Search

In 2006 and 2007, 75 strains of Ralstonia solanacearum were collected from wilting tomato, pepper and eggplant in Benin. The distribution and the incidence of tomato bacterial wilt in the field were assessed by counting wilted tomato plants on 3 plots of 50 m2 per field. The isolated bacterial strains, including the reference strain, were identified using ELISA, pathogenicity test and carbohydrate oxidation. Bacterial wilt is widely distributed in Benin and was found in five of the eight agro-ecological zones (AEZ) of Benin, which correspond to eight of the 12 districts of Benin. The disease was more severe in ferralitic soil (AEZ V), in valleys and lowlands (AEZ IV) and in highlands (AEZ I). The incidence of tomato bacterial wilt was up to 71%. No R. solanacearum strains were isolated from AEZ II, AEZ VII and AEZ VIII. Strains identified as R. solanacearum were more widely distributed in the south than the center and the north of Benin. Based on biochemical characteristics, Beninese R. solanacearum strains were grouped into biovar I/race1 and biovar III/race 1.

Plant pathogenic bacteria in the genus

Experiments were conducted to evaluate potential functional and mechanistic differences in the suppression of

An amendment to this paper has been published and can be accessed via a link at the top of the paper.

While clinical donation after circulatory death (DCD) cardiac transplantation is being implemented with increasing frequency to address the supply/demand mismatch of donor grafts, no research to date has examined a strategy of donor preconditioning to optimize the viability of DCD hearts for transplantation. In our rat model of the DCD protocol, we investigate the impact of pretreating donors with phosphorothioate-linked cytosine and guanine rich oligodeoxynucleotides (CpG ODN) and their effects on cardiac function, injury, and a novel left ventricular (LV) mRNA biomarker panel.DCD rats were subjected to a withdrawal protocol, followed by 20 minutes of warm acirculatory standoff, representing a group of severely injured hearts as previously demonstrated. Beating heart controls and DCD rats were pretreated with vehicle or stimulatory CpG ODN (beating heart control and DCD stimulated with CpG ODN, BST and DST). Hearts were harvested for ex situ heart perfusion (ESHP), where LV function, histochemical injury, and differences in gene expression were characterized between groups.Donor pretreatment with CpG ODN doubled the number of functional DCD hearts at ESHP. Pretreatment was associated with improved systolic and diastolic LV function, a reduction in histological injury, and markedly reduced elaboration of cardiac troponin-I in coronary effluent during ESHP. Pretreatment was also associated with a reduction in mRNA biomarkers associated with myocardial injury.A single dose of CpG ODN was associated with reduced biomarkers of cardiac injury and a 100% increase in cardiac viability in this rodent model of marginal DCD cardiac donation.

Little is known about the abiotic factors contributing to the preharvest persistence of Salmonella in tomato tissues. Therefore, we investigated the effects of specific environmental conditions and contamination methods on the persistence and dissemination of Salmonella enterica subsp. enterica serotype Typhimurium (JSG626) in tomato plants. When plants were sprayed on the leaves with a JSG626-contaminated solution, JSG626 persistence in the phyllosphere (bacteria located on the surface of the inoculated foliage and stem tissues) was lower at higher temperatures (30°C day/25°C night) than at lower temperatures (20°C day/15°C night). However, wounding cotyledons with contaminated tools improved JSG626 persistence and the internalization rate (2.27%) in planta compared to spray inoculation (0.004%). The systemic dissemination of JSG626 to other tissues increased when contaminated plants were grown under low relative humidity ( IMPORTANCE Tomatoes are one of the most widely produced vegetables around the world; however, fresh tomatoes have been connected to multiple wide-scale salmonellosis outbreaks over the past decades. Salmonella is commonly found in the environment and can persist in hostile conditions for several weeks before being internalized into plant tissues, where it is protected from conventional sanitation methods. In addition to biotic factors (host, inoculum size, and phytobiome), abiotic factors (environmental conditions) may affect the persistence of Salmonella in crop production. This study demonstrates that specific environmental conditions, the inoculation method, and the inoculum density affect the persistence and dissemination of JSG626 in tomato plant tissues. Our findings enhance the understanding of interactions between Salmonella enterica and fresh produce and may lead to the development of novel management practices on farms.

Small molecules (SMs) 1, 3, 4, and 5 are novel growth inhibitors of

Anaerobic soil disinfestation (ASD) was evaluated as a tool for managing the root-knot nematode Meloidogyne hapla in lettuce (Lactuca sativa) and clubroot disease, caused by Plasmodiophora brassicae, in mustard greens (Brassica juncea) produced on Ohio muck soils in Huron and Stark Counties. In two consecutive years of field trials, wheat bran (20.2 Mg ha−1), molasses (10.1 Mg ha−1), and wheat bran (20.2 Mg ha−1) plus molasses (10.1 Mg ha−1) were assessed as ASD carbon sources and compared with nonamended controls. Data were collected from plants grown in the field and from plants grown in field-treated soils in growth chamber-based post-ASD bioassays. Anaerobic conditions developed in ASD-treated soils in both trial years, as indicated by polyvinyl chloride pipes painted with an iron oxide paint. Soil pH did not decrease during ASD at the Huron County site of the mustard greens clubroot trials in either trial year but soil pH decreased significantly during ASD in Stark County soils treated with ASD with either wheat bran or wheat bran plus molasses compared with control soils in both trial years. Impacts of ASD on plant biomass were inconsistent in direct field measurements; however, significantly higher biomasses were observed in lettuce and mustard greens grown in bioassay soils collected from plots treated with ASD with wheat bran-based amendments compared with plants grown in soils from control plots. Based on direct field measurements and bioassays, the use of ASD with any carbon source led to significant reductions in root-knot nematode galling on lettuce compared with controls. Reductions in clubroot severity in mustard greens following ASD were less consistent; however, significant reductions in clubroot severity were observed in the field in one trial year and in both years of bioassays. The results of these studies indicate that ASD is a promising tool for managing soilborne diseases in muck soil vegetable production systems.

Bacterial leaf spot of lettuce (Lactuca sativa L.) caused by Xanthomonas campestris pv. vitians (proposed new names X. axonopodis pv. vitians / X. hortorum pv. vitians) is an economically important disease in many areas of the world (1,2). Serious outbreaks occurred in Ohio in 1995 and 1996. The primary sources of the causal agent are presumed to be contaminated seed and infected plant debris in the field. Once the disease is present in a field, crop rotation is required to decrease primary inoculum of the pathogen. Therefore, appropriate crop rotation sequences need to be determined based on the host range of the pathogen. Some vegetable crops, including tomato, pepper, cabbage, collard, kale, radish, and horseradish, were tested for susceptibility to four representative strains of X. campestris pv. vitians by spray inoculation in the greenhouse. Typical symptoms of bacterial leaf spot were observed on tomato and pepper plants 8 days after inoculation, whereas the other crops did not develop diagnostic symptoms. The pathogen was reisolated and Koch's postulates were completed on tomato and pepper. This is the first report that X. campestris pv. vitians strains can cause bacterial spot disease on tomato and pepper. References: (1) C. L. Patterson et al. Plant Dis. 70:982, 1986. (2) L. Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Acibenzolar-S-methyl (CGA 245704 or Actigard 50WG) is a plant activator that induces systemic acquired resistance (SAR) in many different crops to a number of pathogens. Acibenzolar-S-methyl was evaluated for management of bacterial spot (Xanthomonas axonopodis pv. vesicatoria) and bacterial speck (Pseudomonas syringae pv. tomato) of tomato in 15 and 7 field experiments, respectively. Experiments were conducted over a 4-year period in Florida, Alabama, North Carolina, Ohio, and Ontario using local production systems. Applied at 35 g a.i. ha-1, acibenzolar-S-methyl reduced foliar disease severity in 14 of the 15 bacterial spot and all 7 bacterial speck experiments. Disease control was similar or superior to that obtained using a standard copper bactericide program. Acibenzolar-S-methyl also reduced bacterial fruit spot and speck incidence. Tomato yield was not affected by using the plant activator in the field when complemented with fungicides to manage foliar fungal diseases, but tomato transplant dry weight was negatively impacted. X. axonopodis pv. vesicatoria population densities on greenhouse-grown tomato transplants were reduced by acibenzolar-S-methyl treatment. Bacterial speck and spot population densities on leaves of field-grown plants were not dramatically affected. Acibenzolar-S-methyl can be integrated as a viable alternative to copper-based bactericides for field management of bacterial spot and speck, particularly where copper-resistant populations predominate.

