential characteristics in the cloud computing is on-demand computing. It can be explained that users can reserve and utilize IT capabilities, such as computing or network resources, at a certain time they want. As a part of HERO project, we developed HERO web portal which has on-demand capabilities of co-allocating computing and network resources. It is on top of TIGRIS middleware platform, which is developed based on Globus Toolkit 4 WSRF-compatible Grid services. With HERO web portal, Users can utilize HPC clusters and high-performance network between them in an on-demand manner.

We cloned and sequenced the complete mitochondrial DNA (mtDNA) of three tilefishes (Branchiostegus albus, Branchiostegus argentatus, and Branchiostegus japonicus) to characterize and compare their mitochondrial genomes (mitogenomes). The mitogenomes of B. albus, B. argentatus, and B. japonicus were 16,532, 16,550, and 16,541 bp long, respectively, and all consisted of 37 genes (13 protein-coding genes, 2 ribosomal RNA, and 22 transfer RNA (tRNAs)), which are typical for vertebrate mtDNA. As in other bony fishes, most genes were encoded on the H-strand, except for the nad6 and eight tRNA genes that were encoded on the L-strand. Among the 13 protein-coding genes of all three tilefishes, 2 reading-frame overlaps were found on the same strand: atp8 and atp6 overlapped by 10 nucleotides, and nad4L and nad4 overlapped by 7 nucleotides. The identity of the nad4 gene between B. albus and B. argentatus was the lowest at 87%. Conversely, the identity of the nad6 gene between B. albus and B. japonicus was the highest at 99%. Most tRNA genes were similar in length among the three species, while the tRNA-Ser((AGY)) of B. japonicus was 9 bp longer than those of B. albus and B. argentatus. The control region of the mitogenome spanned 853, 862, and 856 bp in B. albus, B. argentatus, and B. japonicus, respectively. A maximum likelihood tree constructed using 11,035 sites contained five independent groups with bootstrap values of 100% in support of their divergence. All three tilefishes examined were clustered with the Pomacanthidae species in Group II.

PURPOSE The aim of this study was to evaluate the clinical significance of perineal descent (PD) in pelvic outlet obstruction patients diagnosed by using defecography. METHODS One hundred thirty-six patients with pelvic outlet obstruction (POO; median age 49 years) had more than one biofeedback session after defecography. Demographic finding, clinical bowel symptoms and anorectal physiological studies were compared for PD at rest and PD with dynamic changes. RESULTS Age (r = 0.33; P < 0.001), rectocele diameter (r = 0.31; P < 0.01), symptoms of incontinence (P < 0.05) and number of vaginal deliveries (r = 0.46; P < 0.001) were correlated with increased fixed PD. However, the female gender (P < 0.005), rectal intussusceptions (P < 0.05), negative non-relaxing puborectalis syndrome (P < 0.00005) and rectocele (P < 0.0005) were correlated with increased dynamic PD. Duration of symptoms, number of bowel movements, history of pelvic surgery and difficult defecation were not related with PD. There was no significant correlation between fixed and dynamic PD and success of biofeedback therapy. CONCLUSION Age, vaginal delivery and diameter of the rectocele are associated with increased fixed PD. Female gender, rectal intussusceptions and a rectocele are correlated with increased dynamic PD. Biofeedback is an effective option for POO regardless of severity of PD.

