Search

A novel intermetallic compound CeCu1 − xBi2 (x = 0.3) [bismuth-cerium-copper (2/1/0.7)], has been synthesized by the bismuth self-flux method and its structure has been analyzed by single-crystal X-ray diffraction. The compound is found to have the ZrCuSi2 structure type. This can be described as a layered structure in which two-dimension Bi layers consisting of closely arranged Bi atoms in a square-lattice array and CeBiCu slabs formed by edge-sharing CeBiCu4 distorted octahedra stack alternately along the [001] direction via Ce-Bi and Bi-Bi bonds, forming a three-dimensional network.

The pseudogap state is one of the peculiarities of the cuprate high temperature superconductors. Here we investigate its presence in BaCo$_{x}$Fe$_{2-x}$As$_{2}$, a member of the pnictide family, with temperature dependent scanning tunneling spectroscopy. We observe that for under, optimally and overdoped systems the gap in the tunneling spectra always closes at the bulk T$_{c}$, ruling out the presence of a pseudogap state. For the underdoped case we observe superconducting gaps over large fields of view, setting a lower limit of tens of nanometers on the length scale of possible phase separated regions., Comment: 5 pages, 3 figures

We report for the first time simultaneous microscopic measurements of the lattice constants, the distribution of the lattice constants, and the antiferromagnetic moment in high-purity URu(2)Si(2), combining Larmor and conventional neutron diffraction at low temperatures and pressures up to 18 kbar. Our data demonstrate quantitatively that the small moment in the hidden order (HO) of URu(2)Si(2) is purely parasitic. The excellent experimental conditions we achieve allow us to resolve that the transition line between HO and large-moment antiferromagnetism (LMAF), which stabilizes under pressure, is intrinsically first order and ends in a bicritical point. Therefore, the HO and LMAF must have different symmetry, which supports exotic scenarios of the HO such as orbital currents, helicity order, or multipolar order.

The weak itinerant ferromagnet UIr is studied by magnetization and magnetostriction measurements. Critical behavior, which surprisingly extends up to several Tesla, is observed at the Curie temperature $T_C\simeq45$ K and is analyzed using Arrott and Maxwell relations. Critical exponents are found that do not match with any of the well-known universality classes. The low-temperature magnetization $M_s\simeq0.5$ $\mu_B \cong const.$ below 3 T rises towards higher fields and converges asymptotically around 50 T with the magnetization at $T_C$. From the magnetostriction and magnetization data, we extract the uniaxial pressure dependences of $T_C$, using a new method presented here, and of $M_s$. These results should serve as a basis for understanding spin fluctuations in anisotropic itinerant ferromagnets., Comment: 4 pages, 3 figures

The functioning of a carbon dioxide laser is generalized from the standard low nitrogen concentration, low temperature coolant to the high nitrogen concentration, room temperature air free convection cooling regime. The efficiencies of the two regimes are comparable. Theoretical arguments are presented to support this new regime.

After years of research into colossal magnetoresistant (CMR) manganites using bulk techniques, there has been a recent upsurge in experiments directly probing the electronic states at or near the surface of the bilayer CMR materials ${\mathrm{La}}_{2\ensuremath{-}2x}{\mathrm{Sr}}_{1+2x}{\mathrm{Mn}}_{2}{\mathrm{O}}_{7}$ using angle-resolved photoemission or scanning probe microscopy. Here, we report temperature-dependent, angle-resolved photoemission data from single crystals with a doping level of $x=0.36$. The first important result is that there is no sign of a pseudogap in the charge channel of this material for temperatures below the Curie temperature ${T}_{C}$. The data show unprecedented sharp spectral features, enabling the unambiguous identification of clear, resolution-limited quasiparticle features from the bilayer split $3{d}_{{x}^{2}\ensuremath{-}{y}^{2}}$-derived Fermi surfaces both at the zone-face and zone diagonal ${k}_{F}$ locations. The data show that these low temperature Fermi surfaces describe closed shapes in ${k}_{\ensuremath{\parallel}}$, centered at the $(\ensuremath{\pi}∕a,\ensuremath{\pi}∕a)$ points in the two dimensional Brillouin zone, and are not open and arclike in nature. The second important result concerns the temperature dependence of the electronic states. The spectra display strong incoherent intensity at high binding energies and a very strong temperature dependence, both characteristics reminiscent of polaronic systems. However, the clear and strong quasiparticle peaks at low temperatures are difficult to place within a polaronic scenario. A careful analysis of the temperature-dependent changes in the Fermi surface spectra both at the zone face and zone diagonal regions in $k$ space indicates that the coherent quasiparticle weight disappears for temperatures significantly above ${T}_{C}$ and that the $k$ dependence of the $T$-induced changes in the spectra invalidates an interpretation of these data in terms of the superposition of a ``universal'' metallic spectrum and an insulating spectrum whose relative weight changes with temperature. In this sense, our data are not compatible with a phase separation scenario.

