Search

Ethnopharmacological relevance Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. Aim of the study To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Camptothecin (CPT), a monoterpene alkaloid, is an important anti-cancer compound obtained from several plant sources including Camptotheca acuminta (from China) and Nothapodytes nimmoniana (from India). Currently, by far the highest levels of CPT (approximately 0.3% w/w) are reported from Nothapodytes nimmoniana, a small tree distributed in the Western Ghats, India. In recent years because of the heavy demand, there has been a serious threat of extinction of the populations of the tree in the Western Ghats forest of south India. Several studies have chemically profiled populations of the species in the Western Ghats to identify sources of high yield and therefore to enable the sustainable production and harvesting of CPT. In this study, using both high-performance liquid chromatography and liquid chromatography-mass spectrometry, we report for the first time the identification of trees that produce at least 5- to 8-fold more CPT than hitherto reported. Furthermore, we show for the first time the production of a few minor camptothecines, including 10-hydroxy camptothecin, in the stem and root bark extracts of the tree. These results have important implications for not only harnessing the high-yielding individuals for clonal multiplication but also for exploiting some of the minor camptothecines, which also have been shown to have important anti-cancer and anti-viral activity.

Sustainable harvesting of non-timber forest products (NTFPs) and associated livelihood security can be affected by forest disturbances additional to harvesting. Amla (Phyllanthus emblica and Phyllanthus indofischeri) is a locally and nationally significant NTFP in India, exploited for its fruit. We examined the infection of these two species by a hemiparasitic mistletoe and investigated two alternative management approaches. Forest surveys, mistletoe removal experiments and seed deposition surveys were employed to assess the prevalence of mistletoe infection, characteristics of infection in relation to resource value and the appropriateness of local versus institutional management approaches. The results suggest mistletoe infection is widespread in the study site, affecting over half of the Amla population, and in particular those reproductive trees important for population persistence. Infection characteristics and resource values differ between the two Phyllanthus species, having significant implications for Amla collectors. Institutional perspectives on the management of this species conflict with local practice. Cutting of branches by collectors has previously been considered destructive, but may in fact have management benefits in terms of increased productivity through re-sprouts and reduced risk of mistletoe infection. However, neither mistletoe removal by hand, nor branch cutting appear to offer a viable control strategy in isolation. A multifarious strategy including new approaches to management is needed to safeguard the role of this resource in local livelihoods.

Summary Cross-species amplification of microsatellite loci is considered to be a time-saving as well as a cost-effective approach for developing locus specific markers for new species. In an attempt to identify molecular markers to determine gene flow events and genetic differentiation of populations in rattans, microsatellite primer pairs developed for Cocos nucifera (Arecaceae) were examined for cross-species amplification in rattans. Of the six microsatellite primer pairs screened, two (CNZ34 and CN2A5) yielded good cross-species amplification across different rattan genera and species from South and Southeast Asia. Based on microsatellite-specific PCR amplification products, cluster analysis was performed. The dendrogram indicated a clear grouping of rattans based on their genera and species. The coconut locus specific primer pairs could be successfully used to construct molecular differentiation of rattan genera across different geographical locations.

Sexual Selection in Plants: The Process, Components and Significance

Santalum album L. is an economically important tropical tree species. Owing to extensive logging, changes in land-use patterns and poor natural regeneration, the natural sandal populations are rapidly dwindling. It is feared that such threats could easily undermine the genetic diversity of sandal populations. Effective measures to prevent such loss are prerequisite. We have developed baseline data on the levels of genetic diversity and its distribution on a geographic scale for sandal in India. Based on Geographic Information System, distribution map of sandal was developed and found that the populations were geographically more concentrated in the Deccan plateau. It was found that, for past 53 years, there was a monotonic decrease in the extraction of sandal in the state of Karnataka, India. Using allozyme markers, the genetic diversity of 19 sandal populations in peninsular India were determined and over all observed heterzygosity (Ho) was found to be 31%. The percent Ho was positively correlated with the density of the sandal populations (r = 0.44) and with increasing longitude it was found to be negatively correlated (r = −0.51). The dendrogram analysis indicated a clear clustering of sandal populations based on their geographic occurrence. The Deccan plateau populations were found to be genetically the most diverse and seemed to represent the ‘hot-spot’ of sandal genetic resources in peninsular India. Our results have important implications for the conservation strategies for sandal populations in peninsular India and can be applied for the conservation of other taxa as well.

