Search

Poplar stands as one of the primary afforestation trees globally. We successfully generated transgenic poplar trees characterized by enhanced biomass under identical nutrient conditions, through the overexpression of the pivotal nitrogen assimilation gene, pxAlaAT3. An environmental risk assessment was conducted for investigate the potential changes in rhizosphere soil associated with these overexpressing lines (OL). The results show that acid phosphatase activity was significantly altered under ammonium in OL compared to the wild-type control (WT), and a similar difference was observed for protease under nitrate. 16SrDNA sequencing indicated no significant divergence in rhizosphere soil microbial community diversity between WT and OL. Metabolomics analysis revealed that the OL caused minimal alterations in the metabolites of the rhizosphere soil, posing no potential harm to the environment. With these findings in mind, we anticipate that overexpressed plants will not adversely impact the surrounding soil environment.

The mutualistic interaction between ectomycorrhizal fungi and trees is characterized by the coordinated exchange of soil nutrients with soluble sugars. Despite the importance of this process, the precise mechanism by which sugars are transported from host roots to colonizing hyphae remains unclear. This study aimed to identify the specific membrane transporters responsible for the unloading of sugars at the symbiotic interface, with a focus on the role of the root Sugars Will Eventually Be Exported Transporter (SWEET) uniporters. Our study used RNA sequencing and quantitative PCR to identify PtaSWEET gene expression in Populus tremula × alba-Laccaria bicolor ectomycorrhizal root tips. Our results suggest that symbiosis-induced PtaSWEET1c is primarily responsible for transporting glucose and sucrose, as demonstrated by the yeast assays. Moreover, we used a promoter-YFP reporter to confirm the localization of the PtaSWEET1c expression in cortical cells of ectomycorrhizal rootlets, supporting its major role in supplying glucose at the symbiotic interface. Furthermore, our observations confirmed the localization of PtaSWEET1c-GFP in the plasma membrane. The inactivation of PtaSWEET1c reduced ectomycorrhizal root formation and 13 C translocation to ectomycorrhizal roots. Our findings highlight the crucial role of PtaSWEET1c in facilitating glucose and sucrose transport at the symbiotic interface of Populus-L. bicolor symbiosis., (© 2024 The Author(s). New Phytologist © 2024 New Phytologist Foundation.)

Expansins are cell wall (CW) proteins that mediate the CW loosening and regulate salt tolerance in a positive or negative way. However, the role of Populus trichocarpa expansin A6 (PtEXPA6) in salt tolerance and the relevance to cell wall loosening is still unclear in poplars. PtEXPA6 gene was transferred into the hybrid species, Populus alba × P. tremula var. glandulosa (84K) and Populus tremula × P. alba INRA '717-1B4' (717-1B4). Under salt stress, the stem growth, gas exchange, chlorophyll fluorescence, activity and transcription of antioxidant enzymes, Na + content, and Na + flux of root xylem and petiole vascular bundle were investigated in wild-type and transgenic poplars. The correlation analysis and principal component analysis (PCA) were used to analyze the correlations among the characteristics and principal components. Our results show that the transcription of PtEXPA6 was downregulated upon a prolonged duration of salt stress (48 h) after a transient increase induced by NaCl (100 mM). The PtEXPA6 -transgenic poplars of 84K and 717-1B4 showed a greater reduction (42-65%) in stem height and diameter growth after 15 days of NaCl treatment compared with wild-type (WT) poplars (11-41%). The Na + accumulation in roots, stems, and leaves was 14-83% higher in the transgenic lines than in the WT. The Na + buildup in the transgenic poplars affects photosynthesis; the activity of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT); and the transcription of PODa2 , SOD [Cu-Zn] , and CAT1 . Transient flux kinetics showed that the Na + efflux of root xylem and leaf petiole vascular bundle were 1.9-3.5-fold greater in the PtEXPA6 -transgenic poplars than in the WT poplars. PtEXPA6 overexpression increased root contractility and extensibility by 33% and 32%, indicating that PtEXPA6 increased the CW loosening in the transgenic poplars of 84K and 717-1B4. Noteworthily, the PtEXPA6 -promoted CW loosening was shown to facilitate Na + efflux of root xylem and petiole vascular bundle in the transgenic poplars. We conclude that the overexpression of PtEXPA6 leads to CW loosening that facilitates the radial translocation of Na + into the root xylem and the subsequent Na + translocation from roots to leaves, resulting in an excessive Na + accumulation and consequently, reducing salt tolerance in transgenic poplars. Therefore, the downregulation of PtEXPA6 in NaCl-treated Populus trichocarpa favors the maintenance of ionic and reactive oxygen species (ROS) homeostasis under long-term salt stress.

