Search

International audience; Following Agrobacterium tumefaciens-mediated mutagenesis in Leptosphaeria maculans, we identified the mutant 210, displaying total loss of pathogenicity towards its host plant (Brassica napus). Microscopic observations showed that m210 is unable to germinate on the host leaf surface and is thus blocked at the pre-penetration stage. The pathogenicity phenotype is linked with a single T-DNA insertion into the promoter region of a typical plasma membrane H(+)-ATPase-encoding gene, termed Lmpma1, thus leading to a twofold reduction in Lmpma1 expression. Since LmPMA1 is involved in intracellular pH homeostasis, we postulate that reduction in LmPMA1 activity disturbs the electrochemical transmembrane gradient in m210, thus leading to conidia defective in turgor pressure generation on leaf surface. Whole genome survey showed that L. maculans possesses a second plasma membrane H(+)-ATPase-encoding gene, termed Lmpma2. Silencing experiments, expression analyses and phylogenetic studies allowed us to highlight the essential role assumed by the Lmpma1 isoform in L.maculans pathogenicity.

International audience; Leptosphaeria maculans, a dothideomycete fungus causing stem canker on oilseed rape, develops gene-for-gene interactions with its host plants. It has the ability to rapidly adapt to selection pressure exerted by cultivars harbouring novel resistance genes as exemplified recently by the 3-year evolution towards virulence at the AvrLm1 locus in French populations. The AvrLm1 avirulence gene was recently cloned and shown to be a solo gene within a 269 kb non-coding, heterochromatin-like region. Here we describe the sequencing of the AvrLm1 genomic region in one avirulent and two virulent isolates to investigate the molecular basis of evolution towards virulence at the AvrLm1 locus. For these virulent isolates, the gain of virulence was linked to a 260 kb deletion of a chromosomal segment spanning AvrLm1 and deletion breakpoints were identical or similar. Among the 460 isolates analysed from France, Australia and Mexico, a similar large deletion was apparent in > 90% of the virulent isolates. Deletion breakpoints were also strongly conserved in most of the virulent isolates, which led to the hypothesis that a unique deletion event leading to the avrLm1 virulence has diffused in pathogen populations. These data finally suggest that retrotransposons are key drivers in genome evolution and adaptation to novel selection pressure in L. maculans.

International audience; The avirulence gene AvrLm4-7 of Leptosphaeria maculans, the causal agent of stem canker in Brassica napus (oilseed rape), confers a dual specificity of recognition by two resistance genes (Rlm4 and Rlm7) and is strongly involved in fungal fitness. In order to elucidate the biological function of AvrLm4-7 and understand the specificity of recognition by Rlm4 and Rlm7, the AvrLm4-7 protein was produced in Pichia pastoris and its crystal structure was determined. It revealed the presence of four disulfide bridges, but no close structural analogs could be identified. A short stretch of amino acids in the C terminus of the protein, (R/N)(Y/F)(R/S)E(F/W), was well-conserved among AvrLm4-7 homologs. Loss of recognition of AvrLm4-7 by Rlm4 is caused by the mutation of a single glycine to an arginine residue located in a loop of the protein. Loss of recognition by Rlm7 is governed by more complex mutational patterns, including gene loss or drastic modifications of the protein structure. Three point mutations altered residues in the well-conserved C-terminal motif or close to the glycine involved in Rlm4-mediated recognition, resulting in the loss of Rlm7-mediated recognition. Transient expression in Nicotiana benthamiana (tobacco) and particle bombardment experiments on leaves from oilseed rape suggested that AvrLm4-7 interacts with its cognate R proteins inside the plant cell, and can be translocated into plant cells in the absence of the pathogen. Translocation of AvrLm4-7 into oilseed rape leaves is likely to require the (R/N)(Y/F)(R/S)E(F/W) motif as well as an RAWG motif located in a nearby loop that together form a positively charged region.

Agrobacterium species are soilborne gram-negative bacteria exhibiting predominantly a saprophytic lifestyle. Only a few of these species are capable of parasitic growth on plants, causing either hairy root or crown gall diseases. The core of the infection strategy of pathogenic Agrobacteria is a genetic transformation of the host cell, via stable integration into the host genome of a DNA fragment called T-DNA. This genetic transformation results in oncogenic reprogramming of the host to the benefit of the pathogen. This unique ability of interkingdom DNA transfer was largely used as a tool for genetic engineering. Thus, the artificial host range of Agrobacterium is continuously expanding and includes plant and nonplant organisms. The increasing availability of genomic tools encouraged genome-wide surveys of T-DNA tagged libraries, and the pattern of T-DNA integration in eukaryotic genomes was studied. Therefore, data have been collected in numerous laboratories to attain a better understanding of T-DNA integration mechanisms and potential biases. This review focuses on the intranuclear mechanisms necessary for proper targeting and stable expression of Agrobacterium oncogenic T-DNA in the host cell. More specifically, the role of genome features and the putative involvement of host’s transcriptional machinery in relation to the T-DNA integration and effects on gene expression are discussed. Also, the mechanisms underlying T-DNA integration into specific genome compartments is reviewed, and a theoretical model for T-DNA intranuclear targeting is presented.

The dothideomycete fungus, Leptosphaeria maculans, is poorly described at the genomic level. Two genomic regions have been analysed - one (55 kb) comprises a cluster of 18 genes encoding the biosynthetic enymes for a phytotoxin, sirodesmin, whilst the other (184 kb) is the pericentromeric region of a 2.80 Megabase chromosome. Transcription of all genes in the sirodesmin gene cluster is co-regulated with the production of sirodesmin in culture. Disruption of one of these genes (encoding a two-module non-ribosomal peptide synthetase) is essential for production of sirodesmin. The 184 kb sequence contains 6.980 kb repetitive element named Pholy bordered by two Long Terminal Repeats (LTRs), five Pholy-related sequences, mostly truncated at their 3′ ends; and five solo-LTRs. This element, Pholy, comprises a previously described element, LMR1. Structural features suggest that Pholy corresponds to an ancient copia-like retrotransposon, as it has high sequence similarity to the ELSA retrotransposon of the closely related fungus, Stagonospora nodorum. Comparative analysis of the structure of the Pholy-like sequences in the 184 kb contig and in other parts of the genome suggests that this family of repetitive elements has undergone extensive Repeat Induced Point (RIP) mutation.

Summary Leptosphaeria maculans, a Dothideomycete causing stem canker on oilseed rape (Brassica napus), develops gene-for-gene interactions with its host plants. To date, nine resistance genes (Rlm1–9) have been identified in Brassica spp. The corresponding nine avirulence genes (AvrLm1–9) in L. maculans have been mapped at four independent loci, thereby revealing two clusters of three and four linked avirulence genes. Here, we report the completion of map-based cloning of AvrLm1. AvrLm1 was genetically delineated within a 7.3 centimorgan interval corresponding to a 439 kb BAC contig. AvrLm1 is a single copy gene isolated within a 269 kb non-coding, heterochromatin-like region. The region comprised a number of degenerated, nested copies of four long-terminal repeat (LTR) retrotransposons, including Pholy and three novel Gypsy-like retrotransposons. AvrLm1 restored the avirulent phenotype on Rlm1 cultivars following functional complementation of virulent isolates. AvrLm1 homologues were not detected in other Leptosphaeria species or in known fungal genomes including the closely related species Stagonospora nodorum. The predicted AvrLm1 protein is composed of 205 amino acids, of which only one is a cysteine residue. It contains a peptide signal suggesting extracellular localization. Unlike most other fungal avirulence genes, AvrLm1 is constitutively expressed, with a probable increased level of expression upon plant infection, suggesting the absence of tight regulation of AvrLm1 expression.