Field trials were conducted over 2 years to assess the effects of compost amendments on disease development in organic and conventional processing tomato (Lycopersicon esculentum L.) production systems. The incidence of anthracnose fruit rot was reduced in organic tomato plots amended with a high rate of composted cannery wastes compared with the incidence in nonamended control plots in 1998 when disease incidence was high. Marketable yield was increased by 33% in compost-amended organic plots. Plots amended with a high compost rate had more ripe fruit than the nonamended control. The incidence of anthracnose and of total disease on fruit was less on the cultivar OH 8245 than on Peto 696. Total fruit yield of OH 8245 but not Peto 696 in organic plots was increased by amendment with composted cannery wastes. In conventional tomato production, composted yard wastes increased disease severity on foliage both years but reduced bacterial spot incidence on fruit in 1997, when disease pressure was high. The incidence of anthracnose was not affected by composted yard wastes. Marketable and total fruit yields of Peto 696 were not increased in compost-amended conventional plots. The plant activator Actigard reduced foliar disease severity and the incidence of bacterial spot and anthracnose on fruit, while increasing yield of marketable fruit.

Bacterial wilt, incited by Ralstonia solanacearum, is a major disease affecting pepper (Capsicum annuum) production worldwide. The most effective management tactic is the deployment of wilt-resistant varieties. However, the lack of a nondestructive method to measure invasiveness and spatio-temporal distribution of R. solanacearum, a vascular pathogen, in planta limits better understanding of pepper resistance and plant-pathogen interactions. We evaluated the resistance of 100 pepper lines using R. solanacearum strain Rs-SY1 (phylotype I, isolated from a sweet pepper in South China). Based on the disease severity index (DSI) values, the elite inbred line BVRC 1 and the small-fruited accessions PI 640435 and PI 640444 were identified as resistant (DSI: 1.2, 1.8, and 1.9 out of 4.0, respectively). In order to evaluate bacterial infection dynamics in planta in real time, we generated seven bioluminescent R. solanacearum strains (BL-Rs1 to BL-Rs7) using vector pXX3 carrying luxCDABE genes, and selected BL-Rs7 for inoculation due to its similarity with parent strain Rs-SY1 in morphology, pathogenicity, and highest light emission in vitro. Luminescence intensity was strongly correlated to bacterial population in planta (R2 = 0.88). The utility of the bioluminescence assay was validated by comparing R. solanacearum infection dynamics in real-time in vivo between resistant line BVRC 1 and susceptible line BVRC 25. The distribution and multiplication of BL-Rs7 strain in resistant line BVRC 1 was conspicuously limited in plants inoculated in either roots or stem compared with susceptible line BVRC 25. These results suggest that pepper line BVRC 1 may resist colonization by interfering with R. solanacearum multiplication in the roots and stem.

Tomato is an important cash crop in many developing countries. However, smallholder farmers often lack access to improved cultivars and breeding programs to develop locally adapted cultivars are limited. Participatory crop improvement (PCI) approaches can be used to increase farmer access to improved cultivars. In this project, we used the mother and baby trial (MBT) design to introduce and evaluate tomato cultivars in three villages in the Morogoro Region of Tanzania. Mother trials were conducted in seven environments within the three villages, and variance partitioning revealed significant genetic effects for all traits measured with h2 ranging from 0.74 to 0.90 for yield and disease reaction, respectively. In baby trials, farmers provided qualitative rankings of cultivars for 16 characteristics, including vigor, yield, harvest period, diseases, insect damage, fruit quality, and salability. Results from baby trials indicated that introduced cultivars were locally acceptable to farmers, except for traits related to marketability. Outcome Mapping was used to evaluate progress in each of the three villages and results suggested that high stakeholder participation levels could predict future adoption of introduced cultivars. Our findings provide a framework for evaluating, selecting, and breeding tomato and other horticultural crops in developing countries using the MBT design for PCI.

In July 2018, a sample of lavender var. Grosso (Lavandula × intermedia 'Grosso') from Miami County, OH was received by The Ohio State University Vegetable Pathology Laboratory in Wooster. Lavender plants were field-grown in sandy clay soil with plastic mulch under drip irrigation. Disease incidence ranged from 0 to 32% depending on variety. Leaves and stems showed dark necrotic lesions that varied from roughly circular (ca. 0.3 to 0.5 mm diameter) to large coalesced necrotic areas surrounded by a water-soaked halo. Bacterial streaming from lesions was observed microscopically. Leaf tissue pieces (~0.5 cm2) were surface sterilized in 70% ethanol for 30 seconds and rinsed in sterile deionized water. The tissue was sliced aseptically into smaller sections in 100 μl sterile water and the bacterial suspension was streaked on yeast dextrose calcium carbonate agar medium. Ten yellow Xanthomonas-like colonies were selected after 72 hours of incubation at 28oC in the dark. Strains were gram negative, oxidase negative and caused hypersensitive reactions on Nicotiana benthamiana (L.). All strains were genotyped after whole-cell DNA extraction by BOX-PCR (Louws et al. 1999) and had the same banding profile. Four 8-wk-old lavender plants (Lavandula dentata and Lavandula × ginginsii 'Goodwin Creek Gray') were spray-inoculated with a 106 CFU/ml suspension of strain SM175-2018 in sterile water. Control plants were sprayed with sterile water. Plants were kept in plastic bags for the first 48 h at 28°C with a 14-h photoperiod. Water-soaked necrotic lesions appeared 14 days after inoculation with SM175-2018, whereas mock-inoculated plants did not show symptoms. Bacterial isolation from symptomatic leaf tissue was carried out as described above. The BOX-PCR profile of the re-isolated strain was identical to that of SM175-2018. Multilocus sequence analysis of the housekeeping genes fuyA, gyrB, and rpoD was performed (Accession numbers: MT764834 - MT764836). The resulting concatenated data set was used to perform a phylogenetic analysis using maximum likelihood criteria to evaluate relationships with closely related Xanthomonas spp. using published reference sequences (Young et al. 2008). SM175-2018 was assigned to the X. hortorum clade (Moriniere et al. 2020) with strong bootstrap support. The strain was subjected to whole genome analysis. Genomic DNA was extracted using a QIAGEN Genomic DNA buffer set with genomic-tip 100/G following manufacturer's protocol and sequenced using the iSeq-100 Illumina platform with the Nextera DNA Flex Library Prep protocol kit and Nextera DNA CD indexes. Average nucleotide identity (ANI) analysis was performed with the ANI-Matrix software Enveomics tool (Rodriguez-R and Konstantinidis 2016) using the sequenced genome (NCBI GenBank Biosample no. SAMN11831455) and those of other X. hortorum (Vauterin et al. 1995) bacteria (pvs. hederae, carotae, vitians). SM175-2018 shared a 96% ANI with other X. hortorum strains. X. hortorum is associated with bacterial leaf spot of carrot (Scott and Dung, 2020) and also reported on ornamental plants (Mirik et al. 2010, Oliver et al. 2012, Roberts and Parkinson 2014, Klass et al. 2019), however additional research is needed to establish the host specificity of lavender strains. To our knowledge this is the first report of X. hortorum causing bacterial leaf spot of lavender in Ohio. The disease may negatively impact the yield and quality of flowers used in production of lavender oils and essences.