Modification of lignin in feedstocks via genetic engineering aims to reduce biomass recalcitrance to facilitate efficient conversion processes. These improvements can be achieved by expressing exogenous enzymes that interfere with native biosynthetic pathways responsible for the production of the lignin precursors. In planta expression of a bacterial 3-dehydroshikimate dehydratase in poplar trees reduced lignin content and altered the monomer composition, which enabled higher yields of sugars after cell wall polysaccharide hydrolysis. Understanding how plants respond to such genetic modifications at the transcriptional and metabolic levels is needed to facilitate further improvement and field deployment. In this work, we acquired fundamental knowledge on lignin-modified poplar expressing 3-dehydroshikimate dehydratase using RNA-seq and metabolomics. The data clearly demonstrate that changes in gene expression and metabolite abundance can occur in a strict spatiotemporal fashion, revealing tissue-specific responses in the xylem, phloem, or periderm. In the poplar line that exhibited the strongest reduction in lignin, we found that 3% of the transcripts had altered expression levels and ~19% of the detected metabolites had differential abundance in the xylem from older stems. The changes affected predominantly the shikimate and phenylpropanoid pathways as well as secondary cell wall metabolism, and resulted in significant accumulation of hydroxybenzoates derived from protocatechuate and salicylate., (© The Author(s) 2024. Published by Oxford University Press on behalf of the Society for Experimental Biology.)

The BTB (Broad-complex, tramtrack, and bric-a-brac) gene family, characterized by a highly conserved BTB domain, is implicated in a spectrum of biological processes, encompassing growth and development, as well as stress responses. Characterization and functional studies of BTB genes in poplar are still limited, especially regarding their response to hormones and biotic/abiotic stresses. In this study, we conducted an HMMER search in conjunction with BLASTp and identified 95 BTB gene models in Populus trichocarpa . Through domain motif and phylogenetic relationship analyses, these proteins were classified into eight families, NPH3, TAZ, Ankyrin, only BTB, BACK, Armadillo, TPR, and MATH. Collinearity analysis of poplar BTB genes with homologs in six other species elucidated evolutionary relationships and functional conservations. RNA-seq analysis of five tissues of poplar identified BTB genes as playing a pivotal role during developmental processes. Comprehensive RT-qPCR analysis of 11 BTB genes across leaves, roots, and xylem tissues revealed their responsive expression patterns under diverse hormonal and biotic/abiotic stress conditions, with varying degrees of regulation observed in the results. This study marks the first in-depth exploration of the BTB gene family in poplar, providing insights into the potential roles of BTB genes in hormonal regulation and response to stress.

The acquisition of nutrients from host plants by phytopathogenic fungi is critically important for their invasion success. Melampsora larici-populina, an obligate biotrophic pathogenic fungus, causes the poplar leaf rust disease and can severely damage host poplar plants. Previously, we found that oligopeptide transporters (OPTs) have undergone a convergent expansion, which might reflect adaptation to a phytoparasitic lifestyle. Here, we used various methods to evaluate this hypothesis, including conserved motif identification, positive selection signal mining, expression pattern clustering analysis, and neutral selection tests. The motif composition of the five clades in the OPT family differed, and positive selection was observed during clade differentiation. This suggests that OPTs in these five clades may be functionally differentiated, which would increase the range of transported substrates and promote the absorption of more types of nitrogen compounds from the hosts. According to clustering analysis of gene expression patterns, the expression of most genes from the two expanded clades (clade 2 and 4) was up-regulated during the infection of poplar trees, indicating that the expansion of OPTs likely occurred to promote the uptake of oligopeptides from host poplar plants. The MellpOPT4g gene was determined to be under significant balancing selection based on the neutral selection tests, suggesting that it plays a role in the pathogenic process. In conclusion, these three observations provide preliminary evidence supporting our hypothesis, as they indicate that the expansion of OPTs in M. larici-populina has aided the ability of this pathogen to acquire nutrients from host plants., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Climate change poses a significant threat to global agriculture, necessitating innovative solutions. Plant synthetic biology, particularly chloroplast engineering, holds promise as a viable approach to this challenge. Chloroplasts present a variety of advantageous traits for genetic engineering, but the development of genetic tools and genetic part characterization in these organelles is hindered by the lengthy time scales required to generate transplastomic organisms. To address these challenges, we have established a versatile protocol for generating highly active chloroplast-based cell-free gene expression (CFE) systems derived from a diverse range of plant species, including wheat (monocot), spinach, and poplar trees (dicots). We show that these systems work with conventionally used T7 RNA polymerase as well as the endogenous chloroplast polymerases, allowing for detailed characterization and prototyping of regulatory sequences at both transcription and translation levels. To demonstrate the platform for characterization of promoters and 5' and 3' untranslated regions (UTRs) in higher plant chloroplast gene expression, we analyze a collection of 23 5'UTRs, 10 3'UTRs, and 6 chloroplast promoters, assessed their expression in spinach and wheat extracts, and found consistency in expression patterns, suggesting cross-species compatibility. Looking forward, our chloroplast CFE systems open new avenues for plant synthetic biology, offering prototyping tools for both understanding gene expression and developing engineered plants, which could help meet the demands of a changing global climate.

