Search

Soybean protein is widely used as a high-quality plant protein in the food industry, due to its multiple functional properties. However, the high-activity lipoxygenase is easy to catalyze the lipid peroxidation of polyunsaturated fatty acids during the processing of soybean products. A large number of reactive oxygen species and secondary oxidation products can also be produced to further induce protein oxidation. The structure and function of proteins are closely related to the oxidation that is accompanied by the changes in protein solubility, water retention, gel, and emulsification functional properties, thus leading to the processing properties of proteins. Fortunately, microwave processing can be expected to alter the spatial structure of proteins and intermolecular forces. The reaction groups can be exposed to be originally embedded in the protein molecules, resulting in changes in their structure and functional characteristics. Taking the soybean protein oxidized aggregates as the raw materials, this work aims to clarify the effect of microwave treatment time on the functional characteristics and structure, such as solubility, emulsification, and foaming. The protein functional properties were then improved without the use of biochemical reagents, high-pressure, or radiation treatment, thereby expanding the protein applications without the wastes of food resources. An oxidization reaction was constructed with the soy protein and AAPH (2,2'-azobis(2-methylpropionamidine) dihydrochloride). Different irradiation durations (0, 10, 20, 30, 40, 50, 60, and 70 s) of the microwave with a power of 350 W were used to investigate the effect of microwave treatment on the structural characteristics (particle size distribution, turbidity, secondary structure, and microstructure) and processing properties (solubility, water-holding capacity, oil-holding capacity, foaming and foam stability, emulsification and emulsion stability) of oxidized aggregated soy protein. The results showed that the oxidation induced the formation of larger particle size, higher molecular weight, and more compact protein aggregates, which simultaneously damaged the processing properties. Microwave treatment for an appropriate time (<30 s) induced the polarization of protein isolate molecule. There was damage to the non-covalent bond that maintained the protein spatial structure. The protein isolate molecules were partially unfolded to expose the internal hydrophobic residues on the protein surface, thus promoting the formation of the water-air interface. At the same time, the interaction between that extensin molecules formed a more stable interfacial facial mask, thereby improving the foaming, emulsifying, water, and oil-holding properties. Microwave treatment for a long time (>30 s) promoted the further expansion of soy protein isolate molecules, and further exposure inside the hydrophobic and sulfhydryl groups. As such, the larger molecular aggregates were formed between depolymerized protein molecules through noncovalent bonds. There was an increase in the particle size, turbidity, and disordered structure, whereas, a decline in the stability of the interfacial facial mask, thus leading to the decline of functional properties. Consequently, the physical field of microwaves can be expected to modulate the functional properties of soy protein. Specifically, the structural and aggregation behavior can be altered to improve the functional properties of soy protein for the better behavior of soy protein oxidation aggregates using microwaves. The finding can also provide a strong reference for microwave processing in the field of food production. [ABSTRACT FROM AUTHOR]

Copyright of Shipin Kexue/ Food Science is the property of Food Science Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The development of plant-based meat analogs is currently hindered by the beany flavor generated by raw soybean protein and extrusion processing. Wide concern has led to extensive research on the generation and control of this unwanted flavor, as an understanding of its formation in raw protein and extrusion processing and methods through which to control its retention and release are of great significance for obtaining ideal flavor and maximizing food quality. This study examines the formation of beany flavor during extrusion processing as well as the influence of interaction between soybean protein and beany flavor compounds on the retention and release of the undesirable flavor. This paper discusses ways to maximize control over the formation of beany flavor during the drying and storage of raw materials and methods to reduce beany flavor in products by adjusting extrusion parameters. The degree of interaction between soybean protein and beany compounds was found to be dependent on conditions such as heat treatment and ultrasonic treatment. Finally, future research directions are proposed and prospected. This paper thus provides a reference for the control of beany flavor during the processing, storage, and extrusion of soybean raw materials used in the fast-growing plant-based meat analog industry. [ABSTRACT FROM AUTHOR]

A cavitation jet can enhance food proteins' functionalities by regulating solvable oxidized soybean protein accumulates (SOSPI). We investigated the impacts of cavitation jet treatment on the emulsifying, structural and interfacial features of soluble soybean protein oxidation accumulate. Findings have shown that radicals in an oxidative environment not only induce proteins to form insoluble oxidative aggregates with a large particle size and high molecular weight, but also attack the protein side chains to form soluble small molecular weight protein aggregates. Emulsion prepared by SOSPI shows worse interface properties than OSPI. A cavitation jet at a short treating time (<6 min) has been shown to break the core aggregation skeleton of soybean protein insoluble aggregates, and insoluble aggregates into soluble aggregates resulting in an increase of emulsion activity (EAI) and constancy (ESI), and a decrease of interfacial tension from 25.15 to 20.19 mN/m. However, a cavitation jet at a long treating time (>6 min) would cause soluble oxidized aggregates to reaggregate through an anti-parallel intermolecular β-sheet, which resulted in lower EAI and ESI, and a higher interfacial tension (22.44 mN/m). The results showed that suitable cavitation jet treatment could adjust the structural and functional features of SOSPI by targeted regulated transformation between the soluble and insoluble components. [ABSTRACT FROM AUTHOR]

The digestive characteristics of plant proteins are crucial for their nutritional value and utilization efficiency. In this study, an in vitro semi-dynamic digestion model was employed to investigate the gastric digestion process of soybean protein after treatment with phytase. The results found that phytase treatment reduced the phytate content in soybean proteins (22.83 ± 0.09 to 8.72 ± 0.07 mg/g), shifted its isoelectric point towards the alkaline range by 1 pH unit, and significantly improved its solubility at pH 4.0. Particularly for protein sample treated with phytase after acid precipitation, the formation of aggregates during digestion was weakened, resulting in a significantly higher digestion rate compared to untreated SPI, with digestion being at least 15 min faster than SPI. This study provides a strategy for preparing soybean protein with faster digestion and weaker clot-forming ability during digestion, which offers insights for the application of soybean protein in clinical nutrition products and specialized medical foods. [Display omitted] • Low clot-forming and quick-digesting soybean protein was successfully prepared. • The gastric digestion behavior of soybean protein was explored through semi-dynamic digestion. • The protein's isoelectric point was increased by the phytase treatment. • Phytase treatment weakened the protein's ability to aggregate during digestion. [ABSTRACT FROM AUTHOR]

High-pressure homogenization and pH-shifting can be used to modify soybean lipophilic protein (SLP), and to enhance its ability to deliver vitamin B 12. The structural changes of SLP were analyzed by multispectral techniques and the results showed that secondary and tertiary structures of SLP were altered by modification. The modification unfolded the SLP structure, released more free hydrogen ions, and increased positive charge density on the protein surface. Also, the solubility of modified SLP increased by maximum of 34.75 %. Furthermore, molecular docking showed that complexes were formed between SLP and vitamin B 12 mainly through hydrogen bonding and hydrophobic interactions, and the encapsulation rate of modified SLP was maximally increased by 2.3 %. In vitro digestion showed that modified SLP enhanced stability and bioaccessibility of vitamin B 12. This study provides theoretical basis for modification of SLP and effective delivery of bioactive substances. [Display omitted] • High-pressure homogenization and pH-shifting effectively modified SLP. • Co-modification improved SLP structural and functional properties. • Optimal conditions for SLP modification were pH 2, 100 MPa and pH 11, 150 MPa. • Modified SLP improved vitamin B12 activity and bioaccessibility. [ABSTRACT FROM AUTHOR]