A survey was conducted to document the incidence of white mold disease in country bean production areas at Bogra, Pabna, Jessore, Sylhet, Hobigonj and Gazipur districts in Bangladesh during 2016–17. A total of 115 farmers’ fields was surveyed from early vegetative to end of harvesting stages. Pathogens were collected from diseased stems, racemes and pods. Soil samples were collected from the same fields. White mold disease was identified based on symptoms in the field. White mold disease infection was recorded in 100% of the surveyed fields in Shahjahanpur upazila of Bogra district, while approx. 90, 80, 60 and 20% of the fields were infected in Bahubal of Hobigonj; Golapganj of Sylhet; Ishordi of Pabna and Monirampur of Jessore, respectively. White mold was not found in any of the fields surveyed in Joydebpur, Gazipur. Disease incidence and severity were higher in Shahjahanpur of Bogra and Bahubal of Hobigonj district. Moderate disease incidence and severity were observed in Golapganj of Sylhet. Pathogen infection was higher in the fields with loamy fine sandy soil with pH of 5.11–6.22. Globose to irregular black sclerotia developed in infected plant parts and the sclerotia germinated and produced apothecia in the fields after rain. Hyaline, branched, well developed and septate mycelia developed on potato dextrose agar medium. The hyphae were 2.0–7.2 μm in width. After five days of incubation, the subsurface mycelial cells swelled and formed dark black sclerotia. The sclerotia were 1.5–6 mm in width and 2–17 mm in length. Sclerotia germinated, and brown colored round to globose shaped apothecia developed at the end of a long stipe. The length and diameter of apothecia were approximately 4–21 mm and 2–8 mm, respectively. Asci were hyaline and cylindrical in shape, while the ascospores were elliptical. The size of ascus and ascospore was 68–155 × 4.5–6.01 μm and 4.7–6.94 x 4–6.2 μm, respectively. Calcium oxalate was formed on the wall surface of the asci. Disease incidence was negatively correlated with pH and calcium content in the soil while apothecia formation was positively correlated with rainfall and humidity.

We selected six strains with in vitro antagonism against 15 South Asian strains of Ralstonia pseudosolanacearum from among 54 previously characterized Pseudomonas and other bacterial biocontrol strains and evaluated the value of integration of these biocontrol agents with partial host resistance of tomato in management of bacterial wilt. Biocontrol strains were almost four times more effective in suppressing bacterial wilt in IRAT L3, a partially resistant tomato line, than in L390, a highly susceptible line. Pseudomonas brassicacearum 93D8 and Wood 1R, and P. fluorescens Clinto 1 were the most effective strains with biocontrol efficacy of 68, 47 and 56% respectively, in IRAT L3. Bacterial wilt incidence was suppressed in IRAT L3 in four of four experiments by P. brassicacearum 93D8, and in three of four experiments by P. protegens Clinto 1 and P. brassicacearum Wood 1R. However, in L390, biocontrol efficacy of P. brassicacearum 93D8 and Wood 1R, and P. fluorescens Clinto 1 was 7, 15 and 12%, respectively. There was no correlation between in vitro antagonism of the biocontrol strains against R. pseudosolanacearum and in vivo biocontrol efficacy. These results highlight the value of integration of biocontrol agents with host resistance in management of bacterial wilt.

Soilborne diseases, root-knot nematodes (Meloidogyne spp.), and weeds are the major yield-limiting factors in okra (Abelmoschus esculentus) and eggplant (Solanum melongena) production in Nepal. Anaerobic soil disinfestation (ASD) is a promising technique in developed countries to control soilborne pests, but it has not been tested in many developing countries. Experiments were conducted in the western plain region of Nepal in okra and eggplant from March to July 2016 and October 2016 to April 2017 (eggplant only) to compare locally available carbon sources for efficacy in ASD. Experiments were conducted in a randomized complete block design with three replicates of seven amendments (molasses 2 kg m−2, rice bran 2 kg m−2, rice bran 1 kg m−2 plus molasses 1 kg m−2, raw goat manure 2 kg m−2, mustard (Brassica campestris var. toria) cake 1.5 kg m−2, lentil (Lens esculenta) husks 2 kg m−2, and berseem clover (Trifolium alexandrinum) leaves 3 kg m−2), and a non-amended, uncovered (aerobic) control in the first year. Lentil husks and berseem clover were replaced by wheat bran (2 kg m−2) and wheat bran (1 kg m2) plus molasses (1 kg m−2) in the second year. Carbon sources were incorporated into soil followed by irrigation to saturation, and plots were covered with white plastic sheeting for 21 days. Significantly lower Fusarium wilt incidence, root-knot disease severity, and weed biomass were observed in ASD-treated eggplant plots compared to the control in 2016; disease, root-knot and weed pressure were low in 2017 and differences were not significant. Root knot disease severity and weed biomass were significantly reduced compared to the control in ASD-treated okra plots, depending on the carbon source used. With the exception of plots amended with molasses (eggplant, 2017) or molasses alone or combined with rice bran (okra), significantly higher fruit yields were observed in ASD-treated plots than in control plots. ASD appears to have great potential in Nepal because of its broad-spectrum impact on multiple soilborne pests and ready availability of inexpensive local inputs.

Little is known about the abiotic factors contributing to the preharvest persistence of Salmonella in tomato tissues. Therefore, we investigated the effects of specific environmental conditions and contamination methods on the persistence and dissemination of Salmonella enterica subsp. enterica serotype Typhimurium (JSG626) in tomato plants. When plants were sprayed on the leaves with a JSG626-contaminated solution, JSG626 persistence in the phyllosphere (bacteria located on the surface of the inoculated foliage and stem tissues) was lower at higher temperatures (30°C day/25°C night) than at lower temperatures (20°C day/15°C night). However, wounding cotyledons with contaminated tools improved JSG626 persistence and the internalization rate (2.27%) in planta compared to spray inoculation (0.004%). The systemic dissemination of JSG626 to other tissues increased when contaminated plants were grown under low relative humidity (

In June 2004, wilted tomatoes with no foliar yellowing were observed in Ouègbo, Atlantique District, Benin. The cut tomato stems released whitish bacterial ooze. Longitudinal sections of most stems showed brown vascular discoloration. Twenty symptomatic tomato plants were collected from 10 fields and exported to the Institute of Plant Disease and Plant Protection, Leibniz Universität Hannover, Germany. Bacteria were isolated on triphenyl tetrazolium chloride (TTC) medium (2) and three of the nine bacterial isolates that resembled Ralstonia solanacearum (colonies with red center and whitish periphery) and reference strain ToUdk (race 1 biovar 3; N. Thaveechai, Kasetsart University, Bangkok, Thailand) were used for pathogenicity tests. Five 4-week-old tomato plants cv. Tohounvi, grown in individual plastic pots (14 × 16 cm) containing sterilized field soil, were inoculated with each of the four isolates individually by soil drenching with 30 ml of the test cultures at 108 CFU/ml. Control plants were treated with 30 ml of sterile water. All plants were incubated in a glasshouse at 30°C. All plants inoculated with the isolates from Benin wilted 4 days after inoculation with symptoms similar to those observed in the field. Plants inoculated with the reference strain wilted 7 to 11 days after inoculation. Control plants treated with water remained healthy. R. solanacearum was recovered from the 20 symptomatic plants on TTC medium. The identity of the strains in comparison with the reference strain was confirmed by PCR with species-specific primers 759/760, which produced a single 281-bp fragment (3). Because similar symptoms were being increasingly reported by farmers across Benin and linked with reduced tomato yields, a disease survey was undertaken by IITA in 2006 and 2007. Wilted tomato plants were found across all agro-ecological zones of Benin (3 to 72% of plants per field). Isolates were recovered from the southeastern districts of Adja-Ouèrè, Sakété, Adjohoun, and Dangbo, the southwestern districts of Klouékanmè and Athiémé, the southern districts of Toffo and Bohicon, the central districts of Dassa and Savè, and the northern districts of Malanville and Karimama. Identification of R. solanacearum was confirmed following inoculation of tomato, production of characteristic wilting symptoms, recovery of the pathogen on TTC medium, and positive identification with ELISA kits (Pathoscreen Rs; Agdia Inc., Elkhart, IN). To our knowledge, this is the first report of R. solanacearum infecting tomato in Benin. Tomato is the most cultivated vegetable crop in Benin and important to the livelihood of many people in peri-urban and rural areas. Understanding that the cause of the observed crop losses is R. solanacearum may lead to implementation of management strategies such as deployment of disease-resistant cultivars or grafting tomatoes onto bacterial wilt-resistant rootstocks (1). References: (1) P. Aggarwal et al. Indian J. Agric. Sci. 78:379, 2008. (2) A. Kelman. Phytopathology 44:693, 1954. (3) N. Opina et al. Asian Pac. J. Mol. Biol. Biotechnol. 5:19, 1997.