We determined the complete mitochondrial genomes of Pseudolabrus sieboldi and P. eoethinus, and analyzed the genome organization, codon usage, and transition/transversion mutation ratio of the mitochondrial genome. The mitochondrial genomes of P. sieboldi and P. eoethinus are 16,507 and 16,508 bp in length, respectively, and consisted of 37 genes (13 protein-coding genes, two ribosomal RNAs, and 22 transfer RNAs), which is typical for vertebrate mitochondrial DNA. All protein-coding genes of two species used the initiation codon ATG except the cytochrome c oxidase subunit (CO) 1, which began with GTG as an initiation codon. However, the termination codon for the NADH dehydrogenase subunit (ND) 6 gene encoded with TAA in P. sieboldi, and TAG in P. eoethinus. The 12S and 16S rRNA genes were 949 and 1694 bp, respectively, in P. sieboldi, and were 948 and 1693 bp in P. eoethinus. The A + T content of the two rRNA genes were 52.9% in P. sieboldi and 52.5% in P. eoethinus, which is slightly lower than that of other labrid species. The identity of the 13 protein-coding genes ranged between 67% (ND6) and 94% (CO2 and ATP8). The G + C contents of all of the protein-coding genes of P. sieboldi were slightly higher than those of P. eoethinus. Our data contribute to the identification, and further our understanding, of the comparative genetics of Pseudolabrus species distributed in East Asia.

We determined the complete nucleotide sequence of the mitochondrial genome for the rabbitfish Siganus fuscescens (Perciformes, Siganidae). This mitochondrial genome, consisting of 16,491 base pairs (bp), included 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region similar those found in other vertebrates; the gene order was identical to that of typical vertebrates. Most of the genes of S. fuscescens were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser [UCN], Glu, and Pro) genes were encoded on the L-strand. The reading frames of ATPase 8 and 6 and those of ND4L and ND4 overlapped by ten and seven nucleotides, respectively. All mitochondrial protein-coding genes began with an ATG start codon, except for CO1, which started with GTG. Open reading frames of S. fuscescens ended with TAA (ND1, CO1, ATPase 8, ND4L, ND5 and ND6), and the remainder had incomplete stop codons, either TA (ATPase 6 and CO3) or T (ND2, CO2, ND3, ND4, and Cytb). The origin of L-strand replication in S. fuscescens was located in a cluster of five tRNA genes (WANCY) and was 34 nucleotides in length. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (828 bp) was considered to be the control region (D-loop). Within this sequence, we identified a conserved sequence block characteristic of this region. The rabbitfish was grouped with Siganus canaliculatus in most parsimony analyses, which showed 100% bootstrap support for their divergence. These findings are useful for inferring phylogenetic relationships and identification within the suborder Acanthuroidei.

We determined the complete nucleotide sequence of the mitochondrial genome for the rock bream, Oplegnathus fasciatus (Perciformes, Oplegnathidae). This mitochondrial genome, consisting of 16,511 base pairs (bp), encoded genes for 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a noncoding control region like those found in other vertebrates, with the gene order identical to that of typical vertebrates. Most of the genes of O. fasciatus were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase 8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The origin of L-strand replication in O. fasciatus was in a cluster of five tRNA genes (WANCY) and was 41 nucleotides in length. The conserved motif (5′-GCGGG-3′) was found at the base of the stem within the tRNA-Cys gene. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (835 bp) was considered to be the control region (D-loop). Within this sequence, we identified a termination-associated sequence and a conserved sequence block characteristic to this region. In most parsimony analyses, the O. fasciatus was positioned in the clade including Emmelichthyidae, Lutjanidae, Percidae, Centrarchidae, and Sparidae, with 100% bootstrap support for their divergence.

Ancient cattle bones were excavated from archaeological sites in Jeju, Korea. We used molecular genetic techniques to identify the species and establish its relationship to extant cattle breeds. Ancient DNA was extracted from four sources: a humerus (Gonae site, A.D. 700-800), two fragments of radius, and a tooth (Kwakji site, A.D. 0-900). The mitochondrial DNA (mtDNA) D-loop regions were cloned, sequenced, and compared with previously reported sequences of various cattle breeds (9 Asian, 8 European, and 3 African). The results revealed that these bones were of the breed, Bos taurus, and a phylogenetic tree indicated that the four cattle bones formed a monophyletic group with Jeju native black cattle. However, the patterns of sequence variation and reports from archaeological sites suggest that a few wild cattle, with a different maternal lineage, may have existed on Jeju Island. Our results will contribute to further studies of the origin of Jeju native cattle and the possible existence of local wild cattle.