Background: Populus spp. is a crucial fast-growing and productive tree species extensively cultivated in the mid-latitude plains of the world. However, the impact of intensive cultivation management on gene expression in plantation remains largely unexplored., Results: Precision water and fertilizer-intensive management substantially increased key enzyme activities of nitrogen transport, assimilation, and photosynthesis (1.12-2.63 times than CK) in Populus × euramericana 'Neva' plantation. Meanwhile, this management approach had a significant regulatory effect on the gene expression of poplar plantations. 1554 differential expression genes (DEGs)were identified in drip irrigation (ND) compared with conventional irrigation. Relative to ND, 2761-4116 DEGs, predominantly up-regulated, were identified under three drip fertilization combinations, among which 202 DEGs were mainly regulated by fertilization. Moreover, drip irrigation reduced the expression of cell wall synthesis-related genes to reduce unnecessary water transport. Precision drip and fertilizer-intensive management promotes the synergistic regulation of carbon and nitrogen metabolism and up-regulates the expression of major genes in nitrogen transport and assimilation processes (5 DEGs), photosynthesis (15 DEGs), and plant hormone signal transduction (11 DEGs). The incorporation of trace elements further enhanced the up-regulation of secondary metabolic process genes. In addition, the co-expression network identified nine hub genes regulated by precision water and fertilizer-intensive management, suggesting a pivotal role in regulating the growth of poplar., Conclusion: Precision water and fertilizer-intensive management demonstrated the ability to regulate the expression of key genes and transcription factor genes involved in carbon and nitrogen metabolism pathways, plant hormone signal transduction, and enhance the activity of key enzymes involved in related processes. This regulation facilitated nitrogen absorption and utilization, and photosynthetic abilities such as light capture, light transport, and electron transport, which faintly synergistically regulate the growth of poplar plantations. These results provide a reference for proposing highly efficient precision intensive management to optimize the expression of target genes., (© 2024. The Author(s).)

Tension wood is a specialized xylem tissue associated with gravitropism in angiosperm trees. However, few regulators of tension wood formation have been identified. The molecular mechanisms underpinning tension wood formation remain elusive. Here, we report that a Populus KNOTTED-like homeobox gene, PagKNAT2/6b, is involved in tension wood formation and gravity response. Transgenic poplar plants overexpressing PagKNAT2/6b displayed more sensitive gravitropism than controls, as indicated by increased stem curvature. Microscopic examination revealed greater abundance of fibre cells with a gelatinous cell wall layer (G-layer) and asymmetric growth of secondary xylem in PagKNAT2/6b overexpression lines. Conversely, PagKNAT2/6b dominant repression plants exhibited decreased tension wood formation and reduced response to gravity stimulation. Moreover, sensitivity to gravity stimulation showed a negative relationship with development stage. Expression of genes related to growth and senescence was affected in PagKNAT2/6b transgenic plants. More importantly, transcription activation and electrophoretic mobility shift assays suggested that PagKNAT2/6b promotes the expression of cytokinin metabolism genes. Consistently, cytokinin content was increased in PagKNAT2/6b overexpression plants. Therefore, PagKNAT2/6b is involved in gravitropism and tension wood formation, likely via modulation of cytokinin metabolism., (© The Author(s) 2024. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.)

Premise: Quaking aspen is a clonal tree species that has mixed ploidy, often with high relative abundance of both diploids and triploids but no haploids or tetraploids. Triploids typically have low fertility, leaving their occurrence apparently unlikely from an evolutionary perspective, unless they provide a "triploid bridge" to generating higher-fitness tetraploids-which are not observed in this species. This study focused on how triploidy can be maintained in quaking aspen., Methods: A computational model was used to simulate gamete production, sexual reproduction, asexual reproduction, parent survival, and offspring survival in a population. All parameters were assumed to be cytotype-dependent and environment-independent. Sampling methods were used to identify parameter combinations consistent with observed cytotype frequencies., Results: Many processes and parameter values were sufficient to yield a moderate frequency of triploids, and very few were necessary. The most plausible route involved higher triploid survival at the parent or offspring stage and limited unreduced gamete production by either diploid or triploid parents. Triploid fertility was helpful but not necessary., Conclusions: The coexistence of diploids and triploids in quaking aspen is statistically likely and promoted by the existence of commonly observed, long-lived triploid clones. However, other mechanisms not captured by the model related to environmental variation could also occur. Further empirical data or more complex but difficult-to-parameterize models are needed to gain further insight., (© 2024 Botanical Society of America.)