Leptosphaeria maculans is the most ubiquitous fungal pathogen of Brassica crops and causes the devastating stem canker disease of oilseed rape worldwide. We used minisatellite markers to determine the genetic structure of L. maculans in four field populations from France. Isolates were collected at three different spatial scales (leaf, 2-m 2 field plot, and field) enabling the evaluation of spatial distribution of the mating type alleles and of genetic variability within and among field populations. Within each field population, no gametic disequilibrium between the minisatellite loci was detected and the mating type alleles were present at equal frequencies. Both sexual and asexual reproduction occur in the field, but the genetic structure of these populations is consistent with annual cycles of randomly mating sexual reproduction. All L. maculans field populations had a high level of gene diversity ( H = 0.68 to 0.75) and genotypic diversity. Within each field population, the number of genotypes often was very close to the number of isolates. Analysis of molecular variance indicated that >99.5% of the total genetic variability was distributed at a small spatial scale, i.e., within 2-m 2 field plots. Population differentiation among the four field populations was low ( G ST < 0.02), suggesting a high degree of gene exchange between these populations. The high gene flow evidenced here in French populations of L. maculans suggests a rapid countrywide diffusion of novel virulence alleles whenever novel resistance sources are used.

Leptosphaeria maculans, the causal agent of stem canker of oilseed rape, develops gene-for-gene interactions with its hosts. To date, eight L. maculans avirulence (Avr) genes, AvrLm1 to AvrLm8, have been genetically characterized. An additional Avr gene, AvrLm9, that interacts with the resistance gene Rlm9, was genetically characterized here following in vitro crosses of the pathogen. A worldwide collection of 63 isolates, including the International Blackleg of Crucifers Network collection, was genotyped at these nine Avr loci. In a first step, isolates were classified into pathogenicity groups (PGs) using two published differential sets. This analysis revealed geographical disparities as regards the proportion of each PG. Genotyping of isolates at all Avr loci confirmed the disparities between continents, in terms of Avr allele frequencies, particularly for AvrLm2, AvrLm3, AvrLm7, AvrLm8, and AvrLm9, or in terms of race structure, diversity, and complexity. Twenty-six distinct races were identified in the collection. A larger number of races (n = 18) was found in Australia than in Europe (n = 8). Mean number of virulence alleles per isolate was also higher in Australia (5.11 virulence alleles) than in Europe (4.33) and Canada (3.46). Due to the diversity of populations of L. maculans evidenced here at the race level, a new, open terminology is proposed for L. maculans race designation, indicating all Avr loci for which the isolate is avirulent.

SUMMARY Leptosphaeria maculans is the most ubiquitous pathogen of Brassica crops, and mainly oilseed brassicas (oilseed rape, canola), causing the devastating ‘stem canker’ or ‘blackleg’. This review summarizes our current knowledge on the pathogen, from taxonomic issues to specific life traits. It mainly illustrates the importance of formal genetics approaches on the pathogen side to dissect the interaction with the host plants. In addition, this review presents the main current research topics on L. maculans and focuses on the L. maculans genome initiative recently begun, including its main research issues. Taxonomy: Leptosphaeria maculans (Desm.) Ces. & de Not. (anamorph Phoma lingam Tode ex Fr.). Kingdom Fungi, Phylum Ascomycota, Class Dothideomycetes (Loculoascomycetes), Order Pleosporales, Genus Leptosphaeria, Species maculans. Host range: cultivated Brassicas such as Brassica napus (oilseed rape, canola), B. rapa, B. juncea, B. oleracea, etc., along with numerous wild crucifers species. Arabidopsis thaliana was recently reported to be a potential host for L. maculans. Primary disease symptoms are greyish-green collapse of cotyledon or leaf tissue, without a visible margin, bearing tiny black spots (pycnidia). The fungus then develops an endophytic symptomless growth for many months. Secondary symptoms, at the end of the growing season, are dry necroses of the crown tissues with occasional blackening (stem canker or blackleg) causing lodging of the plants. Pseudothecia differentiate on leftover residues. Seedling damping-off and premature ripening are also reported under certain environmental conditions. Useful websites: Leptosphaeria maculans sequencing project at Genoscope: http://www.genoscope.cns.fr/externe/English/Projets/Projet_DM/organisme_DM.html; the SECURE site: http://www.secure.rothamsted.ac.uk/ the ‘Blackleg’ group at the University of Melbourne: http://www.botany.unimelb.edu.au/blackleg/overview.htm

The LMR1 5.2 kb interspersed repeat of Leptosphaeria maculans was described by Taylor and Borgmann [Mol. Plant Microbe Interact. 7 (1994) 181] as an uncharacterized repeated element sharing homologies with both LINEs and SINEs. Here, we used the LMR1 sequence as a template to identify the full-length element within a 184-kb genomic sequence corresponding to the pericentromeric region of the 2.80 Mb chromosome of isolate v23.1.3. This region comprises (i) one 6980-bp full-sized Pholy element bordered by two 275- to 280-bp long terminal repeats (LTRs), (ii) five Pholy-related sequences, usually truncated at their 3′ ends, and (iii) five solo-LTRs. Structural features strongly suggested that Pholy corresponds to an ancient copia-like retrotransposon, sharing strong homologies with the Elsa retrotransposon of Stagonospora nodorum. Pholy was also suggested to be specific to pericentromeric regions. Comparative analysis of the structure of the Pholy-like sequences occurring in the 184-kb contig and in other parts of the genome showed that this family of repeats is highly degenerated following extensive repeat induced point mutation (RIP).

Two types of genetic resistance to Leptosphaeria maculans usually are distinguished in Brassica napus: qualitative, total resistance expressed at the seedling stage and quantitative, partial resistance expressed at the adult plant stage. The latter is under the control of many genetic factors that have been mapped through quantitative trait loci (QTL) studies using ‘Darmor’ resistance. The former usually is ascribed to race-specific resistance controlled by single resistance to L. maculans (Rlm) genes. Three B. napus-originating specific Rlm genes (Rlm1, Rlm2, and Rlm4) previously were characterized. Here, we report on the genetic identification of two novel resistance genes, Rlm3 and Rlm7, corresponding to the avirulence genes AvrLm3 and AvrLm7. The identification of a novel L. maculans- B. napus specific interaction allowed the detection of another putative new specific resistance gene, Rlm9. The resistance genes were mapped in two genomic regions on LG10 and LG16 linkage groups. A cluster of five resistance genes (Rlm1, Rlm3, Rlm4, Rlm7, and Rlm9) was strongly suggested on LG10. The relation between all these specific resistance genes and their potential role in adult-plant field resistance is discussed. These two Rlm-carrying regions do not correspond to major QTL for Darmor quantitative resistance.

