Search

The nucleotide sequence of the long terminal repeat (LTR) of human endogenous retrovirus element (HERV), localized in the first introne of the CD4 gene in the antisense direction, is determined. This new retrotransposon is highly homologous with different LTR HERV and belongs to HERV-K family. A peculiar feature of this element is an insertion of the Alu repeated sequence inside LTR. This Alu repeat has the same orientation as LTR HERV and contains two short open frames with a high level of homology with DAF (decay accelerating factor) proteins and the fifth complement component. In addition, this Alu repeat of LTR HERV contains regulatory elements: enhancer, TATAA box, poly A site, etc. Preservation of putative regulatory elements in the LTR suggests that they can render distinct regulatory properties to CD4 receptor gene.

Two strains of parotitis virus were isolated from patients with clinical symptoms of the disease in epidemiological screening which was carried out during an outbreak of epidemic parotitis in the village of Koltsovo in 1994. The strains were isolated from the saliva of children aged 7 and 8 years vaccinated with live parotitis vaccine at the age of 1.5 years. Primers for the genome site coding for the gene F terminal and the SH gene (a total of 509 n. p.) were estimated and synthesized and the site was amplified. Electron-microscopic examination of purified virus and Vero cells infected with it and serological tests showed a similarity of the newly isolated virus with the Anders strain of parotitis virus. The Dragun-1 and Dragun-2 strains of parotitis virus have been deposited in the collection of viruses at the Vektor State Research Center of Virology and Biotechnology in the village of Koltsovo, Novosibirsk district.

Immunization of BALB/c, C57BL/6, CBA/calac mice with strain XJ44 of Argentine hemorrhagic fever resulted in changes of nonspecific immunity parameters, such as interferon, interleukin-1, tumor necrosis factor, and natural killers. The formation of a specific humoral and cellular immune response in BALB/c mice immunized with this strain has been demonstrated. Immunization of BALB/c mice with strain XJ44 protected the animals from infection with a heterogeneous strain Carvallo of Bolivian hemorrhagic fever.

Nucleotide sequences of the genes 5 and 6 of the Marburg virus, Popp strain, were determined. ORFs encoding polypeptides VP30 (281 a.a., MW 32,640) and VP24 (253 a.a., MW 28,621) were found. The putative transcription start and stop signals for viral RNA-dependent RNA polymerase were revealed for both genes. Overlapping of genes 5 and 6 was shown. The deduced amino acid sequences of VP30 and VP24 proteins displayed significant homology with the analogous proteins of another filovirus, the Ebola virus (33% and 37%, respectively). The VP24 appeared to have a hydrophobic amino acid composition; content of hydrophobic amino acids was 40.7%. Model of VP24 location in the virion was suggested.

The nucleotide sequence of genomic RNA of Marburg virus strain Popp was determined. Strain Popp was isolated in 1967 during the first filoviral outbreak. The virus was purified from blood of infected guinea pigs in which it had been maintained. The length of the determined sequence was 19112 nucleotides. Amino acid sequences of seven known virion proteins were deduced. Nucleotide and amino acid sequences were compared with those of strain Musoke of Marburg virus isolated in 1980 in Kenya and purified from Vero cells. Homology between nucleotide sequences of two strains was 93.9%. Comparisons revealed conserved and variable regions of the nucleotide and amino acid sequences. The GP, the envelope protein of the virion, was found to be the most variable protein. The greatest differences in the protein were located in the supposedly external part of the molecule. Amino acid substitutions in the L protein, the main component of viral RNA-dependent RNA polymerase, were also distributed extremely non-randomly. It was shown that the non-coding regions of the genome were more variable than the coding ones; 37.6% of nucleotide differences corresponded to the former. 72.6% of nucleotide substitutions located in the coding regions were found to be at the third codon position.