For trees originating from boreal and temperate regions, the dormancy-to-active transition, also known as bud dormancy release and bud break, are crucial processes that allow trees to reactive growth in the spring. The molecular mechanisms underlying these two processes remain poorly understood. Here, through integrative multiomics analysis of the transcriptome, DNA methylome, and proteome, we gained insights into the reprogrammed cellular processes associated with bud dormancy release and bud break. Our findings revealed multilayer regulatory landscapes governing bud dormancy release and bud break regulation, providing a valuable reference framework for future functional studies. Based on the multiomics analysis, we have determined a novel long intergenic noncoding RNA named Phenology Responsive Intergenic lncRNA 1 (PRIR1) plays a role in the activation of bud break. that the molecular mechanism of PRIR1 has been preliminary explored, and it may partially promote bud break by activating its neighbouring gene, EXORDIUM LIKE 5 (PtEXL5), which has also been genetically confirmed as an activator for bud break. This study has revealed a lncRNA-mediated regulatory mechanism for the control of bud break in Populus, operating independently of known regulatory pathways., (© 2024 John Wiley & Sons Ltd.)

The biosynthesis of cellulose, lignin, and hemicelluloses in plant secondary cell walls (SCWs) is regulated by a hierarchical transcriptional regulatory network. This network features orthologous transcription factors shared between poplar and Arabidopsis, highlighting a foundational similarity in their genetic regulation. However, knowledge on the discrepant behavior of the transcriptional-level molecular regulatory mechanisms between poplar and Arabidopsis remains limited. In this study, we investigated the function of PagMYB128 during wood formation and found it had broader impacts on SCW formation compared to its Arabidopsis ortholog, AtMYB103. Transgenic poplar trees overexpressing PagMYB128 exhibited significantly enhanced xylem development, with fiber cells and vessels displaying thicker walls, and an increase in the levels of cellulose, lignin, and hemicelluloses in the wood. In contrast, plants with dominant repression of PagMYB128 demonstrated the opposite phenotypes. RNA sequencing and reverse transcription - quantitative polymerase chain reaction showed that PagMYB128 could activate SCW biosynthetic gene expression, and chromatin immunoprecipitation along with yeast one-hybrid, and effector-reporter assays showed this regulation was direct. Further analysis revealed that PagSND1 (SECONDARY WALL-ASSOCIATED NAC-DOMAIN PROTEIN1) directly regulates PagMYB128 but not cell wall metabolic genes, highlighting the pivotal role of PagMYB128 in the SND1-driven regulatory network for wood development, thereby creating a feedforward loop in SCW biosynthesis., (© 2024 Institute of Botany, Chinese Academy of Sciences.)

The NAC transcription factor family is one of the largest families of TFs in plants, and members of NAC gene family play important roles in plant growth and stress response. Recent release of the haplotype-resolved genome assembly of P. tomentosa provide a platform for NAC protein genome-wide analysis. A total of 270 NAC genes were identified and a comprehensive overview of the PtoNAC gene family is presented, including gene promoter, structure and conserved motif analyses, chromosome localization and collinearity analysis, protein phylogeny, expression pattern, and interaction analysis. The results indicate that protein length, molecular weight, and theoretical isoelectric points of the NAC TF family vary, while gene structure and motif are relatively conserved. Chromosome mapping analysis showed that the P. tomentosa NAC genes are unevenly distributed on 19 chromosomes. The interchromosomal evolutionary results indicate 12 pairs of tandem and 280 segmental duplications. Segmental duplication is possibly related to amplification of P. tomentosa NAC gene family. Expression patterns of 35 PtoNAC genes from P. tomentosa subgroup were analysed under high salinity, and seven NAC genes were induced by this treatment. Promoter and protein interaction network analyses showed that PtoNAC genes are closely associated with growth, development, and abiotic and biotic stress, especially salt stress. These results provide a meaningful reference for follow-up studies of the functional characteristics of NAC genes in the mechanism of stress response and their potential roles in development of P. tomentosa., (© 2024 Wiley‐VCH GmbH. Published by John Wiley & Sons Ltd.)