Leptosphaeria maculans, the cause of stem canker of oilseed rape (OSR), exhibits gene-for-gene interactions with its host plant. The race structure of L. maculans was assessed on the basis of the analysis of 1011 isolates collected in France between 1990 and 2000, with regards to three AVR genes, AvrLm1, AvrLm2 and AvrLm4. The effect of selection pressure, due to large-scale cropping of Rlm1 cultivars, on the evolution of races of the fungus was also evaluated. The results revealed a scarcity or complete absence of isolates harbouring AvrLm2, whereas isolates harbouring AvrLm4 were present at a variable level, that was as high as 17.2–31.2% depending on the sample year and location. When obtained from rlm1 cultivars, isolates harbouring AvrLm1 always represented more than 83% of the populations until the 1997–1998 growing season. As a consequence, the Rlm1 cultivars had been highly efficient at controlling the disease and were grown on an estimated 43.7% of the total French acreage in OSR in 1998–1999. However, the increased commercial success of Rlm1 cultivars was paralleled by a decrease in the proportion of isolates harbouring AvrLm1 in 1997–1998 and 1998–1999. This resulted in less than 13% of isolates harbouring AvrLm1 in populations being collected from rlm1 cultivars in 1999 and 2000, and contributed to the loss of efficiency of the Rlm1 resistance in the field. The present study is an illustration of one round of a `boom and bust' cycle that occurred for a pathosystem where it has never been reported before. These data and the high evolutionary potential of L. maculans are fully supportive of one pathogen species with a high risk of breaking down resistance genes in OSR and suggest that the development of integrated strategies aiming at maximising the durability of novel resistance is now a priority for this pathosystem.

The occurrence of race-specific resistance genes to the stem canker fungus, Leptosphaeria maculans, was analysed in 453 accessions of B. napus, mainly originating from the Institut fur Pflanzengenetik und Kulturpflanzenforschung (IPK) GeneBank. Major resistance genes Rlm1, Rlm2, Rlm4 and the putative RlmBBA gene were investigated using genetically improved strains of the fungus harbouring as few corresponding avirulence genes as possible. In addition, a screening with fully virulent isolates was used to uncover novel resistance sources. Major resistance genes were rarer in frequency and diversity in spring-type cultivars compared to winter types. In the former, 65.7% of the accessions were fully susceptible to all isolates, whereas only 12.2% of the winter types were devoid of at least one R gene. In spring cultivars, the most common R gene, Rlm4 was found in 26.6% of accessions, whereas the other R genes were rare. In winter cultivars, the most common R genes were Rlm2 (more than 45.9–54.0% of the accessions) and Rlm4 (26.4–27.7% of the genotypes). In winter types however, the improvement of the quality of oils, through the generation of single- and double-low genotypes improved the homogeneity of the cvs, whereas it impoverished R gene diversity, including the loss of complete resistance that was harboured by 18.4% of the less advanced accessions, and a reduction in the ratio of accessions harbouring Rlm1. Correlation between the R gene(s) present in the accessions and their field resistance is discussed.

International audience; In gene-for-gene systems, resistance of a plant to a pathogen is due to the ‘recognition’ by plant surveillance system (i.e. plant resistance gene product) of a pathogen avirulence determinant encoded by an avirulence gene to eventually result in triggering of plant immunity. Avirulence proteins (or products) actually are effectors involved in pathogenicity. In viruses, virtually all the proteins can behave as avirulence determinants. In all other cases,avirulence genes are extreme lydiverse,being often species or isolate/strain-specific and rarely have matches in sequence databases. They often are specifically expressed or strongly over-expressed during plant–pathogen interaction and the encoded proteins show the presence of secretion signals and translocation signals (e.g. the Type III secretion signal for bacteria). Avirulence genes seem to be submitted to high-speed diversifying selection allowing the pathogen to diversify its effector repertoire and rapidly escape recognition by the plant resistance gene.

Leptosphaeria maculans, the causal agent of stem canker of oilseed rape (Brassica napus), develops gene-for-gene interactions with oilseed rape, and four L. maculans avirulence (AVR) genes (AvrLm1, AvrLm2, AvrLm4, and alm1) were previously genetically characterized. Based on the analysis of progeny of numerous in vitro crosses between L. maculans isolates showing either already characterized or new differential interactions, this work aims to provide an overview of the AVR genes that may specify incompatibility toward B. napus and the related species B. juncea and B. rapa. Two novel differential interactions were thus identified between L. maculans and B. napus genotypes, one of them corresponding to a complete resistance to European races of L. maculans. In both cases, a single gene control of avirulence was established (genes AvrLm3 and AvrLm7). Similarly, a single gene control of avirulence toward a B. rapa genotype, also resistant to European L. maculans isolates, was demonstrated (gene AvrLm8). Finally, a digenic control of avirulence toward B. juncea was established (genes AvrLm5 and AvrLm6). Linkage analyses demonstrated that at least four unlinked L. maculans genomic regions, including at least one AVR gene cluster (AvrLm1-AvrLm2-AvrLm6), are involved in host specificity. The AvrLm3-AvrLm4-AvrLm7 region may correspond either to a second AVR gene cluster or to a multiallelic AVR gene.

Map-based cloning of the avirulence gene AvrLm1 of Leptosphaeria maculans was initiated utilizing a genetic map of the fungus and a BAC library constructed from an AvrLm1 isolate. Seven polymorphic DNA markers closely linked to AvrLm1 were identified. Of these, two were shown to border the locus on its 5′ end and were present, with size polymorphism, in both the virulent and the avirulent isolates. In contrast, three markers, J19-1.1, J53-1.3 (in coupling phase with avirulence), and Vir1 (in repulsion phase with avirulence), cosegregated with AvrLm1 in 312 progeny from five in vitro crosses. J19-1.1 and J53-1.3 were never amplified in the virulent parents or progeny, whereas Vir1 was never amplified in the avirulent parents or progeny. J19-1.1 and J53-1.3 were shown to be separated by 40 kb within a 184-kb BAC contig. In addition, the 1.6-cM genetic distance between J53-1.3 and the nearest recombinant marker corresponded to a 121-kb physical distance. When analyzing a European Union-wide collection of 192 isolates, J53-1.3, J19-1.1, and Vir1 were found to be closely associated with the AvrLm1 locus. The results of polymerase chain reaction amplification with primers for the three markers were in accordance with the interaction phenotype for 92.2% (J53-1.3), 90.6% (J19-1.1), and 88.0% (Vir1) of the isolates. In addition, genome organization of the AvrLm1 region was highly conserved in field isolates, because 89.1% of the avirulent isolates and 79.0% of the virulent isolates showed the same association of markers as that of the parents of in vitro crosses. The large-scale analysis of field isolates with markers originating from the genetic map therefore confirms (i) the physical proximity between the markers and the target locus and (ii) that AvrLm1 is located in (or close to) a recombination-deficient genome region. As a consequence, map-based markers provided us with high-quality markers for an overview of the occurrence of race “AvrLm1” at the field scale. These data were used to propose hypotheses on evolution towards virulence in field isolates.