In 2009 and 2010, outbreaks of bacterial spot characterized by significant fruit spotting occurred in at least 2,000 ha of commercial processing tomatoes in northwest Ohio and southeast Michigan. Losses were estimated at $7.8 million. Diseased fruit and foliage were collected from 32 Ohio and Michigan fields in 2010. Excised lesions from fruit and leaves were dipped briefly in 70% ethanol, air dried, and chopped into pieces in 10 mM potassium phosphate buffer (KPB), pH 7.4. Ten-fold serial dilutions in KPB were plated on yeast dextrose carbonate agar medium and 83 yellow mucoid colonies were purified. All isolates were gram negative and induced a hypersensitive response in tobacco (Nicotiana tabacum) plants 24 h after inoculation with a 108 CFU/ml bacterial suspension in water. All 83 isolates were identified as Xanthomonas spp. using genus-specific primers RST65/69 (2). Of these, 11 were identified as X. euvesicatoria and 8 as X. perforans using the species-specific primers RST27/28 (1) and JJ19/22 (5′-AACCCAACTAATTTCCCTC-3′ and 5′-AACGAGATTTGTTACGAACC-3′; J. B. Jones, personal communication), respectively. DNA fingerprint profiles of 62 of the 64 remaining strains generated using BOX-PCR assays (4) were identical to the profile of X. gardneri type strain XCGA2. The DNA profiles of 2 of the 64 Xanthomonas strains did not resemble those of any reference strains. The 16S rDNA and ITS1 genes from two representative strains (SM174-10 and SM230-10) were PCR amplified, direct sequenced, and aligned using nBLAST with the same gene region from XCGA2 (GenBank Accession No. AF123093). Strains SM174-10 and SM230-10 differed from XCGA2 by 2 bp (99% nucleotide similarity). Pathogenicity tests were performed twice on 6-week-old tomato seedlings (cv. Peto 696). Three tomato seedlings were sprayed until runoff with strain SM174-10 (~108 CFU/ml), three seedlings were sprayed similarly with water (control treatment), and all six plants were grown under high relative humidity (24 s of mist per 12 min) at day/night temperatures of 29/23°C for 15 days. Seedlings inoculated with SM174-10 exhibited water-soaked lesions and chlorosis on the foliage, similar to field symptoms, within 14 days. Seedlings sprayed with water did not develop symptoms. Isolates cultured as described above from all three pathogen-inoculated seedlings were similar in morphology to strain SM174-10; no cultures were recovered from water-inoculated plants. The BOX-PCR fingerprint profile of a representative reisolated colony was identical to that of SM174-10. Although bacterial spot of tomato is a common disease in Ohio and Michigan, to our knowledge this is the first report of X. gardneri infecting tomatoes in these states and provides evidence that there may have been a shift in the primary causal agent of bacterial spot from X. euvesicatoria (3) to X. gardneri. References: (1) H. Bouzar et al. Phytopathology 84:39, 1994. (2) A. Obradovic et al. Eur. J. Plant Pathol. 11:285, 2004. (3) F. Sahin. Ph.D. Diss. The Ohio State University, Columbus, 1997. (4) D. J. Versalovic et al. Methods Mol. Cell. Biol. 5:25, 1994.

In January 2011, tomato (Solanum lycopersicum) plants exhibiting stunting, yellow mosaic, short, chlorotic leaves, aborted flowers, and reduced-size fruits, symptoms similar to those exhibited by plants infected by ‘Candidatus Liberibacter solanacearum’ (2), were observed in approximately 5% of tomato plants in greenhouses in Jocotitlan in the State of Mexico, Mexico. Occasional plant recovery was also observed. Tomato plants in this facility were previously shown to be infected by Mexican papita viroid (MPVd), Pepino mosaic virus (PepMV), and aster yellows phytoplasma. Eight symptomatic leaf samples (designated MX11-01 to MX11-08) were collected and screened against selected tomato viruses and pospiviroids by reverse transcription (RT)-PCR using purified plant RNA or for ‘Ca. L. solanacearum’ by PCR using purified plant DNA. As expected, both PepMV and MPVd were detected in these samples. However, two ‘Ca. L. solanacearum’-specific PCR products (1,168 and 669 bp) were also amplified in two samples (MX11-02 and MX11-05) using primers OA2 (2) and OI2c (1) or CL514F/CL514R (3), respectively. Each ‘Ca. L. solanacearum’-specific PCR product was gel purified with Geneclean (Q-Biogene, Carlsbad, CA) and cloned into pCR2.1 using TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced (Functional Biosciences, Madison, WI). Sequences of 16S rRNA (1,168 bp) in both isolates (GenBank Accession Nos. JF811596 and JF811597) were identical. However, the 669-bp 50S rRNA sequences in these two isolates (GenBank Accession Nos. JF811598 and JF811599) contained two single nucleotide polymorphism (SNP) mutations. BLASTn searches showed that both 16S rRNA and 50S gene sequences in MX11-05 were identical to the ‘Ca. L. solanacearum’ previously identified on potato in Chihuahua (GenBank Accession Nos. FJ829811 and FJ829812) and Saltillo (GenBank Accession Nos. FJ498806 or FJ498807) in eastern Mexico. These ‘Ca. L. solanacearum’ isolates were recently classified as the “b” haplotype (4). Alignment analysis of the ‘Ca. L. solanacearum' 16S rRNA sequences also revealed the conserved SNP mutations (g.212T > G and g.581T > C) in MX11-02 and MX11-05 as previously identified for other “b” haplotype isolates (4). ‘Ca. L. solanacearum’ was first identified in greenhouse tomatoes in 2008 in New Zealand (2). It has also been identified in greenhouse and field tomatoes in the United States. ‘Ca. L. solanacearum’ was previously reported to infect field tomatoes in Sinaloa, Mexico (3), which was recently considered as the “a” haplotype (4). To our knowledge, this is the first report of ‘Ca. L. solanacearum’ naturally infecting tomatoes in Jocotitlan in the State of Mexico, Mexico. The greenhouse tomato ‘Ca. L. solanacearum’ may be transmitted from infected solanaceous plants by potato psyllids (Bactericera cockerelli), which were observed in this facility. References: (1) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (2) L. W. Liefting et al. Plant Dis. 93:208, 2009. (3) J. E. Munyaneza et al. Plant Dis. 93:1076, 2009 (4) W. R. Nelson et al. Eur. J. Plant Pathol. 130:5, 2011.