Although conservation and management of tropical ecosystems requires that we understand the threats to these areas, there are no standardized methods to quantify threats to ecosystems. We used a geographic information system-based protocol with several physical and socioeconomic attributes to assess the threats to a protected area, a wildlife sanctuary in southern India. Physical attributes included threats from major and minor roads and the accessibility of an area (given as inverse of the slope of the area), and socioeconomic attributes included the number of human settlements and human, cattle, and sheep populations. We divided the sanctuary into 30-ha grids, and for each grid we computed three threat categories: (1) settlement-associated threat from humans, cattle, and sheep; (2) development-associated threat resulting from major and minor roads; and (3) accessibility-related threat caused by the steepness of the terrain. Combining all three threats, we derived a composite threat index for each grid and mapped five levels of threats in the sanctuary. We collected data on human activities, tree species richness, and diversity in the transects laid in areas corresponding to these five threat levels. Although the threat levels of the transects were strongly correlated with the human-related disturbance activities, the composite threat indices of the transects were negatively correlated with tree species richness, indicating that the threat values we derived served as a good surrogate of the actual threat experienced by the sanctuary. With appropriate modifications, the protocol developed here can be applied to other ecosystems as well. Resumen: La conservacion y manejo de ecosistemas tropicales requiere que entendamos las amenazas a esas areas. Sin embargo, no hay metodos estandarizados para cuantificar las amenazas a los ecosistemas. Utilizamos un protocolo basado en SIG con varios atributos fisicos y socioeconomicos para evaluar las amenazas a un area protegida, un santuario de vida silvestre en el sur de India. Los atributos fisicos incluyeron amenazas de caminos mayores y menores y accesibilidad de un area (como el inverso de la pendiente del area), y los atributos socioeconomicos incluyeron el numero de asentamientos humanos y las poblaciones humanas, de ganado y ovejas. Dividimos al santuario en parcelas de 30 ha, y en cada parcela computamos tres categorias de amenaza: (1) amenaza de humanos, ganado y ovejas asociada con asentamientos, (2) amenaza asociada con desarrollo debido a caminos mayores y menores y (3) amenaza relacionada con accesibilidad debido a la pendiente del terreno. Combinando las tres amenazas, derivamos un indice compuesto de amenaza para cada parcela y mapeamos cinco niveles de amenaza en el santuario. Recolectamos datos sobre actividades humanas, riqueza y diversidad de especies de aves en los transectos ubicados en areas correspondientes a estos cinco niveles de amenaza. Aunque los niveles de amenaza en los transectos estuvieron fuertemente correlacionados con actividades de perturbacion humana, los indices compuestos de amenaza estuvieron correlacionados negativamente con la riqueza de especies de arboles lo que indica que los valores de amenaza que derivamos fueron buen sustituto de la amenazas que hay en el santuario. Con las modificaciones apropiadas, el protocolo desarrollado puede ser aplicado en otros ecosistemas.

1Conservation Genetics, Ashoka Trust for Research in Ecology and the Environment, Royal Enclave, Srirampura, Jakkur Post, Bangalore 560 064, India 2School of Ecology and Conservation, 3Department of Crop Physiology, University of Agricultural Sciences, GKVK Campus, Bangalore 560 065, India 4Biology Department, Concordia University, 7141, Sherbrooke Street West, Montreal, Canada H4B1R6 5Department of Forest Biology and Tree Improvement, College of Forestry, University of Agricultural Sciences, SIRSI campus, Dharwad 581 401, India

Non-timber forest products (NTFPs) constitute the single largest determinant of livelihoods for scores of forest fringe communities and poor people in the tropics. In India over 50 million people are believed to be directly dependent upon NTFPs for their subsistence. However, such human dependence on NTFPs for livelihood gains (win) has most frequently been at a certain ecological cost (lose). If livelihoods are to be maintained, the existing ‘win-lose’ settings have to be steered to a ‘win-win’ mode, otherwise, there could be severe erosion of the biological resources and loss of livelihoods (‘lose-lose’). Examining the dependence of forest fringe communities on NTFPs at three sites in south India with contrasting human and ecological settings, three key factors (extent of dependence on NTFPs, indigenous ecological knowledge and market organization) are likely to constrain reaching the win-win situation. How these factors shape the ecological cost of harvesting NTFPs at the three sites is examined. Within the parameter space of these factors, it is possible to predict outcomes and associations that will conform to win-win or win-lose situations. Empirical data derived from the three study sites demonstrate the causality of the observed associations. The key for long-term livelihood gains lies in reducing the ecological cost. Certain interventions and recommendations that could optimize the balance between livelihood gains and ecological cost are proposed.

The five papers in this Special Section illustrate that pollination processes are often disrupted by changing plant distributions. They further demonstrate that plant pollination and seed production outcomes are highly complex due to multidimensional spatial effects and numerous interactive biological responses of both plants and pollinators at individual and population scales. Nevertheless, these studies also lend support to some emerging generalities that (through modeling) begin to provide a coherent framework by which further research, and ultimately management planning, could proceed.

SUMMARY Factors associated with variation in harvest index and approaches to improve harvest index (HI) and productivity in sunflower are discussed in this article. In recent years, higher productivity in sunflower has been achieved mainly through increased crop growth rates. Besides, an improvement in harvest index also has contributed for improved productivity to a certain extent. In our study we observed that medium duration types (100 to 110 days) had high HI compared with early or long-duration varieties and we also attempted to understand the ways and means to improve HI in sunflower types with varied duration. Genotypes which had low partitioning of dry matter to stem plus thalamus had high HI. Genotypes which accumulated high biomass during post flowering stages of development also showed high HI and seed yield. In a few genotypes remobilization of photosynthates from vegetative plant parts to the seed resulted in high HI and seed yield. Among the sink characters, the number of seed per head, test weight and seed density (weight/volume) also contributed to achieving high HI values. Identification and selection of genotypes based on these criteria will increase the production further. Since large amount of biomass is still locked up in the vegetative plant parts, any practice to manipulate the mobilization of photosynthates from vegetative parts to head also improves HI and thus seed yield. In our experiment, we observed that foliar application of boron nutrient and application of growth regulators to the head improved the translocation of photosynthates to the head and thus increased the HI and seed yield.