The colonization of winter oilseed rape plants and epidemiology of phoma stem canker differed between A/Tox+ and B/Tox0Leptosphaeria maculans. In France and England, where plant colonization was investigated during two and three growing seasons, respectively, there was a difference in timing of leaf infection; A/Tox+L. maculans was predominant on leaves in the autumn (October/November) but there was an increase in the incidence of B/Tox0 in the winter (January/February). In May, June and July both species could be isolated from all external parts of the plant (root to the upper stem) and all crown (stem base) tissues, although they differed in their distribution. At the root and crown, A/Tox+L. maculans was predominant and was located throughout the cortex, wood and pith tissues, but the rarer B/Tox0 was located mainly in the cortex. Approximately equal numbers of A/Tox+ and B/Tox0 isolates were obtained from the upper stem – there was a greater proportion of B/Tox0 isolates than at the crown. In England, after harvest in 1999 and 2000, pseudothecia on the lignified tap root and crown tissues produced predominantly A/Tox+ ascospores (94%), while pseudothecia higher up the stem produced more B/Tox0 ascospores (60%) than A/Tox+ ascospores (40%). The timing of the onset of leaf spotting, earlier in the season for A/Tox+ than B/Tox0L. maculans, and the predominance of mycelium of A/Tox+ at the crown are consistent with the assumption that A/Tox+ is more likely to cause the most damaging stem cankers than B/Tox0L. maculans. Identification as A/Tox+ or B/Tox0 by cultural characteristics differed only slightly (2·3%) from identification by molecular techniques.

Les composantes (Tox+ et Tox0) du complexe implique dans la necrose du collet du colza ont ete suivies au cours du temps et dans la plante, a l’aide d’outils moleculaires (ITS, ISSR), afin de clarifier leurs roles respectifs dans les degâts de necrose, de preciser les relations entre les symptomes foliaires precoces et les necroses du collet tardives et d’evaluer l’etendue de la colonisation de la plante, en conditions naturelles, pendant deux cycles culturaux successifs. Les deux composantes, presentes en permanence, varient en proportion selon la periode de culture et l’organe consideres. La composante Tox+, qui predomine aux deux extremes du cycle cultural, sur feuille en automne et au collet en fin de vegetation, est responsable des degâts de necrose. L’analyse topographique de la region du collet indique que tous les tissus, fortement colonises par de nombreuses souches Tox+ distinctes, constituent un site privilegie de confrontation entre souches differentes, favorable a la reproduction sexuee du champignon.

Background Many plant-pathogenic fungi have a tendency towards genome size expansion, mostly driven by increasing content of transposable elements (TEs). Through comparative and evolutionary genomics, five members of the Leptosphaeria maculans-Leptosphaeria biglobosa species complex (class Dothideomycetes, order Pleosporales), having different host ranges and pathogenic abilities towards cruciferous plants, were studied to infer the role of TEs on genome shaping, speciation, and on the rise of better adapted pathogens. Results L. maculans ‘brassicae’, the most damaging species on oilseed rape, is the only member of the species complex to have a TE-invaded genome (32.5%) compared to the other members genomes (

International audience; In complex eukaryotes, transposable elements (TEs), previously considered as junk DNA, are more and more acknowledged as genome shapers and as a source of gene innovation, genome plasticity and genome divergence. Fungi are simple and easy-to-manipulate eukaryotic organisms, for which ever-increasing genome information indicates that many plant-associated fungi have a tendency to have expanded genomes. This increase in genome size is mostly driven by TE expansion that eventually shapes adaptive regions of the genome. Such genome regions harbour genes involved in niche adaptation and favour accelerated evolution of these genes. The recent rise of comparative genomics in fungi now allows the use of phylogeny to date TE invasion and proliferation in genomes. This in turn provides inferences about the impact of TEs on speciation and on the rise of better-adapted species. Here, focusing on plant-associated fungi, we review our current level of knowledge on how TEs may have contributed to speciation, the rise of two-speed genomes and the shaping of specific genome environments. Moreover, we consider the role of TEs in gene duplication and diversification that contribute to both adaptation to new hosts and adaptation to host resistance genes in gene-for-gene systems.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.

Leptosphaeria maculans, the ascomycete fungus which causes blackleg disease of oilseed rape, has been considered for a long time as a single species divided into ‘aggressive’ and ‘non-aggressive’ pathogenicity groups which differ in their economic importance. However, the development of accurate biochemical and molecular characterisation methods has demonstrated that the world-wide L. maculans population actually comprises at least two species. The aim of this research was to assess the ability of rep (repetitive element based)-PCR genomic fingerprinting methods, initially developed for bacterial identification, to characterise a collection of 90 isolates of L. maculans from Poland, in comparison with reference isolates from the IBCN (International Blackleg of Crucifers Network) collection. REP (repetitive extragenic palindromic)-, ERIC (enterobacterial repetitive intergenic consensus)-, and BOX primers for rep-PCR genomic fingerprinting, and primers derived from LMR1, a L. maculans specific repeated element, were tested. Rep-PCR and LMR1-based analyses were able to discriminate the different components of the species complex and to evaluate the genetic diversity within each member of the complex. These analyses suggested that Polish populations of L. maculans mainly belong to the ‘non-aggressive’ species, rather than the ‘aggressive’ species which is prevalent in Western Europe, Canada and Australia.

The blackleg disease of oilseed rape is caused by an ascomycete species complex termed Leptosphaeria maculans (anamorph Phoma lingam). L. maculans isolates collected worldwide were gathered in the International Blackleg of Crucifers Network (IBCN) collection. Representative IBCN isolates, along with one P. nigrificans isolate, were further analyzed using polymerase chain reaction (PCR) amplification of the internal transcribed spacer (ITS) region. ITS size polymorphism discriminated three groups: (i) P. nigrificans, (ii) Tox+ and ‘Lepidium’ isolates, and (iii) NA1, NA2, NA3, ‘Thlaspi’, and ‘Erysimum’ isolates. Digestion of the ITS region with 19 selected endonucleases showed restriction site polymorphism between the different subgroups: digestion with RsaI could discriminate Tox+ from ‘Lepidium’ isolates, whereas digestion with four enzymes, i.e., HaeIII, EcoRII, RsaI, and AluI, was needed to discriminate between NA1, NA2, NA3, ‘Thlaspi’, and ‘Erysimum’ isolates. No restriction site polymorphism was observed between isolates within the ‘Thlaspi’, Tox+, NA1, and NA2 subgroups. Direct amplification of the ITS region could be achieved using intact conidia, collected either in axenic cultures or on leaf lesions, with only a 4-min 95°C denaturation step prior to PCR reaction. A routine identification protocol requiring no DNA extraction and a sequential use of a few restriction enzymes following PCR has been used successfully for large-scale identification of French field isolates.