Wood formation, which occurs mainly through secondary xylem development, is important not only for supplying raw material for the 'ligno-chemical' industry but also for driving the storage of carbon. However, the complex mechanisms underlying the promotion of xylem formation remain to be elucidated. Here, we found that overexpression of Auxin-Regulated Gene involved in Organ Size (ARGOS) in hybrid poplar 84 K (Populus alba × Populus tremula var. glandulosa) enlarged organ size. In particular, PagARGOS promoted secondary growth of stems with increased xylem formation. To gain further insight into how PagARGOS regulates xylem development, we further carried out yeast two-hybrid screening and identified that the auxin transporter WALLS ARE THIN1 (WAT1) interacts with PagARGOS. Overexpression of PagARGOS up-regulated WAT1, activating a downstream auxin response promoting cambial cell division and xylem differentiation for wood formation. Moreover, overexpressing PagARGOS caused not only higher wood yield but also lower lignin content compared with wild-type controls. PagARGOS is therefore a potential candidate gene for engineering fast-growing and low-lignin trees with improved biomass production., (© 2024 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

Populus, a significant fast-growing tree species with global afforestation and energy potential, holds considerable economic value. The abundant production of secondary xylem by trees, which serves as a vital resource for industrial purposes and human sustenance, necessitates the orchestration of various regulatory mechanisms, encompassing transcriptional regulators and microRNAs (miRNAs). Nevertheless, the investigation of microRNA-mediated regulation of poplar secondary growth remains limited. In this study, we successfully isolated a novel microRNA (Pag-miR257) from 84 K poplar and subsequently integrated it into the 35 S overexpression vector. The overexpression of Pag-miR257 resulted in notable increases in plant height, stem diameter, and fresh weight. Additionally, the overexpression of Pag-miR257 demonstrated a significant enhancement in net photosynthetic rate. The findings from the examination of cell wall autofluorescence indicated a substantial increase in both xylem area and the number of vessels in poplar plants overexpressing Pag-miR257. Furthermore, the cell wall of the Pag-miR257 overexpressing plants exhibited thickening as observed through transmission electron microscopy. Moreover, the Fourier Transforms Infrared (FTIR) analysis and phloroglucinol-HCl staining revealed an elevation in lignin content in Pag-miR257 overexpressing poplar plants. The findings of this study suggest that microRNA257 may play a role in the control of secondary growth in poplar stems, thereby potentially enhancing the development of wood engineering techniques for improved material and energy production., Competing Interests: Declaration of competing interest The authors declare that they have no competing financial interests., (Copyright © 2024 Elsevier Masson SAS. All rights reserved.)

Wood is resulted from the radial growth paced by the division and differentiation of vascular cambium cells in woody plants, and phytohormones play important roles in cambium activity. Here, we identified that PagJAZ5, a key negative regulator of jasmonate (JA) signaling, plays important roles in enhancing cambium cell division and differentiation by mediating cytokinin signaling in poplar 84K (Populus alba × Populus glandulosa). PagJAZ5 is preferentially expressed in developing phloem and cambium, weakly in developing xylem cells. Overexpression (OE) of PagJAZ5m (insensitive to JA) increased cambium activity and xylem differentiation, while jaz mutants showed opposite results. Transcriptome analyses revealed that cytokinin oxidase/dehydrogenase (CKXs) and type-A response regulators (RRs) were downregulated in PagJAZ5m OE plants. The bioactive cytokinins were significantly increased in PagJAZ5m overexpressing plants and decreased in jaz5 mutants, compared with that in 84K plants. The PagJAZ5 directly interact with PagMYC2a/b and PagWOX4b. Further, we found that the PagRR5 is regulated by PagMYC2a and PagWOX4b and involved in the regulation of xylem development. Our results showed that PagJAZ5 can increase cambium activity and promote xylem differentiation through modulating cytokinin level and type-A RR during wood formation in poplar., (© 2024 The Authors. New Phytologist © 2024 New Phytologist Foundation.)

Building sustainable platforms to produce biofuels and specialty chemicals has become an increasingly important strategy to supplement and replace fossil fuels and petrochemical-derived products. Terpenoids are the most diverse class of natural products that have many commercial roles as specialty chemicals. Poplar is a fast growing, biomassdense bioenergy crop with many species known to produce large amounts of the hemiterpene isoprene, suggesting an inherent capacity to produce significant quantities of other terpenes. Here we aimed to engineer poplar with optimized pathways to produce squalene, a triterpene commonly used in cosmetic oils, a potential biofuel candidate, and the precursor to the further diversified classes of triterpenoids and sterols. The squalene production pathways were either re-targeted from the cytosol to plastids or co-produced with lipid droplets in the cytosol. Squalene and lipid droplet co-production appeared to be toxic, which we hypothesize to be due to disruption of adventitious root formation, suggesting a need for tissue specific production. Plastidial squalene production enabled up to 0.63 mg/g fresh weight in leaf tissue, which also resulted in reductions in isoprene emission and photosynthesis. These results were also studied through a technoeconomic analysis, providing further insight into developing poplar as a production host., (© 2024 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