Tomato (Solanum lycopersicum, cvs. Mountain Fresh, Big Dena, and Trust) plants with symptoms of pith necrosis were received from six commercial high tunnels in Ohio during May and July 2012. Disease incidence ranged from 1 to 5%. Symptoms included wilting of shoots, dry, dark brown coalescent lesions on stems, brown discolored pith with a ladder-like appearance, and in some cases, adventitious root formation. Bacterial streaming was observed microscopically from necrotic stem tissue. Bacteria were isolated from surface-sterilized diseased stem tissue by plating 10-fold serial dilutions onto yeast dextrose carbonate (YDC) and Pseudomonas F (PF) agar media. The majority of the colonies recovered were similar in morphology on YDC: round and mucoid, with a greenish center that later became dry and winkled with a curly margin, and producing a yellow-green diffusible pigment. Colonies were creamy, yellow-brown in color and non-florescent on PF medium. Nine isolates from six plant samples were purified. All isolates were gram-negative, levan negative, oxidase positive, and potato rot negative. Three isolates were positive and six were negative for arginine dihydrolase activity. None induced a hypersensitive reaction in tobacco. All isolates grew at 37°C. The isolates were further identified by PCR assays using species-specific primers PC5/1-PC5/2 for Pseudomonas corrugata and PC1/1-PC1/2 for P. mediterranea (1,2). DNA of a reference P. mediterranea strain from Turkey was used as a positive control. A 600-bp band was amplified using P. mediterranea primers from the six arginine dihydrolase negative isolates recovered from four of six samples. An 1,100-bp band was amplified from the three arginine dihydrolase positive isolates from two other samples using P. corrugata primers. The 600-bp PCR products amplified from the P. mediterranea reference strain and isolate SM664-12 were purified and sequenced. The DNA sequence of SM664-12 was 99% aligned with that of the reference strain from Turkey and a BLAST search in NCBI indicated only one match with P. mediterranea strain G-229-21 (Accession No. EU117098.1), with an E-value 1e-145 and 84% identity. P. mediterranea (SM664-12) and P. corrugata (SM658-12) were each inoculated onto four 4-week-old tomato plants (cv. Mountain Fresh) by injecting a 50 μl bacterial suspension (108 CFU/ml) into the stem at the axil of the first true leaf (2). Negative control plants were injected with sterile water. Plants were kept in a mist chamber for 72 h at 25°C, then moved into a growth chamber maintained at 25/20°C day/night, 12-h light/dark, and 80% relative humidity. Plants exhibited dark brown lesions at the inoculation site after 4 weeks and brown discoloration of the pith developed, whereas no lesions were observed in control plants. The reisolated bacteria were tested by PCR and identified as P. corrugata and P. mediterranea. Therefore, we have confirmed that tomato pith necrosis in Ohio involves at least two bacteria, P. corrugata and P. mediterranea. Although tomato pith necrosis has been observed in Ohio since the 1990s, to our knowledge, this is the first confirmation of a causal agent as P. corrugata in Ohio and the first report of P. mediterranea causing tomato pith necrosis in the United States. References: (1) V. Catara et al. Eur. J. Plant Pathol. 106:753, 2000. (2) V. Catara et al. Int. J. Syst. Evol. Microbiol. 52:1749, 2002.

Tomato and pepper plants exhibiting wilt symptoms were collected from fields in seven villages in Northern (Vea, Tono, Pwalugu), Ashanti (Agogo, Akumadan), and Brong Ahafo (Tanoso, Tuobodom) regions of western Ghana in November 2012. The plants were wilted without leaf yellowing or necrosis. Disease incidence was generally low, with less than 20% symptomatic plants observed. Most of the plants collected produced visible bacterial ooze in water in the field. Ooze was plated on 2,3,5-triphenyltetrazolium chloride-amended (TZC) medium. Isolated colonies were fluidal, irregularly round, white with pink centers, gram-negative, and oxidase positive. One strain from each of seven fields was selected for further study. All strains induced a hypersensitive reaction on tobacco. Randomly selected strains SM855-12 and SM857-12 tested positive in R. solanacearum ImmunoStrip assays (Agdia Inc., IN). An end-point PCR assay with primer set 759/760 (3) generated an R. solanacearum-specific 280-bp amplicon for all seven strains. Two of these strains were biovar I and the remaining five were biovar III based on utilization of cellobiose, lactose, maltose, dulcitol, mannitol, and sorbitol. A phylotype-specific multiplex PCR assay that recognizes four geographically linked monophyletic groups within R. solanacearum (1) indicated that one strain (SM855-12) was phylotype III (African origin), whereas the other six were phylotype I (Asian origin). All strains were subjected to repetitive sequence-based PCR (Rep-PCR) with BOXA1R and REP1R/REP2 primers (4). Strain SM855-12 was grouped with the phylotype III reference strain UW 368 and the remaining six strains were grouped with the phylotype I reference strain GMI 1000. A pathogenicity test was performed with bacterial wilt-susceptible tomato line OH7814. Inoculum was prepared from 48-h cultures of strains SM855-12, SM856-12, and SM858-12 grown on casamino acid peptone glucose (CPG) medium at 30°C. Roots of ten 4-week-old tomato plants per strain were drench-inoculated with 5 ml of a 108 CFU/ml bacterial suspension after wounding with a sterile scalpel. Non-inoculated control plants were drenched with 5 ml distilled water after root wounding. Plants were kept in a greenhouse at 25 to 30°C. By 12 days after inoculation, 80 to 100% of inoculated plants were wilted, whereas no symptoms appeared in non-inoculated plants. Bacteria re-isolated from wilted plants were confirmed to be R. solanacearum using techniques mentioned above. Although an association of bacterial wilt with tomato/pepper was mentioned previously (2), to our knowledge, this is the first documented report of bacterial wilt caused by R. solanacearum in Ghana. The presence of Asian strains (phylotype I) may be the result of one or more accidental introductions. Awareness of this disease in Ghana will lead to deployment of management strategies including use of resistant varieties and grafting desirable varieties onto disease-resistant rootstocks. References: (1) M. Fegan and P. Prior. Page 449 in Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. C. Allen et al., eds. American Phytopathological Society, St. Paul, MN, 2005. (2) K. A. Oduro. Plant Protection and Regulatory Services Directorate of MOFA, Accra, Ghana, 2000. (3) N. Opina et al. Asia Pac. J. Mol. Biol. Biotechnol. 5:19, 1977. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5′-CTCGGTTTTCTGCTTTTC-3′ and JAP886, 5′CGGACAGGCTGGAGAAATCG3′) (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5′-CGTATCTGAGGATGTTGAGT-3′ and JAP888, 5′-GCTAACTCCTTGTTCTTTTG-3′). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5′-AGTATTATGCATCTATAGATTAGCACA-3′ and TCSV-R1, 5′-ACAAATCATCACATTGCCAGGA-′) were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

In January 2019, wilted tomato plants were discovered in fields in the Chi Kraeng district of Cambodia, 60 km south of Siem Reap. We observed vascular browning from cut stems from symptomatic plants, which tested positive for Ralstonia solanacearum with the Rs Immunostrip (Agdia, Elkhart, IN). Although bacterial wilt was noted in Cambodia (UK-CAB-International 1977), there has been no official report, and tomato farmers have reported historical losses up to 100% from a disease called sropoun sros (“fresh wilt” or in Khmer). Fluidal, irregular bacterial colonies typical of the R. solanacearum species complex (RSSC) were isolated from cut tomato stems on casamino peptone glucose (CPG) plates amended with 1% 2,3,5-triphenyl tetrazolium chloride (Schaad et al. 2001). To confirm the bacterial identification and to subclassify isolates by phylotype, genomic DNA from eight distinct isolates was amplified with the diagnostic RSSC multiplex PCR primers 759/760, Nmult21:1F, Nmult21:2F, βNmult23:AF, Nmult22:InF, and Nmult22:RR (Fegan and Prior 2005; Opina et al. 1997). Positive controls for each RSSC phylotype were genomic DNA from RSSC strains GMI1000 (phylotype I), K60 (phylotype II), CMR15 (phylotype III), and PSI07 (phylotype IV). Each Cambodian isolate yielded the 280-bp RSSC-specific DNA fragment and the 144-bp phylotype I-specific DNA fragment from this diagnostic multiplex PCR. Therefore, all Cambodian isolates were identified as phylotype I, which was recently renamed R. pseudosolanacearum (Prior et al. 2016; Safni et al. 2014). To perform Koch’s postulates, a single fresh colony from each isolate was cultured overnight in CPG broth at 28°C with 220 rpm shaking, pelleted, and resuspended in sterile water to O.D.₆₀₀ ₙₘ = 0.1 (∼1 × 10⁸ CFU/ml). Unwounded 33-day-old tomato plants (wilt-susceptible cultivar Bonny Best) were inoculated via soil soak with 50 ml of inoculum to a final density of ∼3.1 × 10⁷ CFU/g of soil. Two plants were inoculated per isolate, and four plants were treated with sterile water as negative controls. Fourteen out of 16 tomato plants showed wilting symptoms after 14 days, and all plants were wilted after 21 days. These results are representative of two replicates. No water-treated control plants wilted. R. pseudosolanacearum colonies were successfully reisolated from the wilted tomato plants. Sropoun sros or bacterial wilt has likely been a longstanding problem for Cambodian farmers. Characterizing and reporting bacterial wilt of tomato in Cambodia will be the foundation for future management strategies and the development of tomato varieties specifically resistant to Cambodian R. pseudosolanacearum.