• A novel soybean protein-based PLA flame retardant SPPU was synthesized. • 3 wt.% of SPPU enabled PLA to attain a V-0 rating in UL-94 testing. • SPPU accelerated the biodegradation of PLA under compost condition. A novel soy protein-based phosphonate flame retardant (SPPU) was synthesized by a facile two-step method for PLA. And the flame-retardant PLA/SPPU composites were prepared by melt blending. From the results, 3 wt.% of SPPU could increase the limiting oxygen index (LOI) value of PLA from 19.4 % to 23.4 %, and reach V-0 grade in UL-94 vertical combustion test. In the cone calorimetric tests, the heat release rate (HRR) and total heat release (THR) of PLA/SPPU decreased significantly. The results of TG and TG-IR of PLA/SPPU, FTIR and XPS of the char residual showed that SPPU mainly exerted flame retardant effects in the gas phase, accompanied by some effects in condensed phase. Besides, SPPU could accelerate the biodegradation of PLA under compost conditions, which increased the biodegradation rate of PLA from 86.2 % to 88.39 % in 180 days. The addition of appropriate content of SPPU would not cause the deterioration of mechanical properties of PLA, but can improve the toughness of PLA. [Display omitted] [ABSTRACT FROM AUTHOR]

Soybean could greatly improve stability of quinoa milk substitute. However, the key compound and underlying mechanisms remained unclear. Here we showed that soybean protein was the key component for improving quinoa milk substitute stability but not oil or okara. Supplementary level of soybean protein at 0%, 2%, 4%, and 8% of quinoa (w /w) was optimized. Median level at 4% could effectively enhance physical stability, reduce particle size, narrow down particle size distribution, and decrease apparent viscosity of quinoa milk substitute. Microscopic observation further confirmed that soybean protein could prevent phase separation. Besides, soybean protein showed increased surface hydrophobicity. Molecular docking simulated that soybean protein but not quinoa protein, could provide over 10 anchoring points for the most abundant quinoa vanillic acid, through hydrogen bond and Van-der-Waals. These results contribute to improve stability of quinoa based milk substitute, and provide theoretical basis for the interaction of quinoa phenolics and soybean protein. [Display omitted] • Soy protein is the key compound for improving the stability of formulated quinoa milk. • Moderate soy protein (4% of quinoa, w/w) helps to improve the stability of quinoa milk. • Soy protein improves surface hydrophobicity of quinoa milk, implying stronger bound to phenolic. • Soy protein improves quinoa milk stability by stronger bound with vanillic acid than quinoa protein. [ABSTRACT FROM AUTHOR]

• A low-cost and time-saving screening strategy for antioxidant peptides. • We identify five soybean antioxidant peptides: GA, PH, PK, SGP and GVPY. • All five peptides showed strong antioxidant activity against superoxide radicals and H₂O₂-induced damage. • The peptides target and modulate key pathways to mitigating oxidative stress. Antioxidant peptides have the potential to play a crucial role in mitigating and managing a variety range of diseases associated with oxidative stress. Soybean protein is an important source of antioxidant peptides. Here we employ computational and experimental methods to screen and identify five antioxidant peptides (Gly-Ala, Gly-Val-Pro-Tyr, Pro-His, Pro-Lys, and Ser-Gly-Pro) derived from soybean protein, and explore their potential targets and mechanisms of action. All five peptides demonstrated potent antioxidant activity, effectively scavenging superoxide radicals and protecting cells from H₂O₂-induced oxidative damage. These peptides exhibited multi-target effects on pathways implicated in oxidative stress, cardiovascular disease, and cancer. Notably, our results reveal that these peptides can stably interact with the key target nitric oxide synthase (NOS2) through Glu377, a critical residue of NOS2, thereby inhibiting its activity and potentially mitigating oxidative stress and inflammation. This study confirms the function of soybean peptide sequence that has not been previously disclosed, and provides a more specific theoretical basis for the development of natural antioxidant peptides. [Display omitted] [ABSTRACT FROM AUTHOR]

Soybean protein (SP)-based adhesive, as a biomass environmentally friendly adhesive, is an excellent alternative to petroleum derived wood adhesives. However, SP-based adhesives have poor water resistance and are susceptible to mold attack, which limits their application range. In this paper, a synergistic strategy of catechol chemistry and supermolecular host-guest interactions was reported to prepare high strength antibacterial bio-based adhesives. Specifically, the β @SDS with lamellar structure were synthesized by enveloping the hydrophobic cavity of β- cyclodextrin (β -CD) with protein denaturing agent sodium dodecyl sulfate (SDS). The β @SDS was combined with SP and constructed a nano-assemblies based hydrogen bonding network. Meanwhile, plant polyphenol gallic acid (GA) as an adhesive bridge was introduced to the protein system to enhance the cross-linking network and interfacial interactions. Benefiting from the formation of high-density nano-assemblies-based interfacial hydrogen bonding networks, the wet shear strength of SP-GA- β @SDS adhesives reached 0.95 MPa, 163 % higher than that of unmodified SP adhesive. In addition, the polyphenol structure of GA endowed the adhesives with good anti-mold properties. The water resistance and thermal stability of the adhesive were also improved. This novel nano-assemblies based interfacial hydrogen bonding driven strategy provided valuable guidance for producing sustainable high-performance protein adhesives with potential applications in multiple fields. [Display omitted] • The β @SDS was synthesized by enveloping the hydrophobic cavity of β- CD with SDS. • A high-density nano-assemblies based hydrogen bonding network was constructed. • The strong host-guest interactions significantly improved the wet shear strength. • The introduction of GA endowed the adhesive with superior mildew resistance. [ABSTRACT FROM AUTHOR]

In this study, the soybean protein isolate (SPI)–xanthan gum (XG) or carrageenan (CA) W/O/W emulsions for the co-delivery of vitamin B12 and vitamin E were prepared. The effects of XG and CA concentrations on the physicochemical properties and digestive characteristics of the emulsions were also investigated. The addition of XG and CA improved the SPI aggregation and increased its electrostatic repulsion so that more SPI was adsorbed at the phase interface. The emulsifying activity index and emulsifying stability index increased to 24.09 (XG 0.4%) and 14.00 (CA 0.5%) and 151.08 (XG 0.4%) and 135.34 (CA 0.5%), respectively. The adsorbed protein content increased to 88.90% (XG 0.4%) and 88.23% (CA 0.5%), respectively. Moreover, the encapsulation efficiencies of vitamin B12 and vitamin E were increased to 86.72% (XG 0.4%) and 86.47 (CA 0.5%) and 86.31% (XG 0.4%) and 85.78% (CA 0.5%), respectively. The bioaccessibility of vitamin B12 and vitamin E increased to 73.53% (XG 0.4%) and 71.32% (CA 0.5%) and 68.86% (XG 0.4%) and 68.74% (CA 0.5%). The best properties of the emulsions were obtained at a 0.4% concentration of XG and 0.5% of CA. This study offers a novel system for delivering bioactive substances, which is favorable for the advancement of food with delivery capability in food processing.