Large-scale and uneven distribution of hepatitis C and B (HC and HB) among free blood donors of different regions of the Moldova Republic was established. The rate of detection of anti-HCV (South 6.2%, North 3.6%) correlated with that of HBsAg detection (south 12.5%, north 4.5%). A great role of HCV in the etiology of acute (among them posttransfusion) hepatitis and chronic hepatitis was demonstrated. A significant frequency of detection of anti-HCV (15%) in children treated in oncohematology wards and receiving multiple hemotransfusions as well as the detected cases of acute posttransfusion HC attest to active realization of this virus transmission in the transfusions of blood and/or its components. The necessity of urgent introduction into the Blood Transfusion Service of the republic of the examination of blood donors for HBsAg, alongside with their examination for the presence of anti-HCV and vaccination prophylaxis of HB in high risk groups is substantiated.

The authors tried to decode the mechanism of influenza viruses species adaptation in the process of host changing. The functionally important replacement in the surface pocket domains were revealed, particularly in the conservative region 221-241, involving fibronectin-like part. Close replacements were revealed in the region 141-161. The method of construction of heteroduplexes between hemagglutinin RNA of duck, pig, and human viruses was used. The method showed that all heteroduplexes formed recombinogene structures. An unexpected effect of directional recombination was elicited for hemagglutinin RNA heteroduplexes in cases of duck-pig and human-pig viruses. During the directional recombination the following processes took place: the receptor-binding site of animal type was transmitted to the duck virus, while the human receptor-binding site was transmitted to the pig virus. According to the experimental data, a new hypothesis is formulated: the cascade mechanism of directional recombination for duck, animal and human viruses makes it possible for the recombinant viruses to overcome interspecies barriers.

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

Regions of possible interaction between remantadine and transmembrane M2 protein are revealed by analysis of amino acid substitutions in remantadine- and deutiforin-resistant influenza viruses. The major region includes 5-6 amino acid residues at position 25-31, partially involving the premembrane region and the first position of a hydrophobic membrane-associated domain. The proposed model action of remantadine and its derivatives suggests that remantadine is included into the cell membrane lipid bimolecular layer by its adamantane share and its positively charged NH2-group is exposed to the cell surface. This allows remantadine and its analog to be regarded as molecular "hindrances" for viral particle decapsidation and budding.

DNA of the variola major virus strain India-1967 in the region of HindIII M, L, I fragments has been sequenced. Analysis of this sequence of 18029 bp revealed 19 potential open reading frames (ORFs). Four proposed proteins (L2R, H9R, L5L, L6R) contain metal-binding domains. Comparison of the variola virus (VAR) and vaccinia virus strain Copenhagen (COP) sequences show that the main differences are between proteins L1R and I5R. L1R contains 6 additional amino acid residues on the C-terminus. The protein I5R of VAR contains three Ca2+ binding domains but this COP has deletions in 2 of the 3 established domains. Possible functions of the predicted viral polypeptides are discussed.

The 10466 nucleotide long sequence of the cDNA copy of the tick-borne encephalitis strain 205 viral genome has been determined. It includes the 5'-nontranslating region, the genes for structural as well as nonstructural proteins and the first 93 nucleotides of 3'-nontranslating region. The difference in amino acid sequences of structural and nonstructural proteins of strains 205. Sofjin and Neudoerfl of the tick-borne encephalitis virus and the nucleotide changes in 5'- and 3'-nontranslating of these strains are discussed.

A rare case of larynx malignant fibrous histiocytoma is presented. Histologically and ultrastructurally, the tumour was similar to malignant fibrous histiocytoma of other organs. The patient was followed up for 2 years after surgical treatment and preoperative irradiation. No recurrence and metastases were observed.