The complete mitochondrial (mt) genome of the Chinese many-toothed snake, Sibynophis chinensis, was sequenced and found to be 17,163 bp in length. The arrangement of 13 protein-coding genes, tRNAs and rRNAs was identical to that of other common snake mt genomes. The mt protein-coding genes of S. chinensis utilized ATA, ATG, ATA and GTG as initiation codons and AGA, AGG, TAA, TAG and T as termination codons. Among three tRNA clusters (LQM, WANCY and HSL), LQM was found instead of IQM, which is common in other vertebrates. We also identified two control regions that contained several conserved elements known as conserved sequence blocks and termination-associated sequences related to mt replication and transcription.

The inheritance patterns of the chloroplast genomes of the Actinidia hybrids A. eriantha (male parent) x A. chinensis (female parent) and A. chinensis (male parent) x A. melanandra (female parent) were analyzed using single-strand conformation polymorphism (SSCP) analysis of the trnL-trnF and psbA-trnH intergenic spacers. This showed that the artificial hybrids between A. eriantha and A. chinensis all had the haplotype of their male parent. Alignment of the sequences of A. eriantha and A. chinensis revealed four substitutions and one insertion (GATTC) in trnL-trnF and two substitutions in psbA-trnH. In contrast, the haplotypes of the artificial hybrids between A. chinensis and A. melanandra had the same patterns as their female parent. Alignment of the entire region of A. chinensis and A. melanandra revealed 12 substitutions: 1 in trnL-trnF and 11 in psbA-trnH. However, no sequence variation in the trnL-trnF and psbA-trnH intergenic spacers was found. We have developed a simple screening method for detecting the inheritance patterns of Actinidia chloroplast DNA haplotypes using SSCP analysis of the trnL-trnF and psbA-trnH intergenic spacers. Our findings indicate that the inheritance of the chloroplast genome in Actinidia hybrids differs according to the species selected.

We determined the complete nucleotide sequence of the mitochondrial (mt) genome for the longtooth grouper, Epinephelus bruneus (Perciformes, Serranidae). This mt genome, consisting of 16,686 base pairs (bp), encoded genes for 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region as those found in other vertebrates, with the gene order identical to that of typical vertebrates. A major noncoding region between the trnP and trnF genes (991 bp) was considered to be the control region (D-loop). Within this sequence, 22 copies of a 17-bp tandem repeat element, 5'-TGATATTACATATATGC-3', were identified in the control region unlike previous reported Epinephelus species.

We recently encountered an interesting case of acute inferior ST segment elevation myocardial infarction (STEMI). This patient had a rare anatomic variation, single coronary artery. The right coronary artery originate from the left circumflex proper artery, not from aorta, was totally obstructed with thrombi. Though it took more time to figure out the patient’s coronary anatomy and the culprit lesion, we successfully performed primary percutaneous coronary intervention within the guideline-recommended time period. We performed left coronary angiography at the beginning. This strategy could be helpful in determining the culprit lesion and preventing unnecessary procedural delay in acute inferior STEMI.

We determined the nucleotide sequences of the hypervariable D-loop region of mitochondrial DNA (mtDNA) from horse bone (humerus, A.D. 700 to A.D. 800) that was excavated from the Kwakji archaeological site, Jeju, Korea. We compared them with ones from extant horses. We designed three pairs of oligonucleotide primers from the tRNA-Thr and tRNA-Phe gene regions of mtDNA that are highly conserved among many other animal species. We cloned 232, 336, and 644 bp from the horse bone in order to determine the mtDNA D-loop sequence. The sequence was 1,124 bp long; the middle contained 19 tandem repeats of an 8-bp sequence (TGTGCACC) that is specific to equines. The mtDNA D-loop region contained each base (total number, percentage of total) as follows: A (317, 28.20%), C (336, 29.89%), G (169, 15.04%), and T (302, 26.87%). This sequence, like those of other horse populations, was AT rich. Sequence divergence was the lowest (1.71%) between the ancient horse bone and that of the Thoroughbred horse 1. The neighbor-joining and strict consensus tree of three of the most parsimonious trees also suggested that the ancient bone was considerably unrelated to native Jeju horses. The molecular phylogenetic characteristics of the horse bone that was excavated from the Kwakji archaeological site (Jeju, Korea) showed that some horse breeds may have existed on Jeju Island, Korea before Mongolian horses were introduced. The horse bone that was excavated from the Kwakji archaeological site may aid future research on the origin and ancestry of native Jeju horses.