Bioconversion of the complex carbohydrates present in lignocellulosic biomass into simple sugars, in order to obtain biofuels and bio-based products, is still limited by the low performance of the enzymatic saccharification reaction and the high cost of cellulolytic enzymes. Low-cost additives such as soybean protein can reduce the unproductive adsorption of cellulases onto lignin, increasing conversion rates and reducing enzyme losses. Here, investigation was made of the effects of different soybean protein fractions, extracted in-house, on the enzymatic saccharification of hydrothermally pretreated sugarcane bagasse. The glucose released during biomass saccharification increased by up to 76% in the presence of the in-house extracted soybean protein, compared to the control (without additive). A remarkable finding was that the technique allowed the enzyme loading to be decreased four-fold. The results suggested that the alkali-extracted proteins presented high surface hydrophobicity, which enhanced their interaction with lignin and reduced the unproductive binding of cellulases. Among the main soybean protein fractions, glycinin had the best effect in improving saccharification, which could have been due to its higher hydrophobicity. Hence, in-house extracted soybean proteins seem to be interesting alternative additives capable of increasing the lignocellulosic biomass conversion efficiency in future biorefineries. [ABSTRACT FROM AUTHOR]

Summary: The objective of this study was to investigate the effects of cavitation jets on the structural, emulsifying and rheological properties of soybean protein oxidation aggregates. The results showed that oxidation might induce the formation of larger particle sizes and molecular weight protein aggregates and the decrease of emulsifying properties. The cavitation jet at a short treatment time (<6 min) broke down the disulphide bonds and protein skeleton structures, which reduced the aggregate sizes and molecular weights and increased the emulsion activities, emulsion stabilities, apparent viscosity and elastic modulus. The cavitation jet at a long treatment time (>6 min) supported disulphide bond formation among molecules by intermolecular interactions to form protein aggregates. In addition, the skeleton structure showed cross‐linking aggregation. This increased the particle sizes and molecular weights and reduced the emulsion properties, consistency index K and elastic modulus. The findings showed that a cavitation jet at 6 min on oxidised aggregates of soybean protein might enhance the structural, emulsifying and rheological characteristics for the industry. [ABSTRACT FROM AUTHOR]

This study was performed to determine the crosslinking formed by proanthocyanidins (PC) with respect to IgE binding capacities, functionality, structure and composition of soybean protein (SPI) following the alkali treatment at 60–100 °C. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE) showed the formation of >180 kDa polymers, resulting from the formation of SPI-PC conjugates and protein cross-links. Structural analyses demonstrated that SPI-PC conjugates exhibited structural changes to unfold proteins and increase molecular flexibility. Liquid chromatography coupled to tandem mass spectrometry (LC/MS-MS) showed a decrease in unique protein and peptide numbers as well as major allergen and dominant epitopes abundance. When SPI was treated with PC under the alkali treatment at 80 °C, it exhibited a maximum reduction (68.8 %) in the immunoglobulin E (IgE) binding capacity and a maximum increase in DPPH radical scavenging activities (6.11-fold), ABTS + radical scavenging activities (4.80-fold), foaming stability (6.1 %) and emulsifying activity (27.3 %), compared to the control SPI. Overall, this study demonstrates that alkali treatment at 60–100 °C to form SPI-PC conjugates has potential applications for producing hypoallergenic soybean products with the desired functionality, most especially from alkali treatment at 80 °C. Moreover, the addition of PC pronouncedly alleviates the undesirable functional properties in heated SPI. • Alkali treatment at 60–100 °C accelerated the formation of SPI-PC conjugates. • Antioxidant properties and emulsifying stability were increased in conjugates. • Foaming properties and emulsifying activity varied from different conjugates. • SPI-PC conjugates exhibited a decrease in the IgE binding capacity. • Alkali treatment at 80 °C to form hypoallergenic conjugates is promising. [ABSTRACT FROM AUTHOR]

At present, the changes in fibrous structure of plant proteins improved by polysaccharides during high-moisture extrusion cooking (HMEC) are still unclear. In this study, different additions (1, 2, 3, 4, and 5%) of sodium alginate (SA), xanthan gum (XG), and maltodextrin (MD) were used in the preparation of organised protein products based on soybean protein and wheat protein under high moisture extrusion conditions. It was revealed that SA-4%, XG-2%, and MD-2% (w/w) significantly enhanced the structural and physical properties of the fibres. The polysaccharides increased the water distribution of extrudates by enhancing protein-water interactions through hydrogen bonding, with MD-2% having the strongest ability to trap free water. The mechanism by which the polysaccharides improved the fibrous structure of extrudates involved the reorganization of molten proteins from the die head region to the cooling region, formation of new molecular bonds and enhancement of thermal stability. XG-2% significantly increased the β-sheet structure in the molten region (48.9 ± 1.35%) and showed the best thermal stability. Overall, SA-4% was able to better maintain the molecular bonding transformation and strong water absorption, which stabilised the protein conformation and formed the highest fibrous degree (2.1 ± 0.03). This suggests that the properties of the three polysaccharides can be used as modifiers of high water extruded plant proteins to improve the extruded materiality, functional and nutritional properties.

This study aimed to discover the quantitative trait loci (QTL) associated with a high seed protein content in soybean and unravel the potential candidate genes. We developed two recombinant inbred line populations: YS and SI, by crossing Saedanbaek (high protein) with YS2035-B-91-1-B-1 (low protein) and Saedanbaek with Ilmi (low protein), respectively, and evaluated the protein content for three consecutive years. Using single-nucleotide polymorphism (SNP)-marker-based linkage maps, four QTLs were located on chromosomes 15, 18, and 20 with high logarithm of odds values (5.9–55.0), contributing 5.5–66.0% phenotypic variance. In all three experimental years, qPSD20-1 and qPSD20-2 were stable and identified in overlapping positions in the YS and SI populations, respectively. Additionally, novel QTLs were identified on chromosomes 15 and 18. Considering the allelic sequence variation between parental lines, 28 annotated genes related to soybean seed protein—including starch, lipid, and fatty acid biosynthesis-related genes—were identified within the QTL regions. These genes could potentially affect protein accumulation during seed development, as well as sucrose and oil metabolism. Overall, this study offers insights into the genetic mechanisms underlying a high soybean protein content. The identified potential candidate genes can aid marker-assisted selection for developing soybean lines with an increased protein content.

Increasing market demand for sustainable, environmentally friendly edible film materials has called for the development of new customizable production methods utilizing emerging technologies such as 3D printing. We hereby report a new method to generate functional edible soy protein isolate films prepared from three types of soybeans (AR‐R11‐7999, MO‐S17‐17168, and MO‐S17‐19874R) using an innovative 3D printing technology. The protein contents in AR‐R11‐7999, MO‐S17‐17168, and MO‐S17‐19874R soybean meals and their corresponding protein isolates were 40.0, 39.1, and 39.9; and 84.5, 84.7, and 87.3 % (w/w, dry basis), respectively. Response surface methodology was used to maximize the tensile and puncture strength and minimize the thickness of the 3D‐printed edible films using protein concentration, plasticizer concentration (glycerol), and drying time as the independent variables. The optimized film production conditions were determined as soy protein concentration: 8.91%, plasticizer concentration: 3.00%, and drying time: 3.98 h with a desirability value of 0.7428. The optimized conditions were then successfully verified with the original soybean lot with a nonsignificant difference in physical properties. At the optimized conditions, the 3D‐printed edible films using three soybean lots revealed: 0.108–0.114 mm thickness; 14.79–16.07 MPa tensile strength; 6.97–8.20 N puncture strength; 90.81–91.53, −1.89 to −1.31, and 14.85–17.25 were color parameters L*, a*, and b*, respectively; 1.22–1.36 g/cm3 density; and 104.4–105.7% elongation at break ratio (%). Practical Application: Edible soy protein films produced by an extrusion‐based 3D printing approach are highly customizable and precise, and could be produced at an industrial scale. This newly produced environment‐friendly soy protein‐based edible film can serve as an alternate packaging to synthetic plastics and reduce the environmental landfill problem while adding value to soybean produced in the mid‐south United States. [ABSTRACT FROM AUTHOR]