The near-far effect in a two-user OCDMA network carrying GbE traffic and employing all-optical thresholding is experimentally evaluated. A packet loss of

We have performed high field magnetisation measurements on the ferromagnetic order ( T C =46 K) in single-crystalline UIr. The magnetisation along the easy axis shows a field saturation towards a moment of about 1 μ B /U atom at T =4.2 K. No field-induced magnetic transition was observed for magnetic fields up to 52 T.

This paper presents a summary of a process used to develop a spatial data system to help manage transportation networks. Issues related to the system architecture, and identification and integration of software and hardware elements are addressed. Commercial off-the-shelf software and hardware, along with customized interfaces are use to develop the system. Hardware considered includes portable digital assistants, Table PC, and laptop. Key aspects that were considered in selecting the hardware include the ease with which they can be used in the field, their durability, effectiveness, and portability. Compatibility and ability to integrate with other application software were also critical considerations. The software is selected based on the ease with which they can be used and integrated with web authoring software, thus enhancing collection, processing, and dissemination of data. In addition, the compatibility of the software with various data formats (i.e., prior versions of databases), and the potential for such compatibility to continue into the future is also important. Software considered and tested includes Autodesk MapGuide, ESRI, ArcIMS, ESRI, ArcPad, and Terrasync software. Using selected hardware and software, a pilot project is used to demonstrate the use of the system to assimilate, manage, process, and communicate transportation infrastructure related data.

Extra-corporeal life support (ECLS) has been applied successfully to congenital respiratory defects but less optimally to acquired pulmonary failure. We extended this support to certain extreme complexities of patients with acute respiratory distress. From January 2003 to June 2005, 16 (nine men and seven women) patients refractory to ventilator support were treated with ECLS. Their median age was 32.4 years (1.5-70). The triggering events were pulmonary haemorrhage (n = 4), pneumonia (n = 7), aspiration (n = 2) and pancreatitis (n = 3). The indications for support were hypoxaemia in 13 and hypercapnia in three patients. Ten (63%) met the criteria of fast entry. Thirteen (81%) received veno-venous (V-V) mode support and the other three received veno-arterial mode support initially, but then converted to V-V mode after sufficient oxygenation stabilised haemodynamics. Initial pump flow was maximised to improve (mean 3250 +/- 1615 ml/min) to improve the oxygenation. Four patients with active pulmonary haemorrhage were heparin free in the first 12-24 h of support without complications. Excluding one prematurely terminated patient because of brain permanent damage, the duration of support was 162 +/- 95 h (67-363). Eleven (69%) weaned successfully from ECLS and 10 (63%) discharged and regained normal pulmonary performance in a median of 26.8 months follow-up. Pulmonary support using ECLS was feasible in selected patients with acute respiratory distress. Modification of guidelines for liberal use, early deployment before secondary organ damage and prevention of complications during support were the key to final success.

In 3D topological insulators achieving a genuine bulk-insulating state is an important research topic. Recently, the material system (Bi,Sb)$_{2}$(Te,Se)$_{3}$ (BSTS) has been proposed as a topological insulator with high resistivity and a low carrier concentration (Ren \textit{et al.} \cite{Ren2011}). Here we present a study to further refine the bulk-insulating properties of BSTS. We have synthesized Bi$_{2-x}$Sb${_x}$Te$_{3-y}$Se$_{y}$ single crystals with compositions around $x = 0.5$ and $y = 1.3$. Resistance and Hall effect measurements show high resistivity and record low bulk carrier density for the composition Bi$_{1.46}$Sb$_{0.54}$Te$_{1.7}$Se$_{1.3}$. The analysis of the resistance measured for crystals with different thicknesses within a parallel resistor model shows that the surface contribution to the electrical transport amounts to 97% when the sample thickness is reduced to $1 \mu$m. The magnetoconductance of exfoliated BSTS nanoflakes shows 2D weak antilocalization with $\alpha \simeq -1$ as expected for transport dominated by topological surface states., Comment: 16 pages, 6 figures, accepted for publication in New Journal of Physics