Purpose The aim of this study was to evaluate the clinical characteristics and treatment outcomes, including surgical safety, in patients over 80 years of age who underwent an appendectomy. Methods This study involved 160 elderly patients who underwent an appendectomy for acute appendicitis: 28 patients over 80 years old and 132 patients between 65 and 79 years old. Results The rate of positive rebound tenderness was significantly higher in the over 80 group (P = 0.002). Comparisons of comorbidity, diagnostic tool and delay in surgical treatment between the two groups were not statistically different. American Society of Anesthesiologists score was significantly higher in the over 80 group than in the 65 to 79 group (2.4 ± 0.5 vs. 1.6 ± 0.5; P < 0.00005). Comparisons of operative times and use of drainage between the two groups were not statistically different. In the pathologic findings, periappendiceal abscess was more frequent in the over 80 group (P = 0.011). No significant differences existed between the two groups when comparing the results of gas out and the time to liquid diet, but the postoperative hospital stay was significantly longer in the over 80 group (P = 0.001). Among the postoperative complications, pulmonary complication was significantly higher in the over 80 group (P = 0.005). However, operative mortality was zero in each group. Conclusion In case of suspicious appendicitis in elderly patients, efforts should be made to use aggressive diagnostic intervention, do appropriate surgery and prevent pulmonary complications especially in patients over 80 years of age.

Purpose The appendectomy is the most common emergent surgical procedure in elderly patients. The increasing number of elderly persons has been accompanied by an increase in the number of cases of acute appendicitis in the elderly. In order to understand the clinical significance of a laparoscopic appendectomy for elderly patients with appendicitis, we investigated the results of a laparoscopic appendectomy for treating patients over 60 years of age with appendicitis and compared them with the results for an open technique. Methods We studied retrospectively patients over 60 years of age who underwent an appendectomy with either a laparoscopic (LA) or open (OA) technique for appendicitis between July 2007 and December 2009. There were 30 patients in the LA group and 47 patients in the OA group. The demographic data, operative time, length of the hospital stay, bowel movement, pain control, cost, complications and pre-existing disease were assessed. Results There were no significant differences between the LA and the OA groups with respect to pre-existing diseases, gender, age, American Society of Anesthesiologists (ASA) score and the number of cases of complicated appendicitis, operative time, length of hospital stay, and times of analgesics use. However, the proportion of early gas out (within POD #2) was significantly greater in the LA group (80% vs. 57%, P < 0.05), and postoperative complications were significantly lower in the LA group (7% vs. 32%, P < 0.01). The costs for the two groups were not significantly different. Conclusion A laparoscopic appendectomy is a safe and effective procedure in elderly patients and is not associated with any increase in morbidity. It can be recommended for routine use in treating elderly patients with appendicitis.

Purpose: The aim of this study was to identify the prognostic factors associated with poor outcome of biofeedback therapy. Methods: One hundred thirty-seven (137) constipated patients with pelvic outlet obstruction (median age 49 years) had more than one biofeedback session after defecography. Follow-up data (mean follow-up: 14 months; range: 2∼37 months) were obtained in 114 patients. Any differences in demographics, clinical symptoms, and parameters of an anorectal physiological study were evaluated between the success group and the failure group. Results: At follow-up, 80 (70 percent) patients felt improvement in symptoms, but 34 (30 percent) patients did not. Pre-biofeedback presence of symptoms of difficult defecation predict poor outcome (88 vs. 69 percent for failure vs. success, P＜0.05). The positive and the negative predictive values of difficult defecation for poor outcome were 35 percent and 86 percent, respectively. A negative mean pressure change on pre-biofeedback anal manometry was related to a poor outcome (65 vs. 26 percent for failure vs. success, P＜0.001). The positive and the negative predictive values of negative mean pressure change for poor outcome were 51 percent and 83 percent, respectively. A negative electrical current change on pre-biofeedback anal electromyography was related to a poor outcome (23 vs. 9 percent for failure vs. success, P＜0.05). The positive and the negative predictive values of negative electrical-current change for poor outcome were 53 percent and 74 percent, respectively. Conclusions: Difficult defecation, negative mean pressure change in pre-biofeedback anal manometry, and negative electrical current change in pre-biofeedback anal electromyography were predictors associated with poor outcome of biofeedback therapy for constipated patients with pelvic outlet obstruction.