Rhabdomyosarcoma is the most frequently occurring type of malignant solid tumors in children. The tumor site, aggressive growth, proneness to recurrence, metastatic spreading, and high neglect predetermine the negligible share of the surgical method in multimodality treatment of rhabdomyosarcomas. Of importance are the development and the use of different types and schemes of drug therapy which can be employed in combination with radiotherapy. Drug therapy of rhabdomyosarcomas has large practical potentialities which rise from year to year.

cDNA for proopiomelanocortin (POMC) of mink has been cloned and sequenced. A comparative analysis of the primary structures of mRNAs coding for proopiomelanocortins of eight animal species and man has been performed. The analysis has revealed conserved and variable POMC mRNA regions. High variability of some of the regions is suggested to be due to the peculiarities of their structural organization. A putative mechanism responsible for the mutations in variable regions is proposed. A tree of the evolutionary relations of POMC has been developed.

Issues in diagnosis and complex treatment of pediatric rhabdomyosarcoma were studied in 198 patients with morphologically verified disease. Tumors most often developed in the genitourinary organs (36.6%), head and neck (37%) and--less frequently--on the trunk and extremities (26.4%). The diagnostic workup included instrumental methods, ultrasonography and computed tomography. All modern modalities of cancer treatment, viz. surgery, drug and radiotherapy were used in those patients. As a rule, treatment was either combined or complex. Two-year-survival rate ranged from 83% for rhabdomyosarcoma of the orbit to 50% for those of the trunk and extremities and 47% for head and neck neoplasms. Two-year survival for patients with rhabdomyosarcoma of non-genitourinary sites was 54%.

Ganglioside profile was evaluated in 19 samples of tumor tissue obtained from 13 surgical patients with various morphological patterns of neuroblastoma. In six of those cases, two samples from each proving most different in terms of cell maturity were selected for examination. The relative content of GD2 gangliosides was 27.0-37.6% in sympathoblastoma and as low as 5.1-14.8% in ganglioneuroblastoma. Ganglioneuroblastomas showed fairly high levels of GM1 and GD1a gangliosides which were almost completely absent in sympathoblastomas. Ganglioside profile variations seen within each tumor type were incomparable with differences in profile established between morphological patterns of neuroblastoma studied.

ICO - 10 (Thy-1 antigen) and K 20 (gp 120/200) monoclonal antibodies proved suitable for immunophenotyping solid tumors. The following typical antigen combinations were identified with regard to reaction with those antibodies: ICO - 10+ K 20- (neuroblastoma, malignant schwannoma, neurosarcoma and soft tissue sarcomas); K 20+ ICO - 10- (cancer of the tongue and esophagus, adenoma of the adrenal cortex, adenocarcinoma of the stomach, hepatoblastoma and nephroblastoma); ICO - 10+ K 20+ (immature teratoma and cervical and esophageal leiomyoma) and ICO - 10+ K 20- (malignant fibrous histiocytoma).

1. Steel strengthened by phase work-hardening is distinguished by a ratio of fatigue limit to tensile strength (σ−1/σu=0.55−0.60) significantly greater than that of dispersion hardening steel. 2. The surface treatment method (grinding, turning, surface plastic deformation to a definite intensity) does not have a significant effect on the fatigue strength of N26T steel strengthened by phase work-hardening. 3. Combined strengthening of phase work-hardenable steel by surface plastic deformation, which causes the formation of 15–25% α phase on the surface, and subsequent aging at 350–400°C is an effective means of increasing life. The use of this method makes it possible to increase the fatigue limit by 20% for uniform cross section samples and by 200% for those with a notch. 4. The increase in the fatigue limit with the use of combined strengthening (surface plastic deformation and aging) is related to the increase in the strength of the surface layers as a result of the increase in the dislocation density and fixing of them by the particles of Ni3Ti precipitated in aging and also to the decrease in peak microstresses.