There has been a growing concern about the increasing number of species that are globally threatened. Developmental projects, and increased dependence on forests both for sustenance and livelihood have rendered many species threatened. In the Indian context, more than 150 species are critically endangered and require immediate intervention to sustain their populations. A number of plant species are destructively extracted solely from the forests. Apart from anthropogenic threats, several species are threatened due to invasive species and climate change. In the light of increasing and continued threats, species recovery is the only viable option for restoring many of them from extinction. Here, we review the existing recovery programmes in the country and suggest a comprehensive approach in the conservation and recovery of many of the critically endangered species. We highlight issues that need to be addressed and discuss strategies for recovering the critically endangered species in the country.

Correspondance: Molecular Ecology Resources Primer Development Consortium, E-mail: editorial.office@molecol.com; International audience; This article documents the addition of 396 microsatellite marker loci to the Molecular Ecology Resources Database. Loci were developed for the following species: Anthocidaris crassispina, Aphis glycines, Argyrosomus regius, Astrocaryum sciophilum, Dasypus novemcinctus, Delomys sublineatus, Dermatemys mawii, Fundulus heteroclitus,Homalaspis plana, Jumellea rossii, Khaya senegalensis, Mugil cephalus, Neoceratitis cyanescens, Phalacrocorax aristotelis, Phytophthora infestans, Piper cordulatum, Pterocarpus indicus, Rana dalmatina, Rosa pulverulenta, Saxifraga oppositifolia, Scomber colias, Semecarpus kathalekanensis, Stichopus monotuberculatus, Striga hermonthica, Tarentola boettgeri and Thermophis baileyi. These loci were cross-tested on the following species: Aphis gossypii, Sooretamys angouya, Euryoryzomys russatus, Fundulus notatus, Fundulus olivaceus, Fundulus catenatus, Fundulus majalis, Jumellea fragrans, Jumellea triquetra Jumellea recta, Jumellea stenophylla, Liza richardsonii, Piper marginatum, Piper aequale, Piper darienensis, Piper dilatatum, Rana temporaria, Rana iberica, Rana pyrenaica, Semecarpus anacardium, Semecarpus auriculata, Semecarpus travancorica, Spondias acuminata, Holigarna grahamii, Holigarna beddomii, Mangifera indica, Anacardium occidentale, Tarentola delalandii, Tarentola caboverdianus and Thermophis zhaoermii

Conservation Genetics Resources, 5 (2), ISSN:1877-7252, ISSN:1877-7260

Evolutionary Significance of Economy in the Pollen Grain to Ovule Ratio in the Process of Crop Domestication

of size 400 bp have been shownto successfully discriminate members of various taxa. How-ever, the techniqueis notalways successful, as in the case ofmuseumspecimensorsamplesusedinrawdrugtrade,wherethe DNA is often degraded. In this context, recent studieshave suggested the use of shorter stretches of the region,called mini-barcodes, to resolve species identity. The mini-barcodesarerelativelymorestableandeasilyrecoveredfromthedegradedDNA.Inthisstudy,anattempthasbeenmadetocompare the effectiveness of mini-barcodes over full-lengthDNA barcodes in differentiating 16 species of

Lantana camara is a highly invasive plant that has established itself in at least 60 different countries across the world. Here, we report development of ten microsatellite markers for this species. These microsatellite loci have 2–15 alleles per locus; with observed and expected heterozygosity of 0.022–0.833 and 0.336–0.848, respectively. These markers will be useful in addressing a variety of questions about Lantana camara, including those concerning breeding system, pollination and dispersal, genetic variation and population structure.

Multiple actors are typically involved in forest management, namely communities, managers and researchers. In such cases, suboptimal management outcomes may, in addition to other factors, be symptomatic of a divergence in perspectives among these actors driven by fundamental differences in ecological knowledge. We examine the degree of congruence between the understandings of actors surrounding key issues of management concern in three case studies from tropical, subtropical and boreal forests. We identify commonly encountered points of divergence in ecological knowledge relating to key management processes and issues. We use these to formulate seven hypotheses about differences in the bodies of knowledge that frequently underlie communication and learning failures in forest management contexts where multiple actors are involved and outcomes are judged to be suboptimal. Finally, we present a set of propositions to acknowledge and narrow these differences. A more complete recognition of the full triangulation between all actors involved, and of the influence that fundamental differences in ecological knowledge can exert, may help lead to a more fruitful integration between local knowledge and practice, manager knowledge and practice, and contemporary science in forest management.