This study investigated the changes in the structure and properties of soybean protein after hydrolysis using two types of hybrid nanoflowers (alcalase@Cu3(PO4)2•3H2O (ACHNs) and dispase@Cu3(PO4)2•3H2O (DCHNs)) and examined the basic properties and oxidative stability of hydrolyzed soybean protein emulsions. The formations of the two hybrid nanoflowers were first determined using a scanning electron microscope, transmission electron microscope, and Fourier infrared spectroscopy. The structure and functional properties of soybean protein treated with hybrid nanoflowers were then characterized. The results indicated that the degree of hydrolysis (DH) of the ACHNs hydrolysates was higher than that of the DCHNs for an identical reaction time. Soybean protein hydrolysates treated with two hybrid nanoflowers showed different fluorescence and circular dichroism spectra. The solubility of the hydrolysates was significantly higher (p < 0.05) than that of the soybean protein (SPI) at all pH values tested (2.0–10.0)*: at the same pH value, the maximum solubility of ACHNs hydrolysates and DCHNs hydrolysates was increased by 46.2% and 42.2%, respectively. In addition, the ACHNs hydrolysates showed the highest antioxidant activity (DPPH IC50 = 0.553 ± 0.009 mg/mL, ABTS IC50 = 0.219 ± 0.019 mg/mL, and Fe2+ chelating activity IC50 = 40.947 ± 3.685 μg/mL). The emulsifying activity index of ACHNs and DCHNs hydrolysates reached its maximum after hydrolysis for 120 min at 61.38 ± 0.025 m2/g and 54.73 ± 0.75 m2/g, respectively. It was concluded that the two hydrolysates have better solubility and antioxidant properties, which provides a theoretical basis for SPI product development. More importantly, the basic properties and oxidative stability of the soybean-protein-hydrolysates oil-in-water emulsions were improved. These results show the importance of proteins hydrolyzed by hybrid nanoflowers as emulsifiers and antioxidants in the food and pharmaceutical industry. [ABSTRACT FROM AUTHOR]

BACKGROUND: To clarify the role of the extension region on the structure–functional relationship of the α‐subunit of β‐conglycinin, α‐subunit and its segment of the core region (αc‐subunit) were expressed via an Escherichia coli system. Their physicochemical properties were compared under acid, neutral or alkaline conditions (pH 4.0, 7.0, and 8.0) and high or low ionic strength (μ = 0.05 and 0.5), respectively. RESULTS: The results showed that the extension region contributed to increasing thermal stability, especially at low ionic strength under acidic and neutral conditions. The extension region stabilized the α‐subunit with high solubility, low turbidity, and small particle size under neutral and alkaline conditions, whereas these impacts were suppressed at a high ionic strength and acidic conditions. Surface hydrophobicity of the α‐subunit decreased under acidic and alkaline conditions without being interfered with by ionic strength. CONCLUSION: It can be concluded that the extension region played different roles under different pH and ionic strength conditions. These factors should be specified carefully and speculated individually to explore the more detailed and profound nature of β‐conglycinin at the submolecular level. The results could benefit a better understanding of the relationship between domain structure and functions of soybean protein. © 2022 Society of Chemical Industry. [ABSTRACT FROM AUTHOR]

Copyright of Shipin Kexue/ Food Science is the property of Food Science Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

It is crucial to address the dietary problems of hypertensive patients. The effect and mechanism of different contents of soybean protein on cooking quality and angiotensin-converting enzyme (ACE) inhibitory action in the extruded rice were firstly investigated. The results showed that the extruded rice with soybean protein possessed the higher taste value (90.32 ± 2.31), hardness (2.65 ± 0.01 g), and good pasting quality (p ≤ 0.05). Meanwhile, the soybean protein notably retarded the starch digestibility; the sample with 6% soybean protein showed the fewest rapidly digestible starch (RDS) content (78.82 ± 0.01 mg g−1) and the most slowly digestible starch (SDS) content (8.97 ± 0.45 mg g−1). Importantly, the ACE inhibition rate improved from 17.09 ± 0.01% to 74.02 ± 0.65% in the 6% soybean protein sample because of the production of peptides. The peptide composition of samples were compared, which showed that the effective ACE-inhibitory peptides usually contain 2~20 amino acids, and Pro, Leu, Ile, Val, Phe, and Ala were the main components. Overall, moderate soybean protein would give a good quality and lower ACE activity in extruded food. [ABSTRACT FROM AUTHOR]

Soybean flour has received increasing attention because of its unique nutritional properties. However, potential allergies to soy protein limit its application. This study aims to investigate the impact of various concentrations of γ-aminobutyric acid (GABA) on the secondary structure, foaming properties, and antigenicity of soybean protein obtained from soybean flour under thermal sterilisation. GABA increased the content of α-helix, reduced β-turn and random coil in soybean protein. The results indicated that after heating treatment, the concentration of GABA significantly affects the spatial conformation of soybean protein isolates (SPI). When the concentration of GABA was 0.40% (w/v), the particle size, zeta potential, and surface hydrophobicity of the SPI were the lowest, whereas the disulfide bond content was the highest. Multi-spectral technologies indicated that adding 0.40% GABA could assemble the system in a relatively stable manner. Moreover, the rigid structure of the protein was destroyed. This structural change significantly reduced the foaming and allergy of the protein. Adding 0.40% GABA could reduce the β-conglycinin antigen concentration from 24.26 mg/mL to 4.43 mg/mL. This study provides new insights into the production of new low-allergenic soybean flour. Additionally, it offers an assurance for the safe consumption of soybeans by individuals with allergies. [Display omitted] • The GABA significantly affected the conformation of the SPI. • SPI–GABA complexes had better solubility and higher antioxidant activity. • The interaction of SPI and GABA reduced the foam properties of SPI. • The GABA reduced the β-conglycinin antigen levels from 24.26 to 4.43 mg/mL. • The GABA reduced the soy glycinin antigen levels from 22.12 to 4.39 mg/mL. [ABSTRACT FROM AUTHOR]

Soybean (Glycine max L.) is an important food-grade strategic crop worldwide because of its high seed protein and oil contents. Due to the negative correlation between seed protein and oil percentage, there is a dire need to detect reliable quantitative trait loci (QTL) underlying these traits in order to be used in marker-assisted selection (MAS) programs. Genome-wide association study (GWAS) is one of the most common genetic approaches that is regularly used for detecting QTL associated with quantitative traits. However, the current approaches are mainly focused on estimating the main effects of QTL, and, therefore, a substantial statistical improvement in GWAS is required to detect associated QTL considering their interactions with other QTL as well. This study aimed to compare the support vector regression (SVR) algorithm as a common machine learning method to fixed and random model circulating probability unification (FarmCPU), a common conventional GWAS method in detecting relevant QTL associated with soybean seed quality traits such as protein, oil, and 100-seed weight using 227 soybean genotypes. The results showed a significant negative correlation between soybean seed protein and oil concentrations, with heritability values of 0.69 and 0.67, respectively. In addition, SVR-mediated GWAS was able to identify more relevant QTL underlying the target traits than the FarmCPU method. Our findings demonstrate the potential use of machine learning algorithms in GWAS to detect durable QTL associated with soybean seed quality traits suitable for genomic-based breeding approaches. This study provides new insights into improving the accuracy and efficiency of GWAS and highlights the significance of using advanced computational methods in crop breeding research.