1. Alloying with nickel (8.6–15.7%) and aluminum (3.7–6.2%) of nonmagnetic manganese steels strengthened by precipitates of dispersed particles of vanadium carbide during aging leads to further increase of the strength after aging. This increase in strength is due to additional precipitation not only of spherical vanadium carbide particles 50–150 A in diameter but lamellar particles of intermetallic phase of the (Fe, Ni, Mn)Al type with average linear dimensions of 150×600 A. 2. The physicomechanical properties are highest for steel 50G17N10Yu4F2 quenched from 1150° and aged at 650° for 8 h: σb = 160 kgf/mm2, σ0.2 = 142 kgf/mm2, δ=11%, ψ=19%, μ

1. With nitriding of high-strength maraging steel N18K9M5T the high resistance to fracture is retained to a considerable extent. 2. Nitriding does not change the ductile character of the fracture of the core observed after aging. 3. Nitriding can be recommended for surface hardening of heavily stressed machine parts of steel N18K9M5T. In this case it is necessary to impose more severe requirements with regard to defects as compared with machine parts subjected to quenching and aging.

Results are reported from a study of the structure of steel aged after quenching and subsequent rolling at 20, 400, and 1000°C. It is shown that cold and warm rolling with low and moderate degrees of deformation intensifies the reaction which results in the discontinuous precipitation of chromium nitride. With high degrees of deformation, this reaction does not take place, and heterogeneous precipitation of nitrides occurs. Discontinuous and heterogeneous nitride precipitation take place during hot rolling. During subsequent aging, the processes of spheroidization, coalescence, and recrystallization result in the formation of a microduplex structure.

1. Alloying of Cr−Ni steels with nitrogen, managenese, vanadium, and silicon, or with manganese, vanadium, and carbon, in amounts such that the austenite packing-defect energy decreases to 12–15 mJ/m2 increases the ultimate strength of steels after cold deformation by 1100–1200 MPa. This is mainly caused by deformation strengthening of austenite and, to a smaller degree, by martensite transformation. A particular characteristic of these cold-worked, low-packing-energy steels is the presence of a large number of thin (about 0.1 μm), curved deformation-produced twins. 2. Additional strengthening of Kh16AG5N7S4 and 40Kh12G16N8F2 steels can be achieved by heating them after cold drawing to the temperature range 450–550°C, since such heat treatment causes precipitation of Cr2N-type nitrides in the former steel and VC and Cr23C6 carbides in the latter. Plastic deformation prior to aging prevents formation of continuous grain-boundary precipitates that would impair the tensile characteristics of the steels. 3. Wires manufactured from Kh16AG5NS4 and 40Kh12G16N8F2 steels possess higher strength characteristics than wire made from 12Kh18N10T steel, to the extent of 450 and 320 MPa, respectively.

Molecular and cytogenetic characteristics are given of a 2846 bp DNA sequence from the YDm12 clone, previously derived from the long arm of the Drosophila melanogaster Y chromosome. Sequence analysis revealed within it a 1176 bp fragment with 37 bp terminal inverted repeats, flanked by 6 bp direct repeats. This fragment (called "element 1360") appeared to be A-T rich, and was saturated with short direct and inverted repeats of different degrees of homology and consensus sequences for transcription, potential Z-DNA transition and autonomous replication. After in situ hybridization to polytene chromosomes, the element 1360 exhibited variable, strain-specifics location in the euchromatic parts of the chromosome arms, but constant heavy labelling of the X chromosome region 12E1-2, autosomal regions 42B1-3, 52A1-2, 62A1-2, 75B, 82C1-3, chromosome bases, the chromocentre and numerous sites of chromosome 4. The possible role of element 1360 in heterochromatin organization is discussed.