Rohitukine, a chromone alkaloid, possesses anti-inflammatory, anti-cancer and immuno-modulatory properties. It has been reported from four species, belonging to the families, Meliaceae and Rubiaceae. Stem bark of Dysoxylum binectariferum (Meliaceae) accumulates the highest amount of rohitukine (3-7% by dry weight). In this study, we examine the spatial and temporal distribution of rohitukine and related compounds during various stages of seed development in D. binectariferum using desorption electrospray ionization mass spectrometry imaging (DESI MSI). Rohitukine (m/z 306.2) accumulation increased from early seed development to seed maturity stage. The spatial distribution of rohitukine was largely restricted to the cotyledonary tissue followed by the embryo and least in the seed coat. Besides rohitukine, rohitukine acetate (m/z 348.2) and glycosylated rohitukine (m/z 468.2) were also detected, both through mass fragmentation and exact mass analysis through Orbitrap mass spectrometry. These results indicate a dynamic pattern of chromane alkaloid accumulation through seed development in D. binectariferum. � 2015 Elsevier Ltd. All rights reserved.

Dalbergia sissoo, a wind-dispersed tropical tree, exhibits high intrafruit seed abortion. Of the four to five ovules in the flower, generally one and occasionally two or three develop to maturity. It has been proposed that the seed abortion is a consequence of intense sibling competition for maternal resources and that this competition occurs as an inverse function of the genetic relatedness among the developing seeds. Accordingly, developing seeds compete intensely when they are genetically less related but tend to develop together when genetically more related. We tested this hypothesis by comparing the genetic similarity among the pairs of seeds developing within a pod with that among (a) random pairs from the pool of all seeds, (b) random pairs from single-seeded pods, and (c) random pairs from two-seeded pods, using both randomly amplified polymorphic DNA (RAPD) and isozymes in five trees. We found that the pairs of seeds developing within a pod are genetically more similar than any random pairs of seeds in a tree. Thus the formation of two-seeded pods appear to be associated with increased genetic relatedness among the developing seeds. We discuss the results in the context of possible fitness advantages and then discuss the possible mechanisms that promote tolerance among related seeds.

The Myristicaceae family is a primitive angiosperm family and is characterized by species that are highly endemic to the Western Ghats area of India. Myristica malabarica is confined to the evergreen forests of Western Ghats and Sri Lanka. In this paper we describe for the first time the development of eleven polymorhpic microsatellite markers for Myristica malabarica, which had 2-14 alleles per locus. These microsatellite markers could be used to study the population genetic structure of the species.

Ideally, the estimates of biological diversity of a community of species in a habitat should refer to the biological variation among the species and not merely to their numbers and frequencies. However, the current estimates of biodiversity incorporate only the latter two components but not the biological differences among the species. Ganeshaiah et al. [(1997) Current Science 73: 128–133] have proposed an estimate called the Avalanche Index (AI) that can incorporate the biological heterogeneity among the species in a habitat. This estimate, besides being methodologically simple, can incorporate any quantifiable differences among the species, information on species richness and their frequencies in the habitat. In this paper we have estimated AI for tree vegetation in 14 forest types across different ecosystems of the world and have compared these estimates with other indices being currently used. Through this we have attempted to analyse the relative utility of AI in discriminating the habitats based on their biological heterogeneity by capturing their intra-community biological variation. We discuss the merits and demerits of the AI as a comprehensive estimate of biological diversity.

Ceropegia fantastica L. (Asclepiadaceae) is a highly endemic and endangered species in the Western Ghats of India. Fourteen microsatellite markers were developed for C. fantastica. Eight microsatellite primers screened had 2–5 alleles per locus and the observed and expected heterozygosity ranged from 0.48 to 0.83 and 0.48 to 0.62, respectively. The primers were also evaluated for their cross amplification against two related species Ceropegia hirsuta and Ceropegia oculata. The microsatellites developed for this species could be used for addressing population genetics of this endemic and critically endangered species.

Nothapodytes nimmoniana is a medicinally important tree species that occur in the Western Ghats, a megadiversity hotspot in southern India. Inner stem bark of the tree contains an important anti-cancer alkaloid, camptothecin for which the natural population of the tree is heavily harvested. In this paper, we report the isolation and characterization of eight polymorphic microsatellite loci using enrichment hybridization protocol. Analysis of 36 individuals representing two populations revealed three to 12 alleles per locus. Observed heterozygosity ranged from 0.21 to 0.94 for the two populations. None of the loci tested showed linkage disequilibrium. These markers are invaluable for evaluating the genetic structure and assessing the genetic impacts of harvesting of N. nimmoniana in the Western Ghats to formulate strategies for conservation of the species.

Style length variation in female flowers of monoecious figs has been shown to play an important role in regulating the proportion of flowers that develop into seeds and those that become infested by the pollinator wasp. In this study, we tested the suggestion that style length variation in figs is a consequence of optimal packing of the flowers. We show that optimal packing of flowers in fig syconia will result in a highly skewed distribution of style lengths and a positive skewness of pedicel lengths. These predictions were qualitatively tested in eight species of figs and the results indicate that observed style length distributions did not conform to those expected. We argue that while the pedicel lengths are likely to be a spinoff of optimal packing of the flowers, style lengths are probably shaped by independent selective fotces. The pedicel lengths also are subjected to compensatory growth so as to place the stigmas at a common height in the central cavity for effective pollination of the flowers. This was substantiated by the response (dependence) of pedicels to (on) the length of the style, neck, and other floral features. In all species the coefficient of variation of styles was very consistent (ca 30 %). This is in accordance with expectations if style lengths are shaped to regulate the proportion of flowers for wasp and seed production.