Plant protein-based hydrogels have enormous potential applications, and their great functional properties and sustainability are considered the best alternatives to reduce the environmental burden of animal protein resources. However, heat-induced plant protein-based hydrogels often exhibit a rough and opaque network structure, limiting their application in various scenarios where gel transparency is crucial. In this study, transparent hydrogels were successfully prepared using deamidated soy protein isolate (SPI) modified by protein-glutaminase (PG). Compared with the non-transparent SPI hydrogel, the deamidated SPI hydrogel possessed a soft and intricate chain-like network, exhibiting excellent light transmittance and certain mechanical strength. The results indicated that deamidation treatment unfolded the structure of SPI, shifting the protein conformation from ordered to disordered, and leading to the transformation of large insoluble protein aggregates into small soluble aggregates. In addition, deamidation treatment effectively inhibited the thermal aggregation rate and aggregation counts of SPI. This was attributed to the conversion of glutamine to glutamic acid, which enhanced the electrostatic repulsion between protein molecules. The present work offers a promising approach for preparing highly transparent plant protein-based hydrogels, which are conducive to developing the next generation of plant protein-based functional materials to replace existing petroleum-based materials. [Display omitted] • Transparent soy protein hydrogel is successfully prepared without the addition of any gelling agents. • The deamidation reaction depolymerizes the insoluble soy protein aggregates. • Deamidation treatment inhibits the thermal aggregation of soybean protein. • Deamidated soy protein exhibits a more flexible gel network structure. [ABSTRACT FROM AUTHOR]

High‐intensity ultrasound is widely used to modify the functional properties of macromolecules (proteins, polysaccharides, etc.) and to expand their range of potential applications. This work is aimed at studying the effects of ultrasound treatments on the composition of different soybean okara samples and their potential as an emulsifying agent. Defatted solvent‐free soybean flour (DSF) was extracted by adjusting dispersion to pH 9.0. Insoluble residues obtained after centrifugation were dried, and an unsonicated okara sample (UOK) was obtained. Furthermore, the soybean flour dispersion was subjected to treatment in a probe‐type ultrasonic homogeniser before or after the alkaline extraction process, thus producing SOK and OKS samples, respectively. The sonication process generated compositional and structural changes in okara soybeans. SOK had higher yield and protein content than UOK and OKS due to the insolubilisation of the glycinin (11S) fraction of soybean storage proteins. Due to these characteristics, the SOK sample showed the best emulsifying activity. [ABSTRACT FROM AUTHOR]

Background: Molecular markers have played and will continue to play a major role in the genetic characterization and improvement of soybeans. They have helped identify major loci for tolerance to abiotic stressors, disease resistance, herbicide resistance, soybean seed quality traits, and yield. However, most yield quantitative trait loci (QTL) are specific to a certain population, and the genetic variation found in the specific bi-parental population is not always shared in other populations. A major objective in soybean breeding is to develop high yielding cultivars. Unfortunately, soybean seed yield, as well as protein and oil content, are complex quantitative traits to characterize from the phenotypic and genotypic perspectives. The objectives of this study are to detect soybean genomic regions that increase protein content, while maintaining oil content and seed yield and to successfully identify soybean QTL associated with these seed quality traits. Methods and results: To achieve these objectives, data from the 138 recombinant inbred lines grown in six environments were used to perform QTL detection analyses in search of significant genomic regions affecting soybean seed protein, oil, and yield. Conclusions: A total of 21 QTL were successfully identified for yield, protein, oil, methionine, threonine, lodging, maturity, and meal. Knowledge of their locations and flanking markers will aid in marker assisted selection for plant breeders. This will lead to a more valuable soybean for farmers, processors, and animal nutritionists. [ABSTRACT FROM AUTHOR]

Oxidative attack leads to the oxidative aggregation and structural and functional feature weakening of soybean protein. We aimed to investigate the impact of ultrasonic treatment (UT) with different intensities on the structure, emulsifying features and interfacial features of oxidized soybean protein aggregates (OSPI). The results showed that oxidative treatment could disrupt the native soy protein (SPI) structure by promoting the formation of oxidized aggregates with β1-sheet structures through hydrophobic interactions. These changes led to a decrease in the solubility, emulsification ability and interfacial activity of soybean protein. After low-power ultrasound (100 W, 200 W) treatment, the relative contents of β1-sheets, β2-sheets, random coils, and disulfide bonds of the OSPI increased while the surface hydrophobicity, absolute ζ-potential value and free sulfhydryl content decreased. Moreover, protein aggregates with larger particle sizes and poor solubility were formed. The emulsions prepared using the OSPI showed bridging flocculation and decreased protein adsorption and interfacial tension. After applying medium-power ultrasound (300 W, 400 W, and 500 W) treatments, the OSPI solubility increased and particle size decreased. The α-helix and β-turn contents, surface hydrophobicity and absolute ζ-potential value increased, the structure unfolded, and the disulfide bond content decreased. These changes improved the emulsification activity and emulsion state of the OSPI and increased the protein adsorption capacity and interfacial tension of the emulsion. However, after a high-power ultrasound (600 W) treatment, the OSPI showed a tendency to reaggregate, which had a certain negative effect on the emulsification activity and interfacial activity. The results showed that UT at an appropriate power could depolymerize OSPI and improve the emulsification and interfacial activity of soybean protein.

The experiment aimed to determine the effect of substituting 50% of soy protein for lupin protein in feed mixtures intended for the nutrition of high-yield Isa Brown laying hens, on selected biochemical blood plasma indicators. The trial was designed as a long-lasting feeding experiment (51 weeks) and involved a total of 180 hens divided in three experimental groups (control group C and experimental groups WLS and WDLS). At the end of the laying cycle, blood samples were taken from the hens by puncture of the vena basilica and subsequently, the required blood plasma indicators were analysed in the laboratory. The results demonstrated that the long-term feeding of white lupin (variety Zulika) did not affect the molar concentration of plasma inorganic phosphorus (P), magnesium (Mg), sodium (Na), potassium (K), chloride (Cl), uric acid (UAC) and the activity of alanine aminotransferase (AST). By contrast, the substitution of soy protein for lupin protein in the diets of the experimental groups of laying hens led to the statistically significant (p ≤ .05) decrease of total plasma protein (TP), total cholesterol (Chol), calcium (Ca) and triacylglycerides (TAG) and to an increase (p ≤ .05) of alkaline phosphatase activity (ALP).Highlights Replacement of soya protein with white lupin protein reduced cholesterol and triacylglycerides in blood plasma Feedstuff including white lupin protein did not affect negatively the health status of the layers