Field experiments were conducted in Versailles, France, to assess blackleg resistance of Brassica napus cultivars Quinta and Glacier under natural infection conditions. Blackleg disease severity was assessed twice during growth of B. napus. Quinta resistance was highly expressed as only 13% to 18% of the plants exhibited leaf symptoms in December, whereas Glacier and other cultivars displayed more than 80% of infected plants. In June (harvest), 70% (first year) to 41.5% (second year) of Quinta plants were canker-free. In contrast, Glacier was as infected as the susceptible control cultivars, with more than 88% of plants displaying canker. The Leptosphaeria maculans population structure was examined in parallel. Based on soluble protein patterns, 9% of the 299 fungal isolates collected were characterized as Tox0 species, and belonged to the NA1 sub-group. All but two of Tox0 isolates were isolated from atypical dark necrotic leaf lesions, mainly occurring on Quinta. In contrast, the Tox+ isolates were recovered from typical leaf lesions. Following a cotyledon inoculation test on the differential set Westar, Quinta and Glacier, 92 to 95% of Tox+ isolates collected on susceptible cultivars were characterized as PG3 isolates, i.e. avirulent on Quinta. The remaining Tox+ isolates belong to PG4, i.e. virulent on the three cultivars. No PG2 isolate, i.e. avirulent on both Quinta and Glacier, was identified in the sampling. The present study suggests that specific resistance expressed at the cotyledon level can be efficient under field conditions where the corresponding avirulent races of the pathogen are prevalent.

Phytopathogenic fungi are a major threat for global food security and show an extreme plasticity in pathogenicity behaviours. They often have a high adaptive potential allowing them to rapidly counteract the control methods used by men in agrosystems. In this paper, we evaluate the link between genome plasticity and adaptive potential using genomics and comparative genomics approaches. Our model is the evolutionary series Leptosphaeria maculans-Leptosphaeria biglobosa, encompassing five distinct entities, whose conspecificity or heterospecificity status is unclear, and which all are pathogens of cruciferous plants. They however differ by their host range and pathogenicity. Compared to other species of the species complex, the species best adapted to oilseed rape, L. maculans "brassicae", causing important losses in the crop, has a genome that was submitted to a recent and massive burst of transposition by a few families of transposable elements (TEs). Whether the genome invasion contributed to speciation is still unclear to-date but there is a coincidence between this burst of TEs and divergence between two species. This TE burst contributed to diversification of effector proteins and thus to generation of novel pathogenic specificities. In addition, the location of effector genes within genome regions enriched in TEs has direct consequences on adaptation to plant resistance and favours a multiplicity of mutation events allowing "breakdown" of resistance. These data are substantiated by other examples in the literature showing that fungi tend to have a "two-speed" genome, in which a plastic compartment enriched in TE host genes is involved in pathogenicity and adaptation to host.

International audience; Phytopathogenic fungi frequently contain dispensable chromosomes, some of which contribute to host range or pathogenicity. In Leptosphaeria maculans, the stem canker agent of oilseed rape (Brassica napus), the minichromosome was previously suggested to be dispensable, without evidence for any role in pathogenicity. Using genetic and genomic approaches, we investigated the inheritance and molecular determinant of an L. maculans-Brassica rapa incompatible interaction.Single gene control of the resistance was found, while all markers located on the L. maculans minichromosome, absent in the virulent parental isolate, co-segregated with the avirulent phenotype. Only one candidate avirulence gene was identified on the minichromosome, validated by complementation experiments and termed AvrLm11. The minichromosome was frequently lost following meiosis, but the frequency of isolates lacking it remained stable in field populations sampled at a 10-yr time interval, despite a yearly sexual stage in the L. maculans life cycle.This work led to the cloning of a new 'lost in the middle of nowhere' avirulence gene of L. maculans, interacting with a B. rapa resistance gene termed Rlm11 and introgressed into B. napus. It demonstrated the dispensability of the L. maculans minichromosome and suggested that its loss generates a fitness deficit.

Modern agriculture favours the selection and spread of novel plant diseases. Furthermore, crop genetic resistance against pathogens is often rendered ineffective within a few years of its commercial deployment. Leptosphaeria maculans, the cause of phoma stem canker of oilseed rape, develops gene-for-gene interactions with its host plant, and has a high evolutionary potential to render ineffective novel sources of resistance in crops. Here, we established a four-year field experiment to monitor the evolution of populations confronted with the newly released Rlm7 resistance and to investigate the nature of the mutations responsible for virulence against Rlm7. A total of 2551 fungal isolates were collected from experimental crops of a Rlm7 cultivar or a cultivar without Rlm7. All isolates were phenotyped for virulence and a subset was genotyped with neutral genetic markers. Virulent isolates were investigated for molecular events at the AvrLm4-7 locus. Whilst virulent isolates were not found in neighbouring crops, their frequency had reached 36% in the experimental field after four years. An extreme diversity of independent molecular events leading to virulence was identified in populations, with large-scale Repeat Induced Point mutations or complete deletion of AvrLm4-7 being the most frequent. Our data suggest that increased mutability of fungal genes involved in the interactions with plants is directly related to their genomic environment and reproductive system. Thus, rapid allelic diversification of avirulence genes can be generated in L. maculans populations in a single field provided that large population sizes and sexual reproduction are favoured by agricultural practices., Author Summary Plant disease resistance often relies on simple “gene-for-gene” systems and, in the pathogen, a mutation in a single “avirulence” gene matching the plant resistance gene is sufficient to render the resistance ineffective. In agricultural systems, breeding for resistance is challenged by both the high evolutionary potential of the pathogen and the large scale of crop production; together, these factors encourage “breakdown” of novel sources of resistance soon after their deployment. Here, we established a four-year field experiment to evaluate the mechanisms and speed with which a fungal pathogen of oilseed rape, Leptosphaeria maculans renders ineffective the novel resistance gene Rlm7. The pathogen showed a very high evolutionary potential; the proportion of isolates in the population that were virulent against Rlm7 increased from 0 to 36% in four years. The experiment demonstrated that an extremely diverse range of molecular events leading to virulence, from more or less extensive nucleotide mutations or deletions to complete gene deletion, can occur in a single field. These results suggest that the genomic environment of the avirulence gene and the reproductive regime of the pathogen promote mutability at a single locus to produce virulence. Cropping practices that promote large pathogen populations and encourage sexual reproduction therefore favour rapid adaptation of the pathogen to the novel resistance.

Background: Gene loss, inversions, translocations, and other chromosomal rearrangements vary among species, resulting in different rates of structural genome evolution. Major chromosomal rearrangements are rare in most eukaryotes, giving large regions with the same genes in the same order and orientation across species. These regions of macrosynteny have been very useful for locating homologous genes in different species and to guide the assembly of genome sequences. Previous analyses in the fungi have indicated that macrosynteny is rare; instead, comparisons across species show no synteny or only microsyntenic regions encompassing usually five or fewer genes. To test the hypothesis that chromosomal evolution is different in the fungi compared to other eukaryotes, synteny was compared between species of the major fungal taxa. Results: These analyses identified a novel form of evolution in which genes are conserved within homologous chromosomes, but with randomized orders and orientations. This mode of evolution is designated mesosynteny, to differentiate it from micro-and macrosynteny seen in other organisms. Mesosynteny is an alternative evolutionary pathway very different from macrosyntenic conservation. Surprisingly, mesosynteny was not found in all fungal groups. Instead, mesosynteny appears to be restricted to filamentous Ascomycetes and was most striking between species in the Dothideomycetes. Conclusions: The existence of mesosynteny between relatively distantly related Ascomycetes could be explained by a high frequency of chromosomal inversions, but translocations must be extremely rare. The mechanism for this phenomenon is not known, but presumably involves generation of frequent inversions during meiosis.