Aneurysmal subarachnoid hemorrhage is potentially fatal and is associated with poor outcomes in many patients. Advances in neurosurgical and medical management of ruptured aneurysms have improved mortality rates in patients with aneurysmal subarachnoid hemorrhage. Surgical and endovascular interventions, such as external ventricular drain placement, aneurysm clipping, and endovascular coiling, have been developed over the past few decades. Patients with aneurysmal subarachnoid hemorrhage are also at risk for cerebral vasospasm and delayed cerebral ischemia. This article describes the diagnosis and treatment of aneurysmal subarachnoid hemorrhage, vasospasm, and cerebral ischemia. Concurrent medical considerations and ideas for future neuroinflammatory vasospasm research are also discussed.

The control of Salmonella from farm to fork is challenging due to the emergence of antimicrobial-resistant isolates and the limited effects of current control methods. Advanced chemical technologies have made accessible a wide range of uncharacterized small molecules (SMs) with encouraging chemical properties for antimicrobial treatment. Of the 4,182 SMs screened in vitro, four cidal SMs were effective at 10 µM and higher against several serotypes, antibiotic-resistant, and biofilm embedded Salmonella enterica subsp. enterica serotype Typhimurium by altering cell membrane integrity. The four SMs displayed synergistic effects with ciprofloxacin, meropenem and cefeprime against Salmonella. Further, the SMs were not pernicious to most eukaryotic cells at 200 μM and cleared internalized Salmonella in infected Caco-2, HD11, and THP-1 cells at 6.25 µM and higher. The SMs also increased the longevity of Salmonella-infected Galleria mellonella larvae and reduced the population of internalized Salmonella Typhimurium. Two of the SMs (SM4 and SM5) also reduced S. Typhimurium load in infected chicken ceca as well as its systemic translocation into other tissues, with minimal impact on the cecal microbiota. This study demonstrated that SMs are a viable source of potential antimicrobials applicable in food animal production against Salmonella.

Evaluation is a necessary component of plant health programs designed for and implemented in research, extension, and international development settings. Outcome Mapping is a method of program planning, observation, and assessment in which changes in behavior, relationships, or actions of the target groups (boundary partners) are evaluated during program implementation. Outcome Mapping was used to evaluate stakeholder participation in participatory variety selection trials for tomato and soil health training for tomato farmers in Tanzania. Boundary partner participation varied between the three villages evaluated and predicted adoption of new varieties assessed one year later. Outcome Mapping was valuable in tracking progress during program implementation and can indicate long-term impacts of the program. Accepted for publication 21 November 2016.

A loop-mediated amplification (LAMP) assay developed previously to specifically identify Clavibacter michiganensis subsp. michiganensis, the causal agent of bacterial canker of tomato, was compared with a commercial lateral flow immunoassay, three PCR assays, and culturing on agar medium for efficacy in detecting the pathogen in pepper and tomato tissues and tomato seeds. The LAMP assay was as effective in identifying C. m. michiganensis-positive tomato seed and tissue samples as the Cmm ImmunoStrip®. The LAMP assay was performed using a handheld real-time fluorescence-monitoring device (Smart-DARTTM) and the iQTM5 Multicolor Real-Time PCR Detection System to compare both systems. Both devices produced equivalent results, thus demonstrating the potential of this LAMP detection system for field detection. A side-by-side comparison of the C. m. michiganensis-LAMP with the Cmm ImmunoStrip® assay, two conventional PCR assays, using Cmm5/6 and PSA8/R primer sets, and one quantitative PCR assay (primers...

Tomato bacterial diseases cause significant losses annually to fresh market, processing and greenhouse producers worldwide. As researchers continue to better understand the biology of bacterial pathogens and develop effective management strategies to reduce disease incidence and severity, improved methods are needed to translate and exchange this new knowledge to a diverse and dynamic group of tomato stakeholders. However, identifying tools or methods that present knowledge in a way that will facilitate uptake and application of the knowledge can be challenging. In addition, very little science-based information is available on the best way to deliver plant disease management strategies to vegetable producers. Based on surveys conducted to identify midwestern vegetable producers’ preferences for receiving information regarding food safety hazards and the fact that the need for communication in society is heterogeneous and requires differentiation according to target groups, innovative factsheets for bacterial leaf spot (BLS), bacterial speck, bacterial canker, and pith necrosis were developed. Each factsheet contains science-based information that incorporates recent changes in the taxonomic classification, epidemiology, management and identification of the pathogens that cause these diseases. The information provided is relevant to new producers or home gardeners (beginners), experienced producers (advanced) and plant disease diagnosticians. Information from all three levels of knowledge is summarized into one downloadable factsheet that is available in English and Spanish. Additionally, uncommon terminology is defined in English and Spanish, images of diseases with similar and potentially confusing symptoms are provided and resources for diagnosing each disease are included. The factsheets were published on January 23, 2013 at www.vegetablediseasefacts.com. Over a 2-month period the factsheets had 93 new visitors and 112 returning visitors. The bounce rate for new and returning visitors was 8.6 and 52.7%, respectively. While the majority of visitors (94.7%) were from Ohio, visitors were also from Florida, Illinois, Louisiana, North Carolina, New York, Pennsylvania, Virginia, and Wisconsin. International visitors were from Guatemala, India, China, Colombia, Egypt, Iran, Italy, Mexico and Senegal. Bacterial leaf spot was the most frequently visited and downloaded disease factsheet; followed by bacterial canker, pith necrosis and bacterial speck. User engagement of each factsheet continues to be monitored and additional factsheets targeting high tunnel and organic tomato producers are currently being developed.

Powdery mildew (Oidium sp.) is an important disease of greenhouse-produced tomatoes. The severity of the disease, the widespread distribution of the pathogen, and its ability to develop insensitivity to fungicides with a narrow mode of action requires the identification of viable alternatives to conventional fungicides. Various products are available or in development that have the potential to contribute to the management of powdery mildew of tomato. Biorational products and fungicides including Cease and Serenade ASO (Bacillus subtilis QST 713 strain), Actinovate (Streptomyces lydicus), JMS stylet oil (paraffinic oil), Kocide 3000 (copper hydroxide), Microthiol Disperss (sulfur), Milstop (potassium bicarbonate), OxiDate (hydrogen dioxide), Rally 40WSP (myclobutanil), Regalia (extract of Reynoutria sachalinensis), Nufarm-Cuproxat concentrate (copper sulfate), cedar oil, citronella, clove oil, cottonseed oil, lemongrass, Ortho-Eco sense 3-in-1 Rose and Flower Care (sulfur and pyrethrin), Ortho-Eco sense Garden Disease Control (copper octanoate), whole milk, Prestop (Gliocladium catenulatum J1446), and Quintec (quinoxyfen) were tested. The experiments were done twice, each with four replicates per treatment. The severity of powdery mildew on foliage and phytotoxicity were evaluated using a scale of 0-100% foliage affected. In both experiments the severity of powdery mildew was moderate (~20% foliage affected). Cottonseed oil, Rally 40WSP, whole milk and Microthiol Disperss provided >87% control of powdery mildew compared to the non-treated control in both experiments, with little or no phytotoxicity. Cedar oil, lemongrass, Regalia, citronella, both Ortho-Eco sense products, clove oil, Milstop, JMS stylet oil, and Quintec reduced the severity of powdery mildew at least 39% in the first experiment and 62% in the second experiment. Many of the products were slightly phytotoxic on tomato foliage, but JMS stylet oil, cedar oil and citronella damaged foliage significantly compared to the non-treated control in both experiments.