Copyright of Shipin Kexue/ Food Science is the property of Food Science Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Soybean protein and peptides have the potential to promote the growth of Lactobacillus, but the mechanisms involved are not well understood. The purpose of this study is to investigate differentially expressed genes (DEGs) of Limosilactobacillus reuteri (L. reuteri) LR08 responding to soybean protein and peptides using transcriptome. The results showed that both digested protein (dpro) and digested peptides (dpep) could enhance a purine biosynthesis pathway which could provide more nucleic acid and ATP for bacteria growth. Moreover, dpep could be used instead of dpro to promote the ABC transporters, especially the genes involved in the transportation of various amino acids. Interestingly, dpro and dpep played opposite roles in modulating DEGs from the acc and fab gene families which participate in fatty acid biosynthesis. These not only provide a new direction for developing nitrogen-sourced prebiotics in the food industry but could also help us to understand the fundamental mechanism of the effects of dpro and dpep on their growth and metabolisms and provides relevant evidence for further investigation. [ABSTRACT FROM AUTHOR]

In this study, an obese C57BL/6J mice model was induced to compare the effect of different high protein diets (soybean protein and pork protein) on obesity. The obese mice were randomly divided into four groups: natural recovery (NR), high-fat diet (HF), high soybean protein diet (HSP), and high pork protein diet (HPP) groups. After 12 weeks of dietary intervention, the obesity-related indexes of mice were measured, such as body weight, fat coefficients, blood lipid indexes and so on. Results showed that HSP and HPP decreased the weight and fat coefficients of mice, the levels of serum total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C) and leptin (p < 0.05). Soybean protein was shown to be more effective in reducing the weight and fat mass of obese mice, although pork protein seemed to have a better effect on regulating serum triglyceride (TG). In addition, the two high protein diets both alleviated hepatic fat deposition effectively. Furthermore, HPP and HSP decreased the expression of hepatic peroxisome proliferator-activated receptor-γ (PPAR-γ) and increased the protein expression of phosphorylated AMP-activated protein kinase (pAMPK), phosphorylated acetyl CoA carboxylase (pACC), and uncoupling protein 2 (UCP2) (p < 0.05). In conclusion, the study shows that high protein diets based on both pork protein and soybean protein alleviated abdominal obesity in mice effectively by regulating lipid metabolism, probably via the UCP2-AMPK-ACC signaling pathway. [ABSTRACT FROM AUTHOR]

In this study, soybean protein nanoparticles (SPN) modified poly(hydroxybutyrate) (PHB) electrospun nanofiber scaffold is fabricated by a facile two-step method combination of PHB electrospinning and SPN evaporation-induced self-assembly. The surface characteristics, structure and properties are investigated by SEM, EDS, XPS, FTIR, XRD, DMA, WCA, tensile test and water uptake capacity measurements. To characterize biodegradability and cytocompatibility, biodegradation tests are performed in simulated body fluid with and without lysozyme and cell cultures are carried out using NIH3T3 mouse fibroblast cells by in vitro studies. The as-obtained SPN-modified PHB nanofiber scaffold presents better cytocompatibility and is more suitable for biomedical applications. [ABSTRACT FROM AUTHOR]

BACKGROUND Bioactive protein hydrolysates and peptides are believed to help counteract and ameliorate physical fatigue. Fermented soybean protein peptides (FSPPs) were prepared by protease hydrolysis and microbial fermentation. The present study aimed to evaluate the anti‐fatigue properties of FSPPs. RESULTS: The forced swimming time in the FSPP group was 35.78% longer than the control group, the oxygen‐resistant survival time of the FSPP group was significantly prolonged and the prolongation rate was 31.00%. In addition, FSPPs decreased the lactic acid (LD), blood urea nitrogen (BUN) and creatine kinase (CK) concentration by 27.47%, 25.93% and 21.70%, respectively, after treatment, while increasing the levels of liver glycogen and muscle glycogen by 93.35% and 67.31%, respectively. FSPPs can significantly increase gut microbiota diversity and regulate the species richness of gut microbiota. The results of real‐time polymerase chain reaction (RT‐PCR) and western blotting showed that FSPPs activate p‐AMPK/PGC1‐α and PI3K/Akt/mTOR signaling pathways. CONCLUSION: These results indicate that treatment with FSPPs induces anti‐fatigue effects, which may be due to the mediating muscle protein synthesis and participation in skeletal muscle hypertrophy, providing energy for muscle cells. FSPPs may have potential applications in the food industry as functional material additives. © 2021 Society of Chemical Industry. [ABSTRACT FROM AUTHOR]

Copyright of Shipin Kexue/ Food Science is the property of Food Science Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Soybean [ Glycine max (L.) Merr. ] seeds have an amino acid profile that provides excellent viability as a food and feed protein source. However, low concentrations of an essential amino acid, methionine, limit the nutritional utility of soybean protein. The objectives of this study were to identify genomic associations and evaluate the potential for genomic selection (GS) for methionine content in soybean seeds. We performed a genome-wide association study (GWAS) that utilized 311 soybean accessions from maturity groups IV and V grown in three locations in 2018 and 2019. A total of 35,570 single nucleotide polymorphisms (SNPs) were used to identify genomic associations with proteinogenic methionine content that was quantified by high-performance liquid chromatography (HPLC). Across four environments, 23 novel SNPs were identified as being associated with methionine content. The strongest associations were found on chromosomes 3 (ss715586112, ss715586120, ss715586126, ss715586203, and ss715586204), 8 (ss715599541 and ss715599547) and 16 (ss715625009). Several gene models were recognized within proximity to these SNPs, such as a leucine-rich repeat protein kinase and a serine/threonine protein kinase. Identification of these linked SNPs should help soybean breeders to improve protein quality in soybean seeds. GS was evaluated using k-fold cross validation within each environment with two SNP sets, the complete 35,570 set and a subset of 248 SNPs determined to be associated with methionine through GWAS. Average prediction accuracy (r 2) was highest using the SNP subset ranging from 0.45 to 0.62, which was a significant improvement from the complete set accuracy that ranged from 0.03 to 0.27. This indicated that GS utilizing a significant subset of SNPs may be a viable tool for soybean breeders seeking to improve methionine content. [ABSTRACT FROM AUTHOR]

The aim of this study was preparation of a soybean protein hydrolyzate with thrombin inhibitory activity and isolation, identification, and characterization of the active peptides from the hydrolyzate. In this study, a soybean protein hydrolyzate with the thrombin inhibiting IC50 value of 2.78 mg/mL was prepared under the improved pepsin hydrolysis condition, which exhibited the highest thrombin inhibitory activity in these soybean protein-derived hydrolyzates. A novel nonapeptide FFPDIPKIK with the IC50 value of 2.36 mM was screened from the hydrolyzate by in silico methods. The kinetic studies and molecular docking showed that the nonapeptide adopted a mixed-type mode to inhibit thrombin and bound with thrombin with several hydrogen bonds and hydrophobic interactions. The nonapeptide was partially digested using the in vitro digestion model, and its truncated peptides had comparable thrombin inhibitory activity. The results suggested that soybean protein hydrolyzate could be exploited as a functional food ingredient against coagulation. [ABSTRACT FROM AUTHOR]