Centromeres in most multicellular eukaryotes are composed of long arrays of repetitive DNA sequences. Interestingly, several transposable elements, including the well-known long terminal repeat centromeric retrotransposon of maize (CRM), were found to be enriched in functional centromeres marked by the centromeric histone H3 (CENH3). Here, we report a centromeric long interspersed nuclear element (LINE), Celine, in Populus species. Celine has colonized preferentially in the CENH3-associated chromatin of every poplar chromosome, with 84% of the Celine elements localized in the CENH3-binding domains. In contrast, only 51% of the CRM elements were bound to CENH3 domains in Populus trichocarpa. These results suggest different centromere targeting mechanisms employed by Celine and CRM elements. Nevertheless, the high target specificity seems to be detrimental to further amplification of the Celine elements, leading to a shorter life span and patchy distribution among plant species compared with the CRM elements. Using a phylogenetically guided approach, we were able to identify Celine-like LINE elements in tea plant (Camellia sinensis) and green ash tree (Fraxinus pennsylvanica). The centromeric localization of these Celine-like LINEs was confirmed in both species. We demonstrate that the centromere targeting property of Celine-like LINEs is of primitive origin and has been conserved among distantly related plant species., Competing Interests: Conflict of interest statement. None declared., (© The Author(s) 2024. Published by Oxford University Press on behalf of American Society of Plant Biologists.)

Base editing represents a cutting-edge genome editing technique that utilizes the CRISPR system to guide base deaminases with high precision to specific genomic sites, facilitating the targeted alteration of individual nucleotides. Unlike traditional gene editing approaches, base editing does not require DNA double-strand breaks or donor templates. It functions independently of the cellular DNA repair machinery, offering significant advantages in terms of both efficiency and accuracy. In this review, we summarize the core design principles of various DNA base editors, their distinctive editing characteristics, and tactics to refine their efficacy. We also summarize their applications in crop genetic improvement and explore their potential contributions to forest genetic engineering.

The glutamine synthetase/glutamic acid synthetase (GS/GOGAT) cycle plays important roles in N metabolism, growth, development, and stress resistance in plants. Excess ammonium (NH4+) restricts growth, but GS can help to alleviate its toxicity. In this study, the 84K model clone of hybrid poplar (Populus alba × P. tremula var. glandulosa), which has reduced biomass accumulation and leaf chlorosis under high-NH4+ stress, showed less severe symptoms in transgenic lines overexpressing GLUTAMINE SYNTHETASE 1;2 (GS1;2-OE), and more severe symptoms in RNAi lines (GS1;2-RNAi). Compared with the wild type, the GS1;2-OE lines had increased GS and GOGAT activities and higher contents of free amino acids, soluble proteins, total N, and chlorophyll under high-NH4+ stress, whilst the antioxidant and NH4+ assimilation capacities of the GS1;2-RNAi lines were decreased. The total C content and C/N ratio in roots and leaves of the overexpression lines were higher under stress, and there were increased contents of various amino acids and sugar alcohols, and reduced contents of carbohydrates in the roots. Under high-NH4+ stress, genes related to amino acid biosynthesis, sucrose and starch degradation, galactose metabolism, and the antioxidant system were significantly up-regulated in the roots of the overexpression lines. Thus, overexpression of GS1;2 affected the carbon and amino acid metabolism pathways under high-NH4+ stress to help maintain the balance between C and N metabolism and alleviate the symptoms of toxicity. Modification of the GS/GOGAT cycle by genetic engineering is therefore a potential strategy for improving the NH4+ tolerance of cultivated trees., (© The Author(s) 2024. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.)

Main Conclusion: Transcription of PagMYB147 was induced in poplar infected by Melampsora magnusiana, and a decline in its expression levels increases the host's susceptibility, whereas its overexpression promotes resistance to rust disease. Poplars are valuable tree species with diverse industrial and silvicultural applications. The R2R3-MYB subfamily of transcription factors plays a crucial role in response to biotic stresses. However, the functional studies on poplar R2R3-MYB genes in resistance to leaf rust disease are still insufficient. We identified 191 putative R2R3-MYB genes in the Populus trichocarpa genome. A phylogenetic analysis grouped poplar R2R3-MYBs and Arabidopsis R2R3-MYBs into 33 subgroups. We detected 12 tandem duplication events and 148 segmental duplication events, with the latter likely being the main contributor to the expansion of poplar R2R3-MYB genes. The promoter regions of these genes contained numerous cis-acting regulatory elements associated with response to stress and phytohormones. Analyses of RNA-Seq data identified a multiple R2R3-MYB genes response to Melampsora magnusiana (Mmag). Among them, PagMYB147 was significantly up-regulated under Mmag inoculation, salicylic acid (SA) and methyl jasmonate (MeJA) treatment, and its encoded product was primarily localized to the cell nucleus. Silencing of PagMYB147 exacerbated the severity of Mmag infection, likely because of decreased reactive oxygen species (ROS) production and phenylalanine ammonia-lyase (PAL) enzyme activity, and up-regulation of genes related to ROS scavenging and down-regulation of genes related to PAL, SA and JA signaling pathway. In contrast, plants overexpressing PagMYB147 showed the opposite ROS accumulation, PAL enzyme activity, SA and JA-related gene expressions, and improved Mmag resistance. Our findings suggest that PagMYB147 acts as a positive regulatory factor, affecting resistance in poplar to Mmag by its involvement in the regulation of ROS homeostasis, SA and JA signaling pathway., (© 2024. The Author(s).)