Fungi are of primary ecological, biotechnological and economic importance. Many fundamental biological processes that are shared by animals and fungi are studied in fungi due to their experimental tractability. Many fungi are pathogens or mutualists and are model systems to analyse effector genes and their mechanisms of diversification. In this study, we report the genome sequence of the phytopathogenic ascomycete Leptosphaeria maculans and characterize its repertoire of protein effectors. The L. maculans genome has an unusual bipartite structure with alternating distinct guanine and cytosine-equilibrated and adenine and thymine (AT)-rich blocks of homogenous nucleotide composition. The AT-rich blocks comprise one-third of the genome and contain effector genes and families of transposable elements, both of which are affected by repeat-induced point mutation, a fungal-specific genome defence mechanism. This genomic environment for effectors promotes rapid sequence diversification and underpins the evolutionary potential of the fungus to adapt rapidly to novel host-derived constraints., Leptosphaeria maculans is a plant pathogen that causes stem canker of oilseed rape. Rouxel et al. sequence and describe the key features of the L. maculans genome, including partitioning into AT-rich blocks that are enriched in effector genes and transposable elements affected by repeat-induced point mutation.

International audience; Changes in pathogenicity of populations of Leptosphaeria maculans, the cause of blackleg disease of canola and other Brassica spp., have been observed in western Canada. These changes in the population are believed to have resulted from the use of specific resistance (Rlm) genes in Brassica spp., many of which have only recently been identified. We determined the frequency of 10 avirulence alleles for 96 isolates of L. maculans collected between 1997 and 2005 from Alberta, Saskatchewan and Manitoba, Canada from infested canola stubble in field plots or farmers’ fields. Cotyledon interaction phenotypes were scored after inoculation of each isolate on a differential set of Brassica varieties or lines carrying the known resistance genes LepR3 and Rlm1 to Rlm10, except for Rlm8. The avirulence (AvrLm) alleles present in each isolate were inferred from the data. Due to the presence of confounding resistance genes in the host differentials, AvrLm1 and AvrLm2 could not be determined in nine of the isolates, AvrLm6 in two isolates and AvrLepR3 in 49. Based on the number of isolates in which the avirulence genes were confirmed, AvrLm1 was detected in 46.0% and AvrLm9 in 60.4% of the isolates in this collection. A high proportion of isolates carried AvrLm2 (96.6%) and AvrLepR3 (97.9%), and all isolates carried AvrLm6 and AvrLm10. The proportion of L. maculans isolates carrying AvrLm3, AvrLm4, AvrLm5 and AvrLm7 was much lower and varied between 10.4 and 29.2%. In total, 16 races of L. maculans were identified based on 10 avirulence alleles, with seven races accounting for 89.7% of the isolates. Information on the avirulence frequency in the pathogen population will be useful for development of resistance management strategies to control blackleg disease in B. napus oilseed rape in western Canada.

Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1) perform a search for markers via the external software Tandem Repeat Finder, 2) exclude user-defined specific genomic regions, 3) screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4) evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome) using BLAST2.0, 5) design minisatellite primer pairs via the external software Primer3, and 6) check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

Thirty-six single-ascospore isolates of Leptosphaeria maculans were obtained from eight stubbles of diseased Brassica napus plants collected from two locations in France. The isolates were assessed for (i) their sirodesmin PL and phomenoic acid production in vitro; (ii) their esterase profiles following native polyacrylamide gel electrophoresis; and (iii) their protein patterns obtained by isoelectric focusing. Two groups of isolates could be discriminated according to their toxin production, i.e. isolates producing both sirodesmin PL and phomenoic acid, termed Tox+, and those producing neither of these compounds, termed Tox0. The same clear-cut separation between Tox+ and Tox0 isolates was observed when analysing esterase or soluble protein profiles. In the latter case, the mean similarity index between isolates was 46% when belonging to different groups, and 88–92% when belonging to the same group. Esterase patterns were highly polymorphic within the Tox0 group, and factorial correspondence analysis of soluble protein profiles showed that one individual clearly departed from the main cluster. Within the Tox+ group all the isolates displayed the same five esterase bands. Within this group a high degree of homology between protein profiles was also observed. Nevertheless, three major bands could be used to further characterize Tox+ isolates and discriminate them into subgroups. Both Tox0 and Tox+ isolates were present in each of the collection areas, and even on the same stubble.

International audience; Agrobacterium tumefaciens-mediated random insertional mutagenesis was used to investigate pathogenicity determinants in Leptosphaeria maculans. One tagged nonpathogenic mutant, termed m186, is analyzed in detail here. Microscopic analyses of infected plant tissues revealed that m186 is specifically blocked at the invasive growth phase after an unaffected initial penetration stage and is unable to switch to the necrotrophic lifestyle. In addition, m186 exhibits an altered cell wall and seems to be affected in its ability to produce cell-wall-degrading enzymes. The T-DNA insertion occurs in the intergenic region between two head-to-tail genes, leading to a constitutive upregulation of their expression. Complementation experiments showed that only one of these two genes, Lmepi, fully accounts for the mutant phenotype. Bioinformatics and expression analyses along with functional studies suggested that the Lmepi gene encodes for the highly conserved UDP-glucose-4-epimerase, a key enzyme of the Leloir pathway involved in galactose metabolism. For the third time, this study highlights the intimate connection between primary metabolism and pathogenicity in L. maculans. This finding, along with similar data obtained from the related species Stagonospora nodorum, indicates the importance of in planta nutrition for the success of infection of plants by fungi belonging to class Dothideomycete.

International audience; Leptosphaeria maculans is the ascomycete responsible for one of the most damaging diseases of oilseed rape (Brassica napus), stem canker of crucifers. Both avirulence (AvrLm) genes in the fungus and resistance (Rlm) genes in the plant are genetically clustered. Using a map-based cloning strategy, we delineated a 238 kb region containing the AvrLm7 locus. Structural features of the region were reminiscent of those previously found on another chromosome for genomic regions encompassing AvrLm1 and AvrLm6, i.e. GC-equilibrated, gene-rich isochores alternating with AT-rich, recombinationdeficient, gene-poor isochores. These latter corresponded to mosaics of degenerated and truncated transposable elements. AvrLm7 is the only gene located within a 60 kb AT-rich isochore. It induced resistance responses in plants harbouring either Rlm7 or Rlm4, and was thus renamed AvrLm4-7. It encodes a 143-amino-acid cysteine-rich protein, predicted to be secreted, and strongly induced during early stages of plant infection. Sequencing and restriction analyses of AvrLm4–AvrLm7 or avrLm4–AvrLm7 alleles in L. maculans field isolates, and targeted point mutagenesis strongly suggested that one single base mutation, leading to the change of a glycine to an arginine residue, was responsible for the loss of AvrLm4 specificity whereas AvrLm7 recognition was unaltered.