In Pongamia pinnata only one of the two ovules develops into a seed in most of the pods. Since pollen was not found to be limiting and reduced fertilization could not completely explain the observed frequency of seed abortion, it implied an effect of postfertilization factors. Aqueous extracts of developing seeds and maternal tissue (placenta) did not influence abortion in vitro, suggesting that abortion may not be mediated by a chemical. Experimental uptake of 14C sucrose in vitro indicated that both the stigmatic and the peduncular seed have similar inherent capacities of drawing resources, but the peduncular seed is deprived of resources in the presence of the stigmatic seed. This deprivation of the peduncular seed could be offset by supplying an excess of hormones leading to the subsequent formation of two seeds in a pod. The prevalence of single-seeded pods in P. pinnata seems therefore to be a result of competition between the two seeds for maternal resources. The evolutionary significance of single-seeded pods in P. pinnata is discussed with respect to possible dispersal advantage enjoyed by such pods.

The Indian monsoons are a major seasonal climatic event over the Indian subcontinent, heralding the arrival of the wet season. Many features of life, biological and cultural, are intimately synchronized to this seasonality. In this paper, we show that the Indian monsoons might have played an important role in shaping the fruiting time and hence dispersal phenology of plant species in the subcontinent.

The distribution of endophytes (fungal and bacterial) is ubiquitous and almost without exception; the endophytes have been reported from all tissues, including leaves, stems, roots, flowers and fruits. As typical symptomless organisms, in contrast to their pathogenic counterparts, they pose a serious challenge in explaining their continued maintenance in plants. How do plants tolerate them? And how do the endophytes contain the plant defences? But a more intriguing and enigmatic issue with many endophytes is the fact that they mimic the production of specific plant-associated secondary metabolites (e.g. taxol, camptothecin and rohitukine) in culture, independent of the host tissue. Several theories including the possibility of horizontal gene transfer from the respective hosts have been proposed, but none has so far been supported. In this paper, we critically review studies on endophytes producing plant secondary metabolites and explore the possible molecular mechanisms. By analysing the pathway genes for a few major metabolites, including taxol and camptothecin, we show that a far more intricate molecular mechanism might be involved in the production of the secondary metabolites by the endophytes. We show that these molecular mechanisms could have arisen through the evolutionary interactions of the endophytes with their respective host plants. We discuss these findings in the context of the current interest in harnessing endophytes as alternative sources of plant secondary metabolites.

Dalbergia sissoo, a tropical tree with wind-dispersed pods, exhibits a highly positively skewed distribution of seeds per pod with predominantly only one of the four or five ovules maturing into seed. The abortion cannot be attributed to lack of pollen or resources. This study examines the hypothesis that the abortion is due to an intense rivalry among the developing sibs to gain dispersal advantage. Aqueous extract of the dominant embryos at the stigmatic end that generally develop to maturity significantly inhibited the uptake of labelled sucrose by the young developing (subject) embryos in an in vitro assay system. Extracts of tissues such as subordinate (peduncular embryos), unfertilized ovules and pod coat did not cause such inhibition. Aqueous diffusate of dominant embryos also inhibited the uptake of labelled sucrose by subject embryos. The chemical substance responsible for the inhibition appears to be heat-stable and non-proteinaceous. HPLC analysis indicated the presence of two retention time peaks, different from that of standard indole acetic acid, but with considerable overlap. We hypothesize that the compound could be an indole derivative. We propose that the stigmatic embryos have a head start due to earlier fertilization and produce a chemical that either directly (by metabolically killing) or indirectly (by preventing the uptake of assimilates) kills the proximally placed peduncular embryos.

Sustainable extraction of non-timber forest products (NTFPs) has recently gained considerable attention as a means to enhance rural incomes and conserve tropical forests. However, there is little information on the amounts of products collected per unit area and the impact of extraction on forest structure and composition. In this paper we estimate the quantities of selected products gathered by the Soligas, the indigenous people in the Biligiri Rangaswamy Temple (BRT) sanctuary in Karnataka, India, and examine the effect of extraction on forest structure and composition. Two sites, distant (DS) and proximal (PS), were identified based on the proximity to a Soliga settlement. The frequency of different size classes indicates that regeneration overall is poor in the area. The two sites show differences in species richness, basal area, and tree mortality. Furthermore, non-timber forest product species show a greater deficit of small size classes than the timber forest species, suggesting that regeneration is affected by collection of seeds and fruits from non-timber forest product species. Regeneration, however, may also be affected by other anthropogenic pressures such as fire, grazing and competition with weeds.

Sustainable extraction of non-timber forest products (NTFPs) depends upon harvesting a small fraction of the total productivity. Over-exploitation can lead to a loss of biodiversity, but a low level of extraction, without value addition at the point of origin, is usually not economically feasible for extractors. Extraction and productivity levels per unit area for most non-timber forest products are unknown, nor do we have much information about value addition at various points in the marketing channels. Here we determine extraction and productivity levels for Amla trees (Phyllanthus emblica), which yield fruits that are used for a wide variety of purposes in preparation of various foods, beverages and medicines. We also present preliminary data on the price appreciation of the fruit for one of the processed products. We have determined that the current level of extraction, 60-80% of all fruits at the population level, may have a negative effect on new recruitment. We present a model for value addition that has the potential to enhance income and reduce the level of extraction. This model is currently being implemented by the Soliga community with the assistance of a non-governmental organization.