To recognize and understand a person's emotion has been known as one of the most important issue in human-computer interaction. In this paper, we present a multimodal system that supports emotion recognition from both visual and acoustic feature analysis. Our main achievement is that with this bimodal method, we can effectively extend the recognized emotion categories compared to when only visual or acoustic feature analysis works alone. We also show that by carefully cooperating bimodal features, the recognition precision of each emotion category will exceed the limit set up by the single modality, both visual and acoustic. Moreover, we believe our system is closer to real human perception and experience and hence will make emotion recognition closer to practical application in the future

Mycotic aneurysms are an important cause of morbidity and mortality in endocarditis despite advanced antibiotic therapy. Visceral artery aneurysms are uncommon and usually remain clinically silent until rupture. We now report a case of successful surgical treatment of a superior mesenteric mycotic aneurysm of the superior mesenteric artery, followed by a review of pertinent clinical information.

A novel intermetallic compound CeCu1 − xBi2 (x = 0.3) [bismuth-cerium-copper (2/1/0.7)], has been synthesized by the bismuth self-flux method and its structure has been analyzed by single-crystal X-ray diffraction. The compound is found to have the ZrCuSi2 structure type. This can be described as a layered structure in which two-dimension Bi layers consisting of closely arranged Bi atoms in a square-lattice array and CeBiCu slabs formed by edge-sharing CeBiCu4 distorted octahedra stack alternately along the [001] direction via Ce-Bi and Bi-Bi bonds, forming a three-dimensional network.

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

The AC loss of various silver-sheathed high Tc superconducting Bi-2223 tapes is measured by means of the transport method, as a function of frequency and current amplitude. The frequency dependence of the power loss (in W/m) is used to separate different loss components: the frequency independent part is attributed to the resistive loss, the linear part to the hysteresis loss (self-field loss in J/m per cycle), and the quadratic part, if it appears, may be assigned to other losses such as the eddy current loss. The separated loss components are evaluated with the existing models and the DC voltage-current characteristics of the sample. In general, the self-field loss is dominant when the transport current amplitude is smaller than the critical current of the tape. For larger currents the resistive loss is the most important component. At small transport current, the AC transport loss signal is very small and is sensitive to the phase correction and other disturbances from the surrounding metallic parts in the vicinity of the sample. The signal picked-up from these disturbances shows the quadratic frequency dependence.

A state-of-the-art account is given for shock waves in the Gruneisen solid and in the van der Waals (vdW) fluid. While the computational aspect of the solid is completely presented, only the analytical aspect of the fluid is expounded to include a new catalog of shock waves with dynamic phase transformations and fluid retrogradicity.

We present detailed temperature dependent optical data on BaFe$_{2-x}$Co$_{x}$As$_{2}$ (BCFA), with x = 0.14, between 4 meV and 6.5 eV. We analyze our spectra to determine the main optical parameters and show that in this material the interband conductivity already starts around 10 meV. We determine the superfluid density to be 2.2 10^{7}$ cm^{-2}, which places optimally doped BFCA close to the Uemura line. Our experimental data shows clear signs of a superconducting gap with 2$\Delta_{1}$ = 6.2 $\pm$ 0.8 meV. In addition we show that the optical spectra are consistent with the presence of an additional band of strongly scattered carriers with a larger gap, 2$\Delta_{2}$ = 14 $\pm$ 2 meV., Comment: 5 pages, 4 figures

The system is known to have at least two phases exhibiting high superconducting transition temperatures (TC) of 85 and 110 K. It is well established that Bi2Sr2CaCu2O8+δ has a TC of ~85 K. To date it is not known which phase in the system exhibits TC = 110 K. We performed high-resolution electron microscopy and analytical electron microscopy on material having a nominal composition BiSrCaCu2Ox, and containing a relatively high fraction of the phase with TC = 110 K. Two structures related to the structure of Bi2Sr2CaCu2O8+δ are found. These structures and their possible compositions are discussed.