Subjective reporting of food intake can be unreliable. No objective method is available to distinguish between diets differing in protein type. To address this gap, a secondary analysis of a randomized controlled cross-over feeding trial was conducted. Assessed were fasting plasma metabolite profiles and their associations with cardiometabolic risk factors (CMRFs). Hypercholesterolemic post-menopausal women (N = 11) were provided with diets containing predominantly animal protein (AP) and soy protein (SP). Untargeted metabolomics were used to determine the plasma metabolite profiles at the end of each diet phase. Concentrations of identified metabolites (N = 829) were compared using paired t-tests adjusted for false discovery rate, partial least square-discrimination analysis (PLS-DA) and receiver operating characteristics (ROC). Among the identified metabolites, 58 differed significantly between the AP and SP diets; the majority were phospholipids (n = 36), then amino acids (n = 10), xenobiotics (n = 7), vitamin/vitamin-related (n = 3) and lipids (n = 2). Of the top 10 metabolites, amino acid-derived metabolites, phospholipids and xenobiotics comprised the main categories differing due to dietary protein type. ROC curves confirmed that the top 10 metabolites were potential discriminating biomarkers for AP- and SP-rich diets. In conclusion, amino acid-derived metabolites, phosphatidylethanolamine-derived metabolites and isoflavones were identified as potential metabolite biomarkers distinguishing between dietary protein type. [ABSTRACT FROM AUTHOR]

Soybean [Glycine max (L.) Merr.] seeds have an amino acid profile that provides excellent viability as a food and feed protein source. However, low concentrations of an essential amino acid, methionine, limit the nutritional utility of soybean protein. The objectives of this study were to identify genomic associations and evaluate the potential for genomic selection (GS) for methionine content in soybean seeds. We performed a genome-wide association study (GWAS) that utilized 311 soybean accessions from maturity groups IV and V grown in three locations in 2018 and 2019. A total of 35,570 single nucleotide polymorphisms (SNPs) were used to identify genomic associations with proteinogenic methionine content that was quantified by high-performance liquid chromatography (HPLC). Across four environments, 23 novel SNPs were identified as being associated with methionine content. The strongest associations were found on chromosomes 3 (ss715586112, ss715586120, ss715586126, ss715586203, and ss715586204), 8 (ss715599541 and ss715599547) and 16 (ss715625009). Several gene models were recognized within proximity to these SNPs, such as a leucine-rich repeat protein kinase and a serine/threonine protein kinase. Identification of these linked SNPs should help soybean breeders to improve protein quality in soybean seeds. GS was evaluated using k-fold cross validation within each environment with two SNP sets, the complete 35,570 set and a subset of 248 SNPs determined to be associated with methionine through GWAS. Average prediction accuracy (r2) was highest using the SNP subset ranging from 0.45 to 0.62, which was a significant improvement from the complete set accuracy that ranged from 0.03 to 0.27. This indicated that GS utilizing a significant subset of SNPs may be a viable tool for soybean breeders seeking to improve methionine content.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties., (© 2024 John Wiley & Sons Ltd.)

Copyright of Food Research & Development is the property of Food Research & Development Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Protein allergens is a health risk for consumption of soybeans. To understand allerginicity mechanism, T cell epitopes of 7 soybean allergens were predicted and screened by abilities to induce cytokine interleukin (IL) 4. The relationships among amino acid composition, properties, allergenicity, and pepsin hydrolysis sites were analyzed. Among the 138 T cell epitopes identified, YIKDVFRVIPSEVLS, KDVFRVIPSEVLSNS, DVFRVIPSEVLSNSY of Gly m 6.0501 (P04347), and AKADALFKAIEAYLL, ADALFKAIEAYLLAH of Gly m 4.0101 (P26987) were the most possible epitope candidates. In T cell epitopes pattern, the frequencies of amino acids Q, D, E, P, and G decreased, while F, I, N, V, K, H, A, L, and S increased. Hydrophobic residues at positions p1 and p2 and positively charged residues in positions p13 might contribute to allergenicity. Most of epitopes could be hydrolyzed by pepsin into small polypeptides within 12 residues length, and the anti‐digestive epitope regions contained I, V, S, N, and Q residues. T cell epitopes EEQRQQEGVIVELSK from Gly m 5.03 (P25974) showed resistance to pepsin hydrolysis and would cause a higher Th2 cell response. This research provides basis for the development of hypoallergenic soybean products in the soybean industry as well as for the immunotherapy design for protein allergy. [ABSTRACT FROM AUTHOR]

Current studies regarding the effect of different nitrogen sources on gut microbiota have thus far disregarded the ability of probiotics and coliforms to compete for protein. This study aimed to investigate the differences in the utilization of soybean protein (SPro) and its derived peptides (SPep) by the gut microbiota of Sprague Dawley (SD) rats. The SPro and SPep prepared in this study showed extensive SPro molecular weight distribution, while that of SPep was minimal, ranging between 150 and 1000 Da and primarily consisting of two to five amino acids. The cecum microflora composition of the rats was determined via 16S rDNA amplicon sequencing, showing that the SPro and SPep significantly increased the abundance and uniformity of the gut microbiota after 35 days of feeding. The Firmicutes/Bacteroidetes (F/B) ratios of the SPep, SPro, and casein groups were 2.49 ± 0.60, 2.98 ± 1.12, and 2.59 ± 0.74, respectively. Although the rats fed with SPro and SPep displayed similar gut microbiome structures, SPep significantly promoted Lactobacillus and Phascolarctobacterium growth. The results showed that SPep significantly increased the diversity of the gut microbiota and elevated the probiotic proportion. Practical Application: SPro and SPep are two nutritious and high‐quality nitrogen sources. The results showed that SPro and SPep regulated the structure of gut microbiota in rats, and the effect of SPep was better. This study provides a theoretical basis for developing SPep functional foods able to regulate gut microbiota and maintain health. [ABSTRACT FROM AUTHOR]

In the present study, E-nose, E-tongue, and headspace-solid phase microextraction gas chromatography-mass spectrometry (HS-SPME-GC–MS) technology combined with Principal Component Analysis (PCA) were employed to evaluate the flavor characteristics of the volatile and the non-volatile substances generated during the enzymatic hydrolysis of the soybean meal by Alcalase. The results showed that the enzymatic hydrolysis effectively reduced the content of soybean odorous substance 1-octene-3-ol and led to better flavor. However, the excessive enzymatic hydrolysis resulted in the deterioration of the enzymatic hydrolysates flavor. In addition, both radar graph and PCA of E-tongue were able to provide the distribution of flavor substances during the enzymatic hydrolysis of the soybean meal. These results provided a theoretical basis for the improvement of the flavors of the soybean meal and its derived products.

To improve the soybean protein content (SPC), flavor and quality of soymilk, the effects of dual-frequency ultrasound at different angles (40 + 20 kHz 0°, 40 + 20 kHz 30°, 40 + 20 kHz 45°) on physicochemical properties and soybean protein (SP) structure of raw soymilk were mainly studied and compared with the conventional single-frequency (40 kHz, 20 kHz) ultrasound. Furthermore, the intensity of the ultrasonic field in real-time was monitored via the oscilloscope and spectrum analyzer. The results showed that 40 + 20 kHz 45° treatment significantly increased SPC. The ultrasonic field intensity of 40 + 20 kHz 0° treatment was the largest (8.727 × 104 W/m2) and its distribution was the most uniform. The emulsifying stability of SP reached the peak value (233.80 min), and SP also had the largest particle size and excellent thermal stability. The protein solubility of 40 + 20 kHz 30° treatment attained peak value of 87.09%. 20 kHz treatment significantly affected the flavor of okara. The whiteness and brightness of raw soymilk treated with 40 kHz were the highest and the system was stable. Hence, the action mode of ultrasonic technology can be deeply explored and the feasibility for improving the quality of soymilk can be achieved.