The possible causes of low seed set in Syzygium cuminii, a woody tree bearing flowers with many ovules but fruits with single seeds, have been investigated. Pollen grain limitation and lack of fertilization do not completely explain the single seededness of fruits indicating the involvement of postfertilization factors. Developing ovules exhibited a clear pattern during the early fruit growth, and only one of the ovules eventually matured into a seed. Aqueous extracts of developing ovules significantly increased the rate of abortion of the other ovules in vitro, but the extent of abortion caused by aqueous extracts of maternal tissues from fertilized flowers did not differ from the control, implying that the developing ovules may produce a factor that causes the abortion of other ovules. Silver thiosulfate, an ethyleneaction inhibitor, significantly reduces the rate of such developing-ovule-mediated abortion in vitro as well as in vivo This study indicates that abortion in S. cuminii is mediated by chemic...

The evolution of endosperm, the tissue that nourishes developing embryos, has remained an enigma owing to its unique genetic composition. Because it contains both maternal (generally 2 doses) and paternal (1 dose) genomes, it is suggested to have evolved as a compromising tissue between the evolutionary interests of the maternal parent and offspring over resource allocation. This argument implies that in species where endosperm is highly functional and persistent, it quenches competition among developing embryos for resources and facilitates an equitable resource allocation to the developing offspring. Based on this argument we predict the association of well developed endosperm with certain features of fruits such as high ovule number per ovary and low extent of seed abortion. In this paper, we provide evidence in support of these predictions by analysing the data from 1131 species from the Flora of Presidency of Madras. We show that persistent and functional endosperm is more frequent in multiovulated than in uniovulated species and in species with less seed abortion. Our results also suggest that species with well developed endosperm tend to have uni-carpelled ovaries. Our analyses show that these associations are less likely to be emerging due to phylogenetic constraints. We argue that the endosperm has evolved as a maternal strategy of quenching the extent of sibling rivalry.

Differential development of seeds and their abortion in multi-ovulated fruits is explained by a process of self-organized movement of resource units into the developing ovules. This process involves movement of resource units would be autocatalytically favored and hence dominate over others at a rate defined by the sink-drawing ability of the ovules of a species. Such a process leads to varying levels of seed abortion that are independent of resource or pollen limitation and also predicts a positive relationship between the sink-drawing ability of a species and the extent of seed abortion in its fruits. We tested this prediction by (1) manipulating the sink-drawing ability of ovules in phaseolus vulgaris Linn., Vigna unguiculata Walp., Crotolaria medicaginea Lam., and Solanum seaforthianum Andr.; (2) analyzing the relationship between the in vivo sink-drawing ability and seed abortion in 15 species; and (3) using data from the literature. Our results seem to indicate that, as sink-drawing ability of ovule...

Measurement of total leaf area per plant in crop improvement programmes for a variety of purposes is often very tedious and time consuming. In this paper, we offer a rapid and non-destructive method of estimating the total leaf area in sunflower at the time of anthesis. We show that multiplying the leaf area of a specific leaf position from the apex by the total number of leaves per plant yields total leaf area with more than 95 % accuracy. The specific leaf position for any given genotype in sunflower can be arrived at by multiplying the total number of leaves per plant by the factor 0.355 and rounding off to the nearest highest integer. This technique can be used for the rapid estimation of leaf area per plant at anthesis for any given genotype of sunflower.

Differential development of sinks that depend on a common resource pool has been viewed as a consequence of an autocatalytic feedback process of flow of resource units into them. The feed-back process implies that the stronger a sink is relative to its competitors, the greater is its probability of getting further resources as a non-linear function of its resource drawing ability and sink size. We show that this model contrasts with that of the sink-strength dependent model in its prediction of the subsequent development of the initial asymmetry of growing leaves when their resource drawing ability is enhanced. By artificially enhancing the resource drawing ability of the leaves of Mestha (Hibiscus cannabinus L.) by external application of growth regulators, we test these predictions and show that the results are in conformity with the autocatalytic model proposed by Ganeshaiah and Uma Shaanker.

Monoecious figs reward their pollinators—agaonid wasps—by allocating a proportion of the flowers for egg laying, and retain the rest for seed production. It has been suggested that these proportions could be regulated by producing short-styled and long-styled flowers such that pollinator wasps could only use the former as their ovipositor does not reach the ovules of the latter. Thus the wasps can lay eggs only in the short-styled flowers and raise their offspring, and the ovules of uninfested, long-styled flowers can develop into seeds. This implied that figs bear dimorphic female flowers, with a bimodal distribution of style length. However, recent studies have shown that style length is distributed normally, with no evidence of bimodality. Therefore the regulation of allocation of flowers to the wasps does not seem to be through the production of two distinct kinds of female flowers. In this article we suggest that two factors govern the proportion of flowers rewarded to the wasps: (i) passive regulation, which is a consequence of the optimization of wasp ovipositor length, and (ii) active regulation, where figs are selected to enhance the variance of style length. We show that these arguments lead to certain predictions about the optimum ovipositor length, the proportion of the flowers available to the wasps, and the coefficient of variation of style length. We also show that data for 18 fig-wasp associations conform well with these predictions. We finally suggest that the regulatory process outlined here can be extended to evolution of style length in dioecious fig species also.