International audience; Three avirulence genes, AvrLm1, AvrLm6, and AvrLm4-7, were recently identified in Leptosphaeria maculans and found to be localized as solo genes within large noncoding, heterochromatin-like regions mainly composed of retrotransposons, truncated and degenerated by repeat-induced point mutation (RIP). The Rlm6 resistance gene has been overcome within 3 years in outdoor experiments in France and, here, we investigate the molecular basis of evolution toward virulence at the AvrLm6 locus. A region of 235 kb was sequenced in a virulent isolate and showed the deletion of AvrLm6 and three divergent mosaics of retrotransposons. AvrLm6 was found to be absent from 66% of 70 virulent isolates, with multiple events of deletion. The sequencing of virulent alleles in 24 isolates revealed a few cases of point mutations that had created stop codons in the sequence. The most frequent mutation events, however, were RIP, leading to the modification of 4 to 9% of the bases compared with the avirulent allele and generating 2 to 4 stop codons. Thus, RIP is described for the first time as an efficient mechanism leading to virulence and the multiple patterns of mutation observed suggest that multiple RIP events could occur independently in a single field population during 1 year.

Leptosphaeria maculans causes blackleg of oilseed rape. Gene-for-gene interactions between race PG3 and Brassica napus cv. Quinta were related to interaction between the fungal avirulence (Avr) gene AvrLm1 and the corresponding resistance gene Rlm1. AvrLm1 isolates were aviru-lent on cvs. Doublol, Vivol, Columbus, and Capitol, and no recombinant phenotypes were observed in the progeny of two AvrLm1 × avrLm1 crosses, suggesting that all of these cultivars may possess Rlm1 or genes displaying the same recognition spectrum, or that a cluster of Avr genes is present at the Avrlm1 locus. In one cross, segregation distortion was observed at the AvrLm1 locus that could be explained by interaction between AvrLm1 and one unlinked deleterious gene, termed Del1. Incompatibility toward cvs. Jet Neuf and Darmor.bzh was governed by a single gene, unlinked to AvrLm1 or Del1. This avirulence gene was termed AvrLm4. Preliminary plant genetic analysis suggested the occurrence of a corresponding dominant resistance gene, termed Rlm4, present in the Quinta line analyzed and linked to Rlm1.

International audience; Random insertional mutagenesis was used to investigate pathogenicity determinants in Leptosphaeria maculans. One tagged nonpathogenic mutant, termed m20, was analysed in detail here. The mutant phenotype was investigated by microscopic analyses of infected plant tissues and in vitro growth assays. Complementation and silencing experiments were used to identify the altered gene. Its function was determined by bioinformatics analyses, cell biology experiments and functional studies. The mutant was blocked at the invasive growth phase after an unaffected initial penetration stage, and displayed a reduced growth rate and an aberrant hyphal morphology in vitro. The T-DNA insertion occurred in the intergenic region between two head-to-tail genes, leading to a complex deregulation of their expression. The unique gene accounting for the mutant phenotype was suggested to be the orthologue of the poorly conserved Saccharomyces cerevisiae gpi15, which encodes for one component of the glycosylphosphatidylinositol (GPI) anchor biosynthesis pathway. Consistent with this predicted function, a functional translational fusion with the green fluorescent protein (GFP) was targeted to the endoplasmic reticulum. Moreover, the mutant exhibited an altered cell wall and addition of glucosamine relieved growth defects. It is concluded that the GPI anchor biosynthetic pathway is required for morphogenesis, cell wall integrity and pathogenicity in Leptosphaeria maculans.

International audience; Stem canker of crucifers is caused by an ascomycete species complex comprising of two main species, Leptosphaeria maculans and L. biglobosa. These are composed of at least seven distinct subclades based on biochemical data or on sequences of internal transcribed spacer (ITS), the mating type MAT1-2 or fragments of actin or β-tubulin genes. In the course of a wide-scale characterization of the race structure of L. maculans from Western Australia, a few isolates from two locations failed to amplify specific sequences of L. maculans, i.e., the mating-type or minisatellite alleles. Based on both pathogenicity tests and ITS size, these isolates were classified as belonging to the L. biglobosa species. Parsimony and distance analyses performed on ITS, actin and β-tubulin sequences revealed that these isolates formed a new L. biglobosa subclade, more related to the Canadian L. biglobosa ‘canadensis’ subclade than to the L. biglobosa ‘australensis’ isolates previously described in Australia (Victoria). They are termed here as L. biglobosa ‘occiaustralensis’. These isolates were mainly recovered from resistant oilseed rape cultivars that included the Brassica rapa sp. sylvestris-derived resistance source, but not from the susceptible cv. Westar. The pathogenicity of L. biglobosa ‘occiaustralensis’ to cotyledons of most oilseed rape genotypes was higher than that of L. biglobosa ‘canadensis’ or L. biglobosa ‘australensis’ isolates.

Resistance to Leptosphaeria maculans was assessed in Brassica napus, B. juncea, B. carinata, B. nigra and progeny issuing from an interspecific cross B. napus × B. juncea, using a cotyledon-inoculation test. In these individual plants, brassilexin accumulation was determined following an abiotic, non-specific, elicitation. All the tested B. napus cultivars were highly susceptible to the parasite and weakly accumulated brassilexin. In contrast, B. juncea, B. carinata, and B. nigra usually displayed a hypersensitive response to the inoculation and accumulated more brassilexin than B. napus. The same correlation between resistance to L. maculans and phytoalexin accumulation was observed in the interspecific hybrid progeny. The cotyledon-inoculation test allowed the discrimination of plants displaying a hypersensitive response to the inoculation from those highly sensitive to the parasite, but intermediate disease severity classes were not usually representative of resistance or susceptibility. In this respect, brassilexin determination allowed differentiation, within a set of plants presenting an intermediate response to the pathogen, of plants with a high (B. juncea-like), and with a weak (B. napus-like) ability to accumulate brassilexin.

Zinc sulphate, when added to the growth medium of Leptosphaeria maculans , decreased the production of the toxin sirodesmin PL by 75%. When supplied as a nutrient to Brassica napus plants, zinc was also able to suppress the toxicity of sirodesmin PL deposited on punctured cotyledons or leaves. Finally, zinc (ZnEDTA, ZnSO 4 and ZnCl 2 ) supplied to B. napus plants grown in the glasshouse, increased partial resistance to the blackleg disease. The treated plants did not escape the disease, but it developemore slowly than in the untreated ones. Plants receiving zinc remained free from any symptoms longer, and developed the crown necrosis responsible for the lodging at a later stage than the controls. Phytoalexin synthesis (mainly brassilexin) was not increased by the treatment, hence the protective effects of zinc on plants is likely to be due to the suppression of the toxic effects of sirodesmin PL in planta.