1. Precipitation-hardening nonmagnetic steels of the Fe−Mn−Ni system can be surface hardened by nitriding and also by work hardening of the surface. Surface layers with an elevated hardness to a depth of 0.3 mm can be obtained by nitriding of high-strength nonmagnetic steel 40G14N9Kh3YuF2. The results of comparative wear resistance tests showed that nitrided steel 40G14N9Kh3YuF2 is not inferior to steel 38KhMYuA, which has a fairly high wear resistance after nitriding. 2. Studies of the effect of preliminary heat treatment and the conditions and medium of nitriding on the hardness, depth, and condition of the nitride case showed that the best nitride case on steel 40G14N9Kh3YuF2 is obtained after nitriding at 560 and 600° in ammonia diluted with nitrogen when the steel has a fine-grained structure (after forging or after quenching from 1100° and aging), with an austenite grain size not lower than grade 6. 3. Surface hardening of steel 40G14N9F2 by roller burnishing and by shot peening increases the fatigue strength of smooth samples by 25–30% and notched samples by 90–140%. The increase in the fatigue strength is due to the high surface hardness (H 550) and compressive stresses (σcom~50–70 kg/mm2) in the surface layer.

1. Oxide films formed on the surface of Mn−Al steels during heating in a weakly oxidizing atmosphere can be used for local protection of surfaces not to be nitrided. 2. Heating in spent carburizer or pyrolized gas at 650–750° for 3–12 h produces a dense oxide film impenetrable to atomic nitrogen on the surface of high-manganese austenitic steels with 1.50–3.8% Al.

1. The strength of austenitic high-nitrogen Cr−Mn steels increases considerably when they are alloyed with 1% V due to precipitation hardening resulting from the dispersed particles of VN. 2. For high-nitrogen steels of the Kh18AG20F type we recommend the following optimal heat treatment: water quenching from 1200°, aging at 650° for 10 h. After this treatment, steel Kh18AG12F has high strength (σ0.2 = 830 MPa) and satisfactory ductility (δ=25%). 3. Austenitic high-nitrogen Cr−Mn steels are recommended for nonmagnetic heavily stressed machine parts and equipment.

1. Alloying with chromium raises the fatigue limit of austenitic steel in the quenched condition. In the hardened condition the presence of ∼15% Cr in austenitic steel lowers the fatigue limit due to precipitation of Cr23C6 carbides in the grain boundaries. For long-term operation under ordinary cyclic loading conditions, high-strength austenitic steel with an elevated chromium content is unsuitable. The steel can be recommended when the total number of cycles during operation does not exceed 104–105. 2. Nickel raises the fatigue limit of precipitation-hardening maraging austenitic steel. Nickel-manganese steel 40G14N9F can be recommended for long-term operation under cyclic loading conditions. 3. Electron fractographic studies showed a relationship between the durability of austenitic steel and the microrelief of the fatigue fracture. The number of cycles to failure is inversely proportional to the distance between striations on the fracture surface.

An evolutional tree of human influenza viruses of the H3N2-subtype is suggested on the basis of combined published primary structures of the hemagglutinin HA1-subunit. Possible differences between natural and sequenced structures are discussed. A tendency to reversions in the course of antigenic draft within the subtype has been revealed to support the hypothesis of limited antigenic evolution within a single subtype.

A scheme for evolutionary interrelations of the H1-subunits of influenza hemagglutinin genes is proposed for the natural variants of influenza A virus of the H1N1-subtype. It is based on experimental data obtained by the authors and those reported in the literature. Differences among these viral isolates in their amino acid sequences and in the reaction of hemagglutinin inhibition obtained with a set of monoclonal antibodies are compared. The distinctions in the ability of the viruses to react with several monoclonal antibodies are attributed to differences in the primary structures of their hemagglutinins. Some aspects of hemagglutinin gene evolution are discussed in relation to vaccination.

Full-length DNA copies of M-gene of remantadine-sensitive and remantadine-resistant variants of the influenza virus strain A/FPV/Weybridge (H7N7) have been synthesised and cloned. Complete nucleotide sequences of both cDNAs were determined by the Maxam-Gilbert method. There are three nucleotide substitutions, two of which lead to amino acid changes in M1 and M2 proteins. The existence of M3 protein, a polypeptide 68 amino acids long, encoded by the negative strand of RNA, is suggested. Amino acid changes in M2 and M3 proteins and their relation to the remantadine resistance are discussed.