Poplar coma, the fluff-like appendages of seeds originating from the differentiated surface cells of the placenta and funicle, aids in the long-distance dispersal of seeds in the spring. However, it also poses hazards to human safety and causes pollution in the surrounding environment. Unraveling the regulatory mechanisms governing the initiation and development of coma is essential for addressing this issue comprehensively. In this study, strand-specific RNA-seq was conducted at three distinct stages of coma development, revealing 1888 lncRNAs and 52,810 mRNAs. The expression profiles of lncRNAs and mRNAs during coma development were analyzed. Subsequently, potential target genes of lncRNAs were predicted through co-localization and co-expression analyses. Integrating various types of sequencing data, lncRNA-miRNA-TF regulatory networks related to the initiation of coma were constructed. Utilizing identified differentially expressed genes encoding kinesin and actin, lncRNA-miRNA-mRNA regulatory networks associated with the construction and arrangement of the coma cytoskeleton were established. Additionally, relying on differentially expressed genes encoding cellulose synthase, sucrose synthase, and expansin, lncRNA-miRNA-mRNA regulatory networks related to coma cell wall synthesis and remodeling were developed. This study not only enhances the comprehension of lncRNA but also provides novel insights into the molecular mechanisms governing the initiation and development of poplar coma.

Nonstructural carbohydrate reserves of stems and roots underpin overall tree fitness and productivity under short-rotation management practices such as coppicing for bioenergy. While sucrose and starch comprise the predominant stem carbohydrate reserves of Populus, utilization for fitness and agricultural productivity is understood primarily in terms of starch turnover. The tonoplast sucrose transport protein SUT4 modulates sucrose export from source leaves to distant sinks during photoautotrophic growth, but the possibility of its involvement in remobilizing carbohydrates from storage organs during heterotrophic growth has not been explored. Here, we used PtaSUT4-knockout mutants of Populus tremula × P. alba (INRA 717-1B4) in winter (cool) and summer (warm) glasshouse coppicing experiments to assess SUT4 involvement in reserve utilization. Conditions preceding and supporting summer sprouting were considered favorable for growth, while those preceding and supporting cool temperature sprouting were suboptimal akin to conditions associated with coppicing as generally practiced. Epicormic bud emergence was delayed in sut4 mutants following lower temperature 'winter' but not summer coppicing. Winter xylem hexose increases were observed in control but not in sut4 stumps after coppicing. The magnitude of starch and sucrose reserve depletion was similar in control and sut4 stumps during the winter and did not explain the sprouting and xylem hexose differences. However, winter maintenance costs appeared higher in sut4 based partly on Krebs cycle intermediate levels. In control plants, bark accrual of abundant defense metabolites, including salicinoids and condensed tannins, was higher in summer than in winter, but this increase of summer defense allocations was attenuated in sut4 mutants. Temperature-sensitive trade-offs between growth and other priorities may therefore depend on SUT4 in Populus., (© The Author(s) 2024. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.)

Background: Histone deacetylases (HDACs) and histone acetyltransferases (HATs) are involved in plant growth and development as well as in response to environmental changes, by dynamically regulating gene acetylation levels. Although there have been numerous reports on the identification and function of HDAC and HAT in herbaceous plants, there are fewer report related genes in woody plants under drought stress., Results: In this study, we performed a genome-wide analysis of the HDAC and HAT families in Populus trichocarpa, including phylogenetic analysis, gene structure, conserved domains, and expression analysis. A total of 16 PtrHDACs and 12 PtrHATs were identified in P. trichocarpa genome. Analysis of cis-elements in the promoters of PtrHDACs and PtrHATs revealed that both gene families could respond to a variety of environmental signals, including hormones and drought. Furthermore, real time quantitative PCR indicated that PtrHDA906 and PtrHAG3 were significantly responsive to drought. PtrHDA906, PtrHAC1, PtrHAC3, PtrHAG2, PtrHAG6 and PtrHAF1 consistently responded to abscisic acid, methyl jasmonate and salicylic acid under drought conditions., Conclusions: Our study demonstrates that PtrHDACs and PtrHATs may respond to drought through hormone signaling pathways, which helps to reveal the hub of acetylation modification in hormone regulation of abiotic stress., (© 2024. The Author(s).)