Map-based cloning of avirulence genes of the AvrLm1-2-6 cluster was recently undertaken in Leptosphaeria maculans and led to the identification of AvrLm1. The ensuing chromosome walk toward AvrLm6 resulted in the delineation of a 562-kb bacterial artificial chromosome (BAC) clone contig in an avirulent isolate. Following sequencing of the contig and sequence comparison with a virulent isolate, four AvrLm6 candidate genes were identified. Complementation of the virulent isolate with the four candidates was performed and one gene was found to fully restore the avirulent phenotype on Rlm6 oilseed rape genotypes. AvrLm6 was found to be located in the same genome context as AvrLm1, because it is a solo gene surrounded by 85 and 48 kb of degenerated repeats on its 5′ and 3′ sides, respectively. AvrLm6 is an orphan gene encoding a small, potentially secreted, cysteine-rich protein. Comparison of AvrLm1 and AvrLm6 expressions by quantitative reverse-transcription polymerase chain reaction revealed that both genes are highly overexpressed during primary leaf infection. Using RNA interference, decreasing expression of AvrLm6 was shown to result in virulence toward Rlm6 genotypes whenever the expression was reduced by more than 60% compared with the wild-type isolate.

Leptosphaeria maculans is a haploid outcrossing ascomycete with a genome size of about 34 Megabases (Mb) which is predicted to have between 10,000 and 12,000 genes. The chromosomes of L. maculans are of a size range (0.7–3.5 Mb) and number (15–16) that can be readily resolved by pulsed field gel electrophoresis. Chromosome length polymorphisms are generated by meiosis giving rise to size differences as high as 57%, in the case of the ribosomal DNA-harbouring chromosome whose size varies between 1.8 and 4.2 Mb. Genetic maps are characterised by linkage groups comprising an accumulation of markers based on retrotransposon sequences. This, along with sequencing of pericentromeric regions and stretches of ORF-rich regions, suggest that the genome of L. maculans consists of a mosaic of GC-equilibrated coding regions with no or few transposons, and of stretches of highly degenerated and truncated retrotransposons, encompassing very few genes. Chromosome length polymorphisms are linked with the loss of dispensable regions. We suggest that the degree of length polymorphism for a particular chromosome correlates to the amount of dispensable retrotransposons, and that some gene-rich chromosomes may be less prone to undergo chromosome length polymorphisms than other chromosomes.

Nine avirulence genes (AvrLm1-AvrLm9) were identified in Leptosphaeria maculans, the causal agent of stem canker of oilseed rape (OSR), combinations of which could theoretically generate up to 512 different races of the fungus. L. maculans displays a high evolutionary potential to adapt to novel resistance genes as illustrated by the Rlm1 breakdown in France, where virulent populations became prevalent within three growing seasons. An improved knowledge of the race structure of the fungal population is therefore needed to ensure a better use of available major resistance genes. The objective of this study was to characterise the L. maculans population structure in France using a large-scale, rationalised sample of isolates. Experimental fields, planted with “trap plants” harbouring no major resistance gene, were sown at 20 locations. Single-pycnidium isolates were collected from leaf lesions that developed in early autumn and 1797 isolates were genotyped at Avr loci. The frequency of AvrLm6 and AvrLm7 was higher than 99%, whereas avrLm2 and avrLm9 alleles were fixed in the population. AvrLm1, AvrLm4, AvrLm5 and AvrLm8 were polymorphic. AvrLm3 isolates were detected at a very low frequency (less than 1%). Only 11 races were identified in France, with one race prevalent, namely Av5-6-7-(8) (i.e. virulent on Rlm1, Rlm2, Rlm3, Rlm4 and Rlm9), representing around 65% of the population. Disparities between the locations sampled were evident at all scales analysed. Some virulent races, such as those harbouring avrLm5, were present before the introduction of the corresponding resistance gene in the commercial OSR crop.

The most common and effective way to control phoma stem canker (blackleg) caused by Leptosphaeria maculans in oilseed rape (Brassica napus) is through the breeding of resistant cultivars. Race specific major genes that mediate resistance from the seedling stage have been identified in B. napus or have been introgressed from related species. Many race specific major genes have been described and some of them are probably identical in B. napus (allotetraploid AACC) and the parental species B. rapa (diploid AA). More work is needed using a set of well-characterised isolates to determine the number of different major resistance genes available. In some B. napus cultivars, there is resistance which is polygenic (mediated by Quantitative Trait Loci) and postulated to be race non-specific. Many of these major genes and Quantitative Trait Loci for resistance to L. maculans have been located on B. napus genetic maps. Genes involved in race specific and polygenic resistance are generally distinct.

International audience

We evaluated the usefulness and robustness of Agrobacterium tumefaciens-mediated transformation (ATMT) as a high-throughput transformation tool for pathogenicity gene discovery in the filamentous phytopathogen Leptosphaeria maculans. Thermal asymmetric interlaced polymerase chain reaction allowed us to amplify the left border (LB) flanking sequence in 135 of 400 transformants analysed, and indicated a high level of preservation of the T-DNA LB. In addition, T-DNA preferentially integrated as a single copy in gene-rich regions of the fungal genome, with a probable bias towards intergenic and/or regulatory regions. A total of 53 transformants out of 1388 (3.8%) showed reproducible pathogenicity defects when inoculated on cotyledons of Brassica napus, with diverse altered phenotypes. Co-segregation of the altered phenotype with the T-DNA integration was observed for 6 of 12 transformants crossed. If extrapolated to the whole collection, this indicates that 1.9% of the collection actually corresponds to tagged pathogenicity mutants. The preferential insertion into gene-rich regions along with the high ratio of tagged mutants renders ATMT a tool of choice for large-scale gene discovery in L. maculans.

Leptosphaeria maculans causes phoma stem canker, the most serious disease of oilseed rape world-wide. Sexual recombination is important in the pathogen life cycle and increases the risk of plant resistance genes being overcome rapidly. Thus, there is a need to develop easy-to-use molecular markers suitable for large-scale population genetic studies. The minisatellite MinLm1, showing six alleles in natural populations, has previously been used as a marker to survey populations. Here, we report the characterization of five new minisatellites (MinLm2–MinLm6), of which four were identified by a systematic search for tandemly repeated polymorphic regions in BAC-end sequencing data from L. maculans. Of 782 BAC-end sequences analysed, 43 possessed putative minisatellite-type repeats and four of these (MinLm3–MinLm6) displayed both consistent PCR amplification and size polymorphism in a collection of L. maculans isolates of diverse origins. Cloning and sequencing of each allele confirmed that polymorphism was due to variation in the repeat number of a core motif ranging from 11 bp (MinLm3) to 51 bp (MinLm4). The number of alleles found for each minisatellite ranged from three (MinLm4) to nine (MinLm2), with eight, five and six for MinLm3, MinLm5 and MinLm6, respectively. MinLm2–MinLm6 are all single locus markers specific to L. maculans and share some common features, such as conservation of core motifs and incomplete direct repeats in the flanking regions. To our knowledge, L. maculans is the first fungal species for which six polymorphic single locus minisatellite markers have been reported.