A cavitation jet can enhance food proteins’ functionalities by regulating solvable oxidized soybean protein accumulates (SOSPI). We investigated the impacts of cavitation jet treatment on the emulsifying, structural and interfacial features of soluble soybean protein oxidation accumulate. Findings have shown that radicals in an oxidative environment not only induce proteins to form insoluble oxidative aggregates with a large particle size and high molecular weight, but also attack the protein side chains to form soluble small molecular weight protein aggregates. Emulsion prepared by SOSPI shows worse interface properties than OSPI. A cavitation jet at a short treating time (6 min) would cause soluble oxidized aggregates to reaggregate through an anti-parallel intermolecular β-sheet, which resulted in lower EAI and ESI, and a higher interfacial tension (22.44 mN/m). The results showed that suitable cavitation jet treatment could adjust the structural and functional features of SOSPI by targeted regulated transformation between the soluble and insoluble components.

The development of plant-based meat analogs is currently hindered by the beany flavor generated by raw soybean protein and extrusion processing. Wide concern has led to extensive research on the generation and control of this unwanted flavor, as an understanding of its formation in raw protein and extrusion processing and methods through which to control its retention and release are of great significance for obtaining ideal flavor and maximizing food quality. This study examines the formation of beany flavor during extrusion processing as well as the influence of interaction between soybean protein and beany flavor compounds on the retention and release of the undesirable flavor. This paper discusses ways to maximize control over the formation of beany flavor during the drying and storage of raw materials and methods to reduce beany flavor in products by adjusting extrusion parameters. The degree of interaction between soybean protein and beany compounds was found to be dependent on conditions such as heat treatment and ultrasonic treatment. Finally, future research directions are proposed and prospected. This paper thus provides a reference for the control of beany flavor during the processing, storage, and extrusion of soybean raw materials used in the fast-growing plant-based meat analog industry.

Bioconversion of the complex carbohydrates present in lignocellulosic biomass into simple sugars, in order to obtain biofuels and bio-based products, is still limited by the low performance of the enzymatic saccharification reaction and the high cost of cellulolytic enzymes. Low-cost additives such as soybean protein can reduce the unproductive adsorption of cellulases onto lignin, increasing conversion rates and reducing enzyme losses. Here, investigation was made of the effects of different soybean protein fractions, extracted in-house, on the enzymatic saccharification of hydrothermally pretreated sugarcane bagasse. The glucose released during biomass saccharification increased by up to 76% in the presence of the in-house extracted soybean protein, compared to the control (without additive). A remarkable finding was that the technique allowed the enzyme loading to be decreased four-fold. The results suggested that the alkali-extracted proteins presented high surface hydrophobicity, which enhanced their interaction with lignin and reduced the unproductive binding of cellulases. Among the main soybean protein fractions, glycinin had the best effect in improving saccharification, which could have been due to its higher hydrophobicity. Hence, in-house extracted soybean proteins seem to be interesting alternative additives capable of increasing the lignocellulosic biomass conversion efficiency in future biorefineries.

It has been shown that enzyme-treated plant protein can increase performance and promote intestinal health, and save dietary protein. However, our understanding of the effects of enzyme-treated soy protein on performance and intestine function in laying hens, and its rational use, remains limited. The experiment was conducted to study the effect of enzyme-treated soy protein (ETSP) in different nutrient density diets on performance, egg quality, digestive enzyme activity and mRNA expression of amino acid transporters of laying hens. A total of 1 200 Lohmann laying hens (52 wk of age) was randomly divided into a 3 × 2 factorial design that included three nutrient levels: [positive control (PC), metabolisable energy (ME): 2 680 kcal/kg, CP: 15.5%; negative control 1 (NC1), ME: 2 630 kcal/kg, CP: 15%; negative control 2 (NC2), ME:2 580 kcal/kg, CP: 14.5%] and 2 ETSP levels (0 and 0.5%) for 12 weeks. Each treatment had 10 replicates with 20 birds. With the decrease of dietary nutrition density, egg production rate (P = 0.07) and feed conversion ratio (FCR) (P = 0.06) were reduced. Yolk colour was decreased, and yolk index was increased. Supplemented ETSP improved FCR (P = 0.05) and qualified egg rate (P

Oral nutritional (ON) products are an effective way to treat patients with type 2 diabetes mellitus (T2DM) whose gastrointestinal functions are normal. The influence of ON formula prepared with three different proteins on T2DM was studied. The hyperglycaemic mouse model using a high-fat diet (HFD) combined with an intraperitoneal injection of streptozotocin (STZ) was used to simulate T2DM. The study was done for 15 weeks using seven groups of mice: control group (CG, normal mice, and normal food), non-treated group (BG, diabetic mice, and normal food), positive control group (PG, diabetic mice, and HFD), soybean protein group (SPG, diabetic mice, and HFD), silkworm pupa protein group (SPPG, diabetic mice, and HFD), whey protein group (LPG, diabetic mice, and HFD), and whey protein combined with silkworm pupa protein group (LCSSPG, diabetic mice, and HFD). The plasma levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were analyzed on weeks 2, 10, 12, 14, and 15. The concentration of total protein (TP) and albumin (ALB) of the plasma was increased in SPG, SPPG, and PG comparing with BG (p < 0.05). The TC, TG, and LDL-C levels were decreased, and HDL-C level was increased in SPG, PG, SPPG, PG comparing with BG (p < 0.05). Blood glucose (BLG) levels were decreased 47, 34, 24, and 21% in SPG, LCSSPG, SPPG, and PG, respectively. While BLG was not significantly changed (p ≥ 0.05) in LG after 5 weeks of treatment. Overall, the data suggested that consumption of SP, SPP, LCSSPG Oral-formula may be beneficial for the treatment of T2DM.

We examined the effects of cooking and processing on the quantitation of soy protein in various soy-based foods. For the phosphate-buffered saline (PBS) extraction, the total protein content was measured by bicinchoninic acid assay, and the buffer extraction containing sodium dodecyl sulfate (SDS) and 2-mercaptoethanol (ME) was measured by the 2-D Quant Kit, and SDS-polyacrylamide gel electrophoresis analysis (SDS-PAGE) of each extraction was performed. Furthermore, measurements were performed by various ELISAs. During the tofu cooking process, the protein concentrations of soaked soybeans and Seigo (soybean homogenized with water) fluctuated-the change in protein solubility due to the amount of water during sample homogenization was considered to be a factor. It was thought that the decrease in protein concentration due to heating of Seigo during soymilk production was considered to indicate thermal denaturation of the protein, and that SDS and ME extraction in tofu may affect the measurement system. In cooking excluding roasted beans, proteins with a mass of 50 kDa or above and around 20 kDa were denatured, and in twice-fried tofu, proteins around 40 kDa were denatured, but the protein concentration excluding boiled soybeans did not decreased. Furthermore, the protein concentration from roasted beans, yuba, roasted okara and fried tofu increased with the cooking time, suggesting that the denaturation temperature of the protein shifted to a high temperature as the water content decreased. Both of the two types of ELISAs that comply with the official labeling system of foods containing allergenic substances were useful for detecting soybean protein by detecting proteins and peptides in processed soybean products, fermented foods excluding natto, and health foods. [ABSTRACT FROM AUTHOR]