The room temperature isothermal section of the Pr-Co-Ni ternary system ( Pr ⩽ 16.67 at .%) and vertical sections of Pr 2 Co 17− x Ni x and PrCo 5− y Ni y were determined by differential thermal analysis, X-ray diffraction, optical microscopy and electron probe microanalysis techniques. This room temperature section consists of three single-phase regions ((2:17), (1:5) and nickel(cobalt)-rich α solid solution), three two-phase regions ((2:17) + α , (1:5) + α , (1:5) + (2:17)) and one three-phase region ((2:17) + (1:5) + α ). The vertical section of Pr 2 Co 17− x Ni x exhibits one eutectic reaction: L → (1:5) + α , one peritectic-eutectic reaction: L + α → (2:17) + (1:5). The phase regions identified are L , L + α , L + (1:5) + α , L + α + (2:17), α + (2:17), α + (2:17) + (1:5) and α + (1:5). The vertical section of PrCo 5 − y Ni y consists of three phase regions: L , L + (2:17) and (1:5).

We have performed investigations on the Ca-Sr-Bi-Cu-O system with respect to high-Tc superconductivity and structural properties. It is shown that there are two high-Tc superconducting phases in the system, i.e. a 110 K and an 85 K phase. The 85 K phase has a body-centred tetragonal structure with a stoichiometry of CaSr2Bi2Cu2O8. The 110 K phase is closely related to the 85 K phase. It is formed only in a very narrow temperature range and easily deteriorates to the phase with the lower Tc by quenching. Although some samples show a large diamagnetic signal at 110 K in ac-susceptibility measurements, there is still evidence of the presence of the 85 K phase. X-ray diffraction studies, especially in the low-angle region, show a structural relation between these two superconducting phases. The procedures of the preparation and the characterization of the 85 K and 110 K polycrystalline superconducting phases as well as the single crystal growth of the 85 K superconducting phase are described.

The equations of state for the ideal classical gas are generalized with two characteristic constants known as the state indices. A simple and complete representation is developed for the super-ideal gas, with explicit results which are general enough to cover a wide range of equilibrium systems and states. Evidence and justification are provided in terms of examples and results of statistical physics. The new model should prove useful for treating problems involving physical behavior and properties which might otherwise call for specialized or advanced methods of statistical mechanics.

The magnetization of magnetically-aligned (Nd1−xPrx)2Fe14B samples with x = 0.0, 0.2, 0.4, 0.6, 0.8 and 1.0 at 4.2 K has been measured in fields up to 35 T. The first-order magnetization process (FOMP) which has been observed earlier to occur in the magnetization of Nd2Fe14B, measured with the field applied perpendicular to the c axis, becomes more pronounced with increasing praseodymium content, whereas the transition field appears to decrease. A phenomenological analysis is presented in which the misalignment of the grains in the samples has been taken into account. The anisotropy constants up to sixth order obtained in this analysis allow for the calculation of the free energy as a function of the angle between the magnetization vector and the applied fields from which the first-order magnetic transition can be understood.

This study was undertaken to investigate the hemodynamic changes induced by intraventricular injections of angiotensin II (A-II), 1 to 100 ng/kg/min, and renin in doses of 0.025 to 0.3 units (u) in conscious instrumented dogs. Angiotensin II produced a dose-related increase in mean arterial pressure; however, only the highest dose produced a significant increase of 23 +/- 6 mmHg. In contrast, renin did not significantly alter mean arterial pressure in the doses administered but 0.1 and 0.3 u induced a significant increase in systolic arterial blood pressure of 10 +/- 2 and 17 +/- 4 mmHg, respectively. Neither A-II nor renin affected heart rate, dP/dt or carotid, coronary or renal blood flows. These data suggest that in conscious dogs, the threshold level of A-II necessary to induce substantial hemodynamic changes is greater than the amount of A-II that can be acutely generated by activation of angiotensinogen. In addition, the present data suggest that the magnitude of the response is dependent on the availability of the substrate rather than the dose of renin injected centrally into conscious dogs.