One half of fresh tomato sales in the US are from greenhouse grown crops. Fresh tomato was linked to a number of foodborne disease outbreaks. Collectively, foodborne and phytopathogen hazards threaten both public health and economic viability of the greenhouse industry. Management practices in tomato greenhouses in North America were documented previously. In this study, a systematic, internet-based, iterative Delphi method was used to gauge opinions about the potential impact of various greenhouse management factors (water management, workers, environment and greenhouse design, equipment sanitation, animals, waste, and traceability) on food safety. The pretested questionnaire was distributed to 20 national and international experts in food safety of fresh fruits and vegetables. The Delphi process was repeated until the criteria for consensus were satisfied (expert agreement ≥70%). Expects attributed greenhouse irrigation water as a highly important source of contamination with human pathogens. Accordingly, testing of irrigation water for human pathogens was considered to be a valuable tool in controlling contamination in the greenhouse. According to this expert panel, people may occasionally introduce pathogens into the greenhouse. Hand washing and footwear were ranked the most effective in preventing contamination from employees and visitors. The majority of experts believed the presence of human pathogens in the greenhouse environment presented an important source of contamination for edible tomato fruits. Experts also agreed that livestock and poultry operations should be at least 250 feet away from the greenhouse. Although any animal intrusion was considered a high-extreme food safety risk-rodents were ranked the highest, and cats the lowest. Employee hygiene, mode of irrigation, equipment sanitation was ranked the most important management practice in prevention of contamination with human pathogens.

Cucurbit downy mildew caused by the obligate oomycete, Pseudoperonospora cubensis, is considered one of the most economically important diseases of cucurbits worldwide. In the continental United States, the pathogen overwinters in southern Florida and along the coast of the Gulf of Mexico. Outbreaks of the disease in northern states occur annually via long-distance aerial transport of sporangia from infected source fields. An integrated aerobiological modeling system has been developed to predict the risk of disease occurrence and to facilitate timely use of fungicides for disease management. The forecasting system, which combines information on known inoculum sources, long-distance atmospheric spore transport and spore deposition modules, was tested to determine its accuracy in predicting risk of disease outbreak. Rainwater samples at disease monitoring sites in Alabama, Georgia, Louisiana, New York, North Carolina, Ohio, Pennsylvania and South Carolina were collected weekly from planting to the first appearance of symptoms at the field sites during the 2013, 2014, and 2015 growing seasons. A conventional PCR assay with primers specific to P. cubensis was used to detect the presence of sporangia in rain water samples. Disease forecasts were monitored and recorded for each site after each rain event until initial disease symptoms appeared. The pathogen was detected in 38 of the 187 rainwater samples collected during the study period. The forecasting system correctly predicted the risk of disease outbreak based on the presence of sporangia or appearance of initial disease symptoms with an overall accuracy rate of 66 and 75%, respectively. In addition, the probability that the forecasting system correctly classified the presence or absence of disease was ≥ 73%. The true skill statistic calculated based on the appearance of disease symptoms in cucurbit field plantings ranged from 0.42 to 0.58, indicating that the disease forecasting system had an acceptable to good performance in predicting the risk of cucurbit downy mildew outbreak in the eastern United States.

In July 2017, common beet leaves (cv. Red Ace) from an open field in Erie County, Ohio, showing foliar blight symptoms were received by the OSU Vegetable Pathology Laboratory. Another beet sample (cv. Boro) from Wayne County, Ohio, displaying the same symptoms was received in June 2018. Symptoms consisted of pale brown circular water-soaked necrotic lesions, 2 to 3 mm in diameter, surrounded by a red halo. Bacterial streaming was observed from the lesions when viewed microscopically. Pieces of symptomatic tissue ∼0.25 cm² were surface sterilized in 70% ethanol for 30 s, rinsed in sterile water, placed in 100 µl of sterile water, and minced with a sterile blade. After 30 s, 10 µl of the resulting suspension was streaked onto Pseudomonas F agar medium (PF) and incubated in the dark for 48 h at 28°C. White creamy colonies fluorescent on PF when exposed to UV light were selected. Isolates from both samples were gram negative, oxidase negative, arginine dihydrolase negative, levan positive, and caused a hypersensitive reaction 24 h after infiltration into tobacco (Nicotiana tabacum) leaves. None of the isolates caused soft rot when inoculated at 10⁷ CFU/ml onto sterile potato slices. Box PCR (Louws et al. 1994) profiles were similar for strain SM200-2017 (Erie County) and SM61-2018 (Wayne County), with an additional band in SM200-2017. Both strains were subjected to whole-cell DNA extraction and multilocus sequence analysis of the housekeeping genes sigma factor 70, rpoD; glyceraldehyde-3-phosphate dehydrogenase, gapA; DNA gyrase B, gyrB; and citrate synthase, gltA (Hwang et al. 2005). Sequences were compared with those of the reference pathotype strain Pseudomonas syringae pv. aptata (Psa) CFBP 1617 deposited in the PAMDB database (Almeida et al. 2010). Both SM200-2017 (MK085510) and SM61-2018 (MK085511) showed 100% identity to the rpoD gene. SM200-2017 gapA sequence (MK085516) shared 99% homology with the gapA sequence of Psa CFBP 1617, and SM61-2018 gapA sequence (MK085517) was 100% identical. Similarly, the gyrB sequences from SM200-2017 (MK085515) and SM61-2018 (MK085514) were 99 and 100% similar to Psa CFBP 1617, respectively. No match was found for SM200-2017 and SM61-2018 gltA sequences (MK085512 and MK085513, respectively) when compared with those of Psa CFBP 1617. However, the sequences were 100% identical to Psa sequence KX226440 (Arabiat et al. 2016) deposited in the NCBI database. Koch’s postulates were confirmed in a greenhouse by spray inoculating 4-week-old beet seedlings (cv. Red Ace) with 10⁶ CFU/ml water suspensions of SM200-2017 or SM61-2018, or with sterile water. Plants were maintained at 27°C with a 14-h photoperiod, in plastic bags for the first 48 h. Symptom development was monitored daily. Water-soaked necrotic lesions similar to those observed on the original samples appeared 10 days after inoculation, whereas mock-inoculated plants did not show any symptoms. Symptomatic leaves were collected and processed as described above. Colonies with the same morphology on PF and with the same biochemical characteristics previously described were isolated. Box PCR profiles matched those of the original strains. To our knowledge, this is the first report of bacterial leaf spot of beet caused by Psa in Ohio. Common beets are cultivated throughout Ohio and can be severely affected under disease-conducive environmental conditions.

Tomatoes have been linked to many outbreaks of salmonellosis over the last decade, but the routes of contamination have yet to be discerned. Many phytopathogens of tomato are seedborne and are effectively managed using seed sanitizers. Seed sanitizers effective against bacterial phytopathogens were evaluated for their efficacy in killing bioluminescent Salmonella enterica serovar Typhimurium strain SeT-A14 on tomato seed infested with moderately high and high levels of pathogen. SeT-A14 incidence on seedlings produced from contaminated seed following sanitation was also determined. At a moderately high infestation rate (40%), SeT-A14 was eradicated on seed sanitized with 1.2% sodium hypochlorite (NaClO) mixed with 0.03% surfactant for 2 min, hydrochloric acid (HCl) for 30 min, and trichloromelamine for 2 min. At a higher infestation rate (94%), only NaClO and HCl were effective in eradicating SeT-A14 from the seed. At both infestation rates, 2% Virkon-S for 15 min significantly reduced SeT-A14 incidence compared with the nontreated infested controls but did not eradicate the pathogen. Hot water, a commonly used sanitizer for managing seedborne bacterial plant diseases, significantly reduced SeT-A14 on heavily infested seed, but incidence was still moderate at 17.5%. On seedlings produced from moderately highly infested seed, SeT-A14 was not detected using RapidChek Salmonella test strips. Using heavily infested seed, SeT-A14 was detected with the test strips in one of four pooled samples of 14-day-old seedlings produced from nonsanitized seed and from seed sanitized with hot water and trichloromelamine. However, bioluminescence was not observed on 14-day-old seedlings. To our knowledge, this is the first report that provides evidence that S. enterica serovar Typhimurium can be seed transmitted and can lead to the contamination of tomato seedlings. In addition to eliminating important bacterial phytopathogens from tomato seed, NaClO or HCl may mitigate the risk of Salmonella seedling contamination.