Purpose: Biofeedback therapy is widely used for the management of constipation associated with pelvic outlet obstruction. Some patients have shown poor outcome after biofeedback alone. A subgroup of patients complains of absence of desire to defecate. The main pathophysiology of constipation may be impaired rectal sensation or compliance. This study evaluated the effect of electrical stimulation and biofeedback therapy (EST-BF) for this subgroup of constipated patients with impaired rectal sensation. Methods: Of the 37 patients diagnosed with pelvic outlet obstruction by using cinedefecography, 9 patients (M：F=2：7, age=22～77 years, median=57 years) who had impaired rectal sensation (rectal desire threshold ≥100 ml) on anorectal manometry were selected. These patients were treated with EST-BF therapy 2～6 (median: 5) sessions, Kontinece, Multichannel system, HMT, Inc, Seoul, Korea). Treatment consisted of 20 minutes of variant-mode electrical stimulation and 20 minutes of EMG biofeedback therapy per week administered by a specialized colorectal surgeon. All patients were evaluated by using a standardized questionnaire and a threshold for rectal sensation based on balloon distention before and after treatment. Results: At post EST-BF, six (67%) patients had experienced an improvement in symptoms, including five (56%) patients with complete symptom relief. Significant improvement in rectal sensation, especially the rectal defecation desire threshold (pre-EST-BF vs. post- EST-BF: 181.0±38.7 vs. 88.3±29.1) was achieved. Conclusions: EST- BF may be an effective option for use in the treatment of functional constipation with impaired rectal sensation.

Purpose: To determine the outcome and identify predictors of success of biofeedback for descending perineum syndrome (DPS). Methods: 103 patients diagnosed with DPS by defecography were evaluated by standardized questionnaire, before, immediately after treatment, and at follow-up. Clinical bowel symptoms and anorectal physiological studies were also analyzed. Results: At post- biofeedback, 81 patients felt improvement in symptoms, including 29 with complete symptom relief. At follow-up (median: 13 months, n=82), 58 patients felt improvement in symptoms, including 12 with complete symptom relief. There was a significant reduction in difficult defecation (from 78 to 34, 37%, from pre-biofeedback to post-biofeedback, and at follow-up respectively; P＜0.001), incomplete defecation (from 88 to 44, 41%; P＜0.001), hard stool (from 63 to 25, 0%; P＜0.01), small caliber stool (from 63 to 0,0%; P＜0.001, P＜0.005), fecal incontinence (from 10 to 1,1%; P＜0,01), anal pain (from 21 to 2, 6%; P＜0.001, P＜0.05), laxative use (from 30 to 11, 6%; P＜0.001), enema use (from 16 to 0, 1%; P＜0.001) and digitation (from 11 to 1%, from pre-biofeedback to at follow-up; P＜0.05). Normal spontaneous bowel movement was increased from 47% pre-biofeedback to 79% post-biofeedback (P＜0.001), 86% at follow-up (P＜0.001). Difficult defecation predict poor outcome (96 vs. 66%; failure vs. success, P＜0.01). Positive mean pressure change predict good outcome (69 vs. 35%; success vs. failure, P＜0.05). Conclusions: Biofeedback is an effective option for DPS. J Korean Soc Coloproctol