It is suggested that maternal parent and offspring have conflicting interests over the extent of resource allocation to developing seeds. While maternal parent would be selected to allocate her resources optimally among her offspring, the latter would be selected to demand more. In animals, offspring are known to demand additional resources either visibly (through intense vocal calls) or subtly through the production of hormones. In plants though parent offspring conflict over resource allocation has been invoked, the mechanism through which the parent and offspring interact in regulating resource allocation into developing seeds is not yet clear. In this paper, we propose that the strategies and counter-strategies of the offspring and mother during the development of seeds might be manifested through the production of appropriate growth hormones. Accordingly, we predict (i) hormones that mobilize resources into seeds (e.g. auxins and gibberellic acid) shall be synthesized exclusively by the offspring tissue and (ii) hormones that inhibit resource flow in to seeds (e.g. abscisic acid) be produced exclusively by the maternal tissue. We show that these predictions are supported by existing literature on the temporal dynamics and source of production of growth hormones during seed development. Finally, we suggest that such analysis viewing the production of different hormones during early seed development, as strategies and counter-strategies of mother and offspring tissue, helps ofer a meaningful interpretation of the otherwise complex dynamics of hormone fluxes.

In this study, the production of camptothecine and its derivatives, in thirteen species of the family Icacinaceae, namely, Apodytes dimidiata , Codiocarpus andamanicus , Gomphandra comosa , Gomphandra coriacea , Gomphandra polymorpha , Gomphandra tetrandra , Iodes cirrhosa , Iodes hookeriana , Miquelia dentata , Miquelia kleinii , Natsiatum herpeticum , Pyrenacantha volubilis and Sarcostigma kleinii is reported. Seeds of M. dentata were found to produce the highest content of camptothecine (1.0–1.4% by dry weight of seeds). Full scan LC–MS and ESI-MS/MS analysis of M. dentata revealed, besides camptothecine, a number of other derivatives, namely, 10-hydroxycamptothecine, 9-methoxycamptothecine, 20-deoxycamptothecine. Crude extract preparations of the seeds of M. dentata were effective against a breast cancer cell line (IC 50 = 3.82 μg/ml for MDA MB273 cell lines) and two ovarian cancer cell lines (IC 50 = 2.8 μg/ml for NCI/ADR-RES and 4.5 μg/ml for SKOV). These results are the first reports of camptothecine and its derivatives in these species and offer rich alternative plant sources for the anticancer compound, camptothecine.

Fruit and seed abortion in plants have been traditionally attributed to limiting factors such as resources or to chemically mediated dominance hierarchy among the developing sinks. These hypotheses however do not satisfactorily explain the observed patterns of seed and fruit abortion and have also not withstood the test of critical experimentation. In this paper, we propose an alternative model based on the process of self organization used in physics to explain the flow of liquids etc. As proposed here, the model assumes one simple rule, that the probability of any given sink getting a resource molecule is a function of (a) the sink-drawing ability of each unit of the tissue and (b) the amount of resource molecules already moved to that sink. Accordingly, any resource molecule moving to a sink, autocatalytically increases the probability of the latter getting further resources. We show that starting from a set of identical sinks, all with equal sink-drawing ability, the differential development of sinks and thence their abortion might occur purely as a consequence of the autocatalytic or feedback movement of the resource molecules to the developing sinks. We also show that, such a process can lead to abortion even under resource-abundant conditions, though resource limitation aggravates the extent of abortion. Further, the extent of abortion is shown to be highly dependent on the sink-drawing ability of the species. We offer the test of this prediction in two ways: (a) in Derris indica the extent of abortion increases with the sink drawing ability of the fertilized ovules and (b) treatments involving growth regulators that increase the sink-drawing ability result in increased abortion of seeds and fruits. Based on these, we argue that self organization could be the basic process regulating resource flow to sinks and factors such as resource limitation and chemical inhibition might be additionally aggravating the asymmetry among the developing sinks.

The styles of flowers may represent an arena for pollen competition in the race to fertilize ovules. Accordingly, selection should favour a longer 'race' to better discriminate among variable pollen by increasing style length. Sampling across a taxonomically diverse range of wild and outcrossed species, we found that the distribution of style lengths within plants were skewed towards longer styles, as predicted. In self-pollinated domesticated species, where discrimination among pollen is less important, we found no such pattern. We conclude that style length is under directional selection towards longer styles as a mechanism for mate choice among pollen of variable quality.

In view of the recent debate on the future of invasion biology, we argue that species could be regarded as invasive only when after adaptation in non-native habitats they reach yet another fitness maximum. We suggest that invasion biologists need to unambiguously clarify what constitutes being “invasive” to refute those who call for an end to invasion biology.