Shock waves in solid craters and effects of high speed impact of particles on space vehicles

This paper presents an analytic method for evaluating the effect of shock compression on metals. A lattice potential of the Born-Mayer type is used for calculating the pressure, compressibility, Gruneisen coefficient, entropy, temperature, and energy. A general equation of state is determined in the form of p ( v , T ) = f ( v ) + Tg ( v ). Except for the use of a few well-established thermodynamic properties of the metal, no experimental data from shock-wave measurements are required for the theoretical calculation in this paper. Comparison between the calculated and cited experimental results is made only to test the accuracy of the analysis, and agreement turns out to be fairly close. The analysis also establishes a validity range for shock compressibility of solids, and the material model considered is sensitive to its lattice structure as compared with a continuum model.

Shock‐wave behavior and properties of solids are described on the basis of a quadratic representation for the shock velocity and with results of considerable generality and simplicity. An implicit treatment is provided by coupling the Hugoniot adiabat with the isentrope in the Gruneisen equation of state for solids. This also leads to correlations between data and results of shock and hydrostatic measurements for high pressures.

Investigations show that static compressibility of a Debye solid can be deduced from shock‐compression data and vice versa. In this paper three different approaches are considered for the evaluation of static and dynamic compressibilities. Except for the linear law of shock propagation and the Born—Mayer type of energy function, which are semianalytical, all other equations are derived on a full analytic basis. It is of interest to show that the entropy and temperature are implicit functions of shock compression. These implicit functions are then determined in closed form, and they turn out to provide a means for the calculation of thermal properties of the Debye solid at high pressures in terms of purely mechanical parameters. Some calculated results are given according to the pseudo‐Hugoniot approach only, and the validity range covers pressures from 104−107 atm and temperatures from 102−103K.

An average value of 11 / 6 is taken to represent the Gruneisen constant of these eighteen metals: Li, Na, K, Rb, Cs, Fe, Mo, Ta, W, Al, Co, Ni, Cu, Pd, Ag, Pt, Au, and Pb. An analytical model is formulated for the interpretation of shock‐wave behavior of the_e metals. The model is shown to be as heuristic as the classical model of gas dynamics, and the adiabatic indices and compression ratios of both models at shock infinity may now be arranged as orderly spectra (53, 32, 75, 43) and (4, 5, 6, 7), respectively. The investigation seeks to emphasize the interrelation between shock and isentropic compressibilities, and it also provides favorable evidence for the use of Slater formula to evaluate γ at high pressure.

In this paper the compressibility equation of Tait is generalized in a basic form with three arbitrary parameters. Data-fitting of these parameters can be made correct to the third order. Thus, the generalized Tait yields a more flexible equation of state that is also related simply to several other well-known equations of high pressure, all accurate only to the second order.

The ac resistivity of a “110 K phase” multiphase polycrystalline Ca-Sr-Bi-Cu-O compound and an “85 K phase” single-crystalline Ca0.9Sr2.1Cu2.0O8 + δ has been measured in various magnetic fields up to 8 T. Values forBc2/∥(0) of 71.5 T and forBc2⊥(0) of 542 T are found for the “85 K phase” sample. A value forBc2(0) of 57.9 T is estimated for the “110K phase” compound.

The ac resistivities and dc V-I characteristics have been studied in a multiphase Bi-Ca-Sr-Cu-O sample in the temperature region where the transition from the normal to the superconducting state takes place. The resistivity drops sharply between 112K and 107K and follows a tail before zero resistivity is reached near 94K. The resistivity in the tail region is current dependent, this current dependence is easily suppressed by a magnetic field. We argue that this phenomenon is due to weak links between regions of the 110K-phase material.

The observation of macroscopic quantum phenomena in a high-${T}_{c}$ superconducting material [${\mathrm{YBa}}_{2}$${\mathrm{Cu}}_{3}$${\mathrm{O}}_{9\mathrm{\ensuremath{-}}\mathrm{y}}$ (Y-Bu-Cu-O), ${T}_{c}$=93.4 K] is reported. Relationships between current, voltage, and magnetic fields of Sn--Y-Ba-Cu-O and Y-Ba-Cu-O--Y-Ba-Cu-O point contracts were measured. In both cases the critical current is periodic in the magnetic field, which is typical for double point contacts (dc superconducting quantum interference devices). In the Sn--Y-Ba-Cu-O contacts the oscillations were observed below the ${T}_{c}$ of tin. In the Y-Ba-Cu-O--Y-Ba-Cu-O contacts the oscillations were observed at temperatures up to 66 K, clearly demonstrating macroscopic quantum phemonena in this high-${T}_{c}$ material.