A statistically valid similarity was found to exist between the amino acid sequences of poliovirus genome-linked protein VPg and a fragment of bacteriophage Mu transposase (Mu A protein). Based on this observation a hypothesis is proposed that the molecular mechanisms underlying the functions of the two proteins may be analogous. Both proteins are supposed to be site-specific endonucleases which form covalent linkage with the 5'-phosphate group of the nicked DNA or RNA strand. The amino acid residue participating in the formation of this linkage in MuA is tentatively identified as Tyr413.

A comparative analysis is presented of 24 known amino acid sequences of RNA-dependent RNA polymerases of positive strand RNA viruses infecting animals, plants and bacteria. Using a newly proposed methodology of group alignment for weakly similar sequences, evolutionary conserved fragments of all these proteins were unambiguously aligned. A unique pattern (consensus) of 7 invariant amino acid residues was revealed which is absent from the sequences of other RNA and DNA polymerases and is thought to unequivocally identify the RNA-dependent RNA polymerases of positive strand RNA viruses. Based on the obtained alignment a tentative phylogenetic tree of viral RNA polymerases was constructed for the first time. The RNA-dependent RNA polymerases of positive strand RNA viruses are concluded to comprise a distinct family of evolutionary related proteins.

Screening of amino acid sequences of a variety of virus-specific proteins for fragments structurally similar to the "ATP-consensus", a universal sequence found in nucleotide-binding pockets of several ATP-utilizing enzymes, was made. Fragments of hypothetical nucleotide-binding pockets were discovered in some proteins of DNA viruses (herpesviruses, papovaviruses, poxviruses and parvoviruses, comoviruses, bromoviruses, alpha 1-phaviruses and tobamoviruses). Analysis of the published data concerning the functions of the virus-specific proteins in question makes it evident that the proposal that these proteins possess nucleotide-binding properties. Is confirmed by these data or, at least does, not contradict to them. The possibility of a common evolutionary origin of the proteins containing fragments similar to the "ATP-consensus" is discussed.

Full-length DNA-copy of hemagglutinin gene RNA of influenza A virus strain A/Leningrad/54/1 was synthesized and cloned in E. coli plasmid pBR 327. Its primary structure was determined by a modified Maxam - Gilbert procedure. The nucleotide sequence of this gene was compared with sequences of analogous genes of influenza strains A/USSR/90/77 and A/PR/8/34. An addition of one nucleotide in non-translated region was found in the former.

Analysis of amino acid sequences of barley stripe mosaic virus (BSMV) proteins revealed the pentapeptide GDSGG, the sequence unique for catalytic centers of serine chymotrypsin-like proteases, in protein p14 encoded by open reading frame 4 of RNA beta. Computer-assisted comparisons revealed a statistically significant similarity between amino acid sequences of p14 and chymotrypsin-like proteases. The catalytic His and Asp residues tentatively identified in p14 together with the Ser residue of the GDSGG sequence, presumably, constitute the "catalytic triad" characteristic of chymotrypsin-like proteases. Based on these observations and on the presence of a potential N-proximal transmembrane domain in p14, this protein may be suggested to be a serine protease involved in processing of the replicase precursor within a membrane-bound replication complex of BSMV.

The possibility to reveal the following types of neuroblastoma is described: with c-ALL-antigen; with Thy-1-antigen (ICO-10); with granulocytic antigen (ICO-G2); with B-cell antigen (IPO-10). Immunocompetent cells in the tumour may be studied with the use of monoclonal antibodies ICO-1, ICO-11, ICO-GM-1, OKT3, IPO-3.

The complete nucleotide sequence of the cloned full-length DNA copy of A/Kiev/59/79 (H1N1) influenza virus hemagglutinin gene has been determined. The comparison with the other hemagglutinin structures reveals the divarication of evolutionary pathway of the H1N1-influenza viruses.