Camptothecin (CPT), a monoterpene indole alkaloid, is a potent inhibitor of eukaryotic toposiomerase-I. Several derivatives of CPT are in clinical use against ovarian and lung cancers. CPT has been reported from several plant species belonging to the order Asterids, with the highest concentration in Nothapodytes nimmoniana (family Icacinaceae). In this paper, we report an intriguing observation of chrysomelid beetles (Kanarella unicolor Jacobby) feeding on the leaves of N. nimmoniana without any apparent adverse effect. LC-MS/MS analysis of the beetles indicated that 54.9% of the ingested CPT’s was recovered from the wings, followed by lesser amounts in the head and abdomen. LC-HRMS analysis revealed that most of the CPT in the insect body was in the parental form available in the plants without any major metabolizable products, including sulfated and glucuronilated forms. The mechanism by which the beetles are able to tolerate substantially high levels of CPT in their body tissue is under investigation.

Biological diversity and its constituent chemical diversity have served as one of the richest sources of bioprospecting leading to the discovery of some of the most important bioactive molecules for mankind. Despite this excellent record, in the recent past, however, bioprospecting of biological resources has met with little success; there has been a perceptible decline in the discovery of novel bioactive compounds. Several arguments have been proposed to explain the current poor success in bioprospecting. Among them, it has been argued that to bioprospect more biodiversity may not necessarily be productive, considering that chemical and functional diversity might not scale with biological diversity. In this paper, we offer a critique on the current perception of biodiversity and chemodiversity and ask to what extent it is relevant in the context of bioprospecting. First, using simple models, we analyze the relation among biodiversity, chemodiversity and functional redundancies in chemical plans of plants and argue that the biological space for exploration might still be wide open. Second, in the context of future bioprospecting, we argue that brute-force high throughput screening approaches alone are insufficient and cost ineffective in realizing bioprospecting success. Therefore, intelligent or non-random approaches to bioprospecting need to be adopted. We review here few examples of such approaches and show how these could be further developed and used in the future to accelerate the pace of discovery.

5 pages; International audience; This article documents the addition of 411 microsatellite marker loci and 15 pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Acanthopagrus schlegeli, Anopheles lesteri, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus oryzae, Aspergillus terreus, Branchiostoma japonicum, Branchiostoma belcheri, Colias behrii, Coryphopterus personatus, Cynogolssus semilaevis, Cynoglossus semilaevis, Dendrobium officinale, Dendrobium officinale, Dysoxylum malabaricum, Metrioptera roeselii, Myrmeciza exsul, Ochotona thibetana, Neosartorya fischeri, Nothofagus pumilio, Onychodactylus fischeri, Phoenicopterus roseus, Salvia officinalis L., Scylla paramamosain, Silene latifo, Sula sula, and Vulpes vulpes. These loci were cross-tested on the following species: Aspergillus giganteus, Colias pelidne, Colias interior, Colias meadii, Colias eurytheme, Coryphopterus lipernes, Coryphopterus glaucofrenum, Coryphopterus eidolon, Gnatholepis thompsoni, Elacatinus evelynae, Dendrobium loddigesii Dendrobium devonianum, Dysoxylum binectariferum, Nothofagus antarctica, Nothofagus dombeyii, Nothofagus nervosa, Nothofagus obliqua, Sula nebouxii, and Sula variegata. This article also documents the addition of 39 sequencing primer pairs and 15 allele specific primers or probes for Paralithodes camtschaticus.

"Many forest communities possess considerable knowledge of the natural resources they use. Such knowledge can potentially inform scientific approaches to management, either as a source of baseline data to fill information gaps that cannot otherwise be addressed or to provide alternative management approaches from which scientists and managers might learn. In general, however, little attention has been given to the relevance of quantitative forms of such knowledge for resource management. Much discussion has focused on the integration of traditional ecological knowledge (TEK) into management, but less attention has been paid to identifying specific areas where it is most useful and where it may be most problematic. We contrasted scientific data with information from TEK in the context of a threat to the sustainable harvesting of a nontimber forest product (NTFP) of livelihood importance in southern India, specifically, a fruit tree infected by mistletoe. The efficiency of deriving information from NTFP harvesters compared to scientific field studies was assessed. We further evaluated the potential of TEK to provide novel solutions to the management problem in question, the degree to which TEK could provide quantitative information, and the biases that might be associated with information derived from TEK. TEK complemented previously gathered ecological data by providing concordant and additional information, but also contradicted some results obtained using a scientific approach. TEK also gave a longer-term perspective with regard to NTFP harvesting patterns. Combining information on historical and current harvesting trends for the NTFP with official data suggests that current assessments of sustainability may be inaccurate and that the use of diverse information sources may provide an effective approach to assessing the status of harvested resources."

This chapter argues that solutions to the management of invasive species need to be reworked to take into account the fact that invasive species can impact human livelihoods both negatively and positively. Besides the existing strategies for the management of invasive species, there is a need for alternative strategies in terms of the net benefit they yield, taking of course all benefits and costs into account. A specific case of control of invasive species in largely tropical landscapes is considered, with the attendant problems of human dependence on natural resources as well as lack of investment portfolios to control invasive species. Management strategies are proposed that promote use of the invasive as a way of minimizing the net costs of the invasive species.