A study is presented of the magnetocrystalline anisotropy of the quasiternary systems (Pr/sub 1-x/Er/sub x/)/sub 2/Fe/sub 14/B and (Pr/sub 1-x/Sm/sub x/)/sub 2/Fe/sub 14/B in which, with increasing x, the easy-magnetization direction changes from easy axis to easy plane. Magnetization measurements on samples aligned magnetically at room temperature have been carried out in fields up to 20 T at temperatures ranging from 4.2 K to room temperature. The data of the easy-axis compounds are analyzed in terms of the anisotropy constants up to sixth-order, taking into account the misalignment of the grains in the magnetically-aligned samples. Special emphasis is given to the influence of the Sm and Er substitutions on the first-order magnetization process and the anisotropy energy of Pr/sub 2/Fe/sub 14/B. >

Initial studies were undertaken to investigate the effects of prolonged administration of angiotensin II (AII), 1 micrograms twice daily, via the lateral ventricles to mongrel dogs on arterial blood pressure and to determine if sodium intake was essential for the development of hypertension. Increasing AII levels in the cerebrospinal fluid for a prolonged period of time produced a sustained hypertensive state only in those dogs in which the daily intake of sodium was increased. The hypertension appeared to be due to an increase in total peripheral resistance. Central administration of AII increased both fluid intake and urine output. In order to assess the hemodynamic effects of increasing endogenous brain AII, renin was injected in doses of 0.025, 0.05, 0.1 and 0.3 units (from porcine kidney) into the lateral ventricles of chronically instrumented awake dogs. Hemodynamic variables were recorded prior to and one and 2 h after the central administration of renin. Renin produced a dose-dependent increase in mean arterial pressure with no significant change in heart rate or carotid, coronary and renal blood flow velocities. Chronic intraventricular administration of renin, 0.15 units twice daily to awake instrumented dogs receiving saline as the drinking fluid, markedly increased the daily intake of saline and increased diastolic and systolic blood pressure without increasing heart rate or carotid, coronary or renal blood flow velocities. There appears to be a direct significant relationship between the increase in mean blood pressure due to the intraventricular administration of renin and the volume of saline consumed.

This work is concerned with shock initiation in munitions. As a numerical experiment, twenty computations have been performed to simulate three basic types of detonation transfer between munitions at small separations. All computations show two distinct reactive flows, with shock waves communicable between them. The numerical aspects of these can serve to explain the mechanism and development of the detonation phenomena. One after the other, shock impulses arrive at the munition or acceptor explosive; it is the impact shock pulse, whose peak rises above the large scale gap test 50% point, that builds up to detonation. Shock sensitivity of the munition decreases as casing thickness or interround separation increases. Our numerical experiments also demonstrate the remarkable efficacy of thin plastic shields in suppressing detonation transfer.

This paper explores a new application field of power electronics. A soft-switching quasiresonant flyback converter is designed for transdermal drug delivery (TDD) applications with the processes of electroporation and phonophoresis. The converter can generate a constant DC voltage output for a pulsed generator in electroporation processing and can generate a variable DC voltage to drive a radial type of piezoelectric device in axial vibration mode for phonophoresis processing. Weight and size of the system can be reduced significantly, and its efficiency can be correspondingly improved, which is suitable for designing a portable TDD system. Experimental results have verified the feasibility and effectiveness of the proposed ideas.

This paper seeks to establish a new isentrope in the form of a generalized Murnaghan equation, by fitting its parameters with compressibility constants which are accurate to the third order. Such an isentrope corresponds also closely to the generalized shock adiabat of an earlier investigation by the author. Inasmuch as few third‐order compression data and equations are available in the literature, this work is meant to provide one using reliable data and results from shock compression of solids.

In the framework of a simple compression wave and a weak shock wave, an isentrope of the Tait type and a Hugoniot adiabat based on the linear velocity relation are shown to verify each other consistently. Thus, the two empirical equations of state are given a semianalytical treatment on favorable terms.

Evidence of a stable and reproducible high-Tc superconductivity above 90 K is reported in the single-phase YBa2Cu3O7. It is confirmed that this YBa2Cu3O7 phase is responsible for high-Tc superconductivity. A Curie-Weiss law in the dc-susceptility is observed above the superconducting transition temperature. The importance of the amount of the oxygen containing in this system to realize the superconductivity above 90 K is emphasized in relation to the crystal structure.