Ten isolates of Sclerotinia sclerotiorum, namely country bean (Lablab purpureus L.), Bogra; country bean (Lablab purpureus L.), Hobigonj; eggplant (Solanum melongena L.), Pabna; sunflower (Helianthus annuus L.), Pabna; mustard (Brassica rapa L.), Pabna; mustard (Brassica rapa L.), Bogura; mustard (Brassica rapa L.), Joypurhat; marigold (Tagetes erecta L.), Gazipur; Sylvia (Salvia colorans Bemth), Gazipur and weed (Sida rhombifolia L.), Bogra were collected from Bogra, Hobigonj, Pabna, Joypurhat and Gazipur district of Bangladesh. Among them seven isolates were tested for production of oxalic acid in culture media and pathogenicity by inoculating on country bean, eggplant, marigold leaves. All the isolates of S. sclerotiorum produced oxalic acid in bromophenol blue amended potato dextrose agar (PDA) media and PD broth, and evidence of oxalic acid production was confirmed as changing of media color. Radial growth of mycelium was higher in isolates of mustard and eggplant from Pabna, marigold from Gazipur, country bean from Bogra and Hobigonj. Deep bright yellow color with higher luminosity values (35.58–36.84) was recorded in the isolates of mustard and eggplant from Pabna. Higher pH reduction (42.8%–50.6%) with changing of color from blue to yellow was recorded in the isolates of country bean in Bogra and, mustard and sunflower in Pabna. Oxalic acid production was higher in the isolates of mustard, Pabna (23.55 mM) and weed, Bogra (21.54 mM). Isolates of country bean, Bogra and eggplant, Ishordi produced 14.67 mM and 13.40 mM oxalic acid, respectively. The lowest oxalic acid (8.74 mM) was produced in the isolate of marigold, Gazipur. Isolates of country bean in Hobigonj and Bogra, weed in Bogra and eggplant in Pabna developed symptoms size 4.62–7.78 cm on country bean leaves. Severe infection and rapidly developing symptoms (5.00–9.00 cm) were observed on eggplant leaves when the isolates of country bean in Hobigonj and Bogra, marigold in Gazipur, sunflower and eggplant in Pabna were inoculated. All seven isolates infected and produced symptoms on marigold leaves; however the size of symptoms varied. While ten isolates were examined for melanin synthesis in PDA media, all isolates produced melanin except the ones collected from Pabna regardless of crops. Isolates differed significantly for mycelial growth, media luminosity and pathogenicity. A positive correlation was found between mycelial growth and luminosity values, between mycelial dry weight and media pH and oxalic acid productions. Isolates also varied in relation to the time required to produce visible symptoms on the host plants.

Banana Xanthomonas wilt (BXW) caused by Xanthomonas campestris pv. musacearum (Xcm) is a devastating disease of bananas in Uganda and across the Great Lakes region of East and Central Africa. While use of disease-free suckers is recognized as important to control BXW, bacterial movement from infected mother plants to their suckers is not well understood. In this study, the movement of Xcm through the pseudostem of naturally and artificially infected bananas was examined. In naturally infected plants, samples of plant organs collected from susceptible cultivars ‘Kayinja’, ‘Nfuuka’ and Kivuuvu’ (Musa acuminata) at various stages of disease were analysed using a polymerase chain reaction assay employing Xcm specific primers. Xanthomonas campestris pv. musacearum was detected in 70% of asymptomatic corms and suckers collected from each of the three susceptible cultivars. In ‘Kayinja’ and ‘Nakitembe’, Xcm was recovered from plant parts 20 cm away from the point of inoculation prior to symptom development. The ...

Many factors must be considered in order to develop and implement treatment systems to improve the microbial quality of surface water and prevent the accidental introduction of plant and human pathogens into vegetable crops. The efficacy of chlorine gas (Cl2(g)) and chlorine dioxide (ClO2) injection systems in combination with rapid sand filtration (RSF) was evaluated in killing fecal indicator microorganisms in irrigation water in a vegetable-intensive production area. The efficacy of ClO2 and Cl2(g) was variable throughout the distribution systems and coliform bacteria never dropped below levels required by the United States Environmental Protection Agency for recreational waters. Sampling date and sampling point had a significant effect on the abundance of coliforms in Cl2(g)- and ClO2-treated water. Sampling date and sampling point also had a significant effect on the abundance of generic Escherichia coli in Cl2(g) treated water but only sampling point was significant in ClO2 treated water. Although the waterborne plant pathogen Phytophthora capsici was detected in five different sources of surface irrigation water using baiting and P. capsici-specific PCR, in vitro studies indicated that ClO2 at concentrations similar to those used to treat irrigation water did not reduce mycelial growth or direct germination of P. capsici sporangia and reduced zoospore populations by less than 50%. This study concludes that injection of ClO2 and Cl2(g) into surface water prior to rapid sand filtration is inadequate in reducing fecal indicator microorganism populations and ClO2 ineffectively kills infectious propagules of P. capsici. Additional research is needed to design a system that effectively targets and significantly reduces both plant and human pathogens that are present in surface irrigation water. A model for a multiple barrier approach to treating surface water for irrigation is proposed.

Tricho-compost, a Trichoderma based compost fertilizer, was developed by mixing a definite concentration of spore suspension of a Trichoderma harzianum strain with measured amounts of processed raw materials, such as cowdung, poultry refuse, water hyacinth, vegetable wastes, sawdust, maize bran, and molasses. Tricho-leachate, a liquid by-product of the Tricho-compost, was obtained during decomposition of Tricho-compost materials. These bioproducts were tested both in the laboratory and in seedbed nurseries to evaluate their effectiveness against soil-borne pathogens for growing cabbage seedlings. Application of Tricho-compost and Tricho-leachate reduced the seedling mortalities of cabbage caused by Sclerotium rolfsii by about 98%. In laboratory tests, Trichoderma harzianum, after re-isolation from Tricho-compost and tricho-leachate, was also found to be highly effective to arrest the growth of S. rolfsii. T. harzianum destroyed the radial growth of S. rolfsii mycelium by 59.7% after five days, and effected total destruction of the mycelium in 10 days. In seedbed nurseries, soil applications of Tricho-compost and Tricho-leachate significantly increased the seedling germination rate and reduced the incidence of soil-borne diseases and infestation of root-knot nematodes. Field experiment showed that combined application of Tricho-compost and Tricho-leachate reduced the seedling mortalities by 40.9% to 64.5% in Gazipur and 53.3% to 62.1% in Bogra. Application of Tricho-leachate at 500 ml per sq. metre increased plant weight by about 55.6%, and reduced the seedling mortality by about 84.0% in Gazipur. Seedbed nurseries treated with Tricho-compost and Tricho-leachate had only Pythium spp as a soil-borne pathogen, whereas the control plot had as many as four soil-borne pathogens -Pythium, Rhizoctonia, Sclerotium and Fusarium spp. Use of richo-compost and Tricho-leachate also reduced the infestation of root-knot nematode by about 80.7% to 91.0%. The results clearly showed that use of Tricho-compost and Tricho-leachate is highly effective for production of healthy cabbage seedlings. DOI: http://dx.doi.org/10.3329/bjar.v37i4.14390 Bangladesh J. Agril. Res. 37(4): 653-664, December 2012