Plant enzymes significantly contribute to the rapidly diversified metabolic repertoire since the colonization of land by plants. Carboxylesterase is just one of the ubiquitous, multifunctional and ancient enzymes that has particularly diversified during plant evolution. This study provided a status on the carboxylesterase landscape within Viridiplantae. A total of 784 carboxylesterases were identified from the genome of 31 plant species representing nine major lineages of sequenced Viridiplantae and divided into five clades based on phylogenetic analysis. Clade I carboxylesterase genes may be of bacterial origin and then expanded and diversified during plant evolution. Clade II was first gained in the ancestor of bryophytes after colonization of land by plants, Clade III and Clade IV in ferns which were considered the most advanced seedless vascular plants, while Clade V was gained in seed plants. To date, the functions of carboxylesterase genes in woody plants remain unclear. In this study, 51 carboxylesterase genes were identified from the genome of Populus trichocarpa and further divided into eight classes. Tandem and segmental duplication events both contributed to the expansion of carboxylesterase genes in Populus. Although carboxylesterase genes were proven to enhance resistance to pathogens in many herbaceous species, relevant researches on forest trees are still needed. In this study, pathogen incubation assays showed that overexpressing of six Class VI carboxylesterases in Populus tomentosa, to a greater or lesser degree, reduced colonization of detached leaves by fungus Cytospora chrysosperma. A significant difference was also found in functional divergence patterns for genes derived from different gene duplication events. Functional differentiation of duplicated carboxylesterase genes in Populus was proved for the first time by in vivo physiological analysis. The identification of the potentially anti-fungal PtoCXE06 gene also laid a theoretical foundation for promoting the genetic improvement of disease-resistance traits in forest trees., (© The Author(s) 2024. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.)

Poplar is a valuable tree species that is distributed all over the world. However, many insect pests infest poplar trees and have caused significant damage. To control poplar pests, we transformed a poplar species, Populus davidiana × P. bolleana Loucne, with the dsRNA of the chitinase gene of a poplar defoliator, Clostera anastomosis (Linnaeus) (Lepidoptera: Notodontidae), employing an Agrobaterium-mediated approach. The transgenic plant has been identified by cloning the T-DNA flanking sequences using TAIL-PCR and quantifying the expression of the dsRNA using qPCR. The toxicity assay of the transgenic poplar lines was carried out by feeding the target insect species (C. anastomosis). The results showed that, in C. anastomosis, the activity of chitinase was significantly decreased, consistent with the expression on mRNA levels, and the larval mortality was significantly increased. These results suggested that the transgenic poplar of dsRNA could be used for pest control., (© The Author(s) 2024. Published by Oxford University Press on behalf of Entomological Society of America.)

Alternative splicing (AS) serves as a crucial post-transcriptional regulator in plants that contributes to the resistance to salt stress. However, the underlying mechanism is largely unknown. In this research, we identified an important AS transcript in Populus euphratica, PeuHKT1:3a, generated by alternative 3' splice site splicing mode that resulted in the removal of 252 bases at the 5' end of the first exon in PeuHKT1:3. Protein sequence comparison showed that the site of AS occurred in PeuHKT1:3 is located at a crucial Ser residue within the first pore-loop domain, which leads to inefficient K + transport in HKT I-type transporters. Expressing PeuHKT1;3a in an axt3 mutant yeast strain can effectively compensate for the lack of intracellular K + , whereas the expression of PeuHKT1;3 cannot yield the effect. Furthermore, in transgenic Arabidopsis and poplar plants, it was observed that lines expressing PeuHKT1;3a exhibited greater salt tolerance compared to those expressing the PeuHKT1;3 strain. Analysis of ion content and flux demonstrated that the transgenic PeuHKT1;3a line exhibited significantly higher K + content compared to the PeuHKT1;3 line, while there was no significant difference in Na + content. In conclusion, our findings revealed that AS can give rise to novel variants of HKT I-type proteins in P. euphratica with modified K + selectivity to keep a higher K + /Na + ratio to enhanced salt tolerance., Competing Interests: Declaration of competing interest The authors declare no conflicts of interest., (Copyright © 2024 Elsevier Masson SAS. All rights reserved.)

PXY (Phloem intercalated with xylem) is a receptor kinase required for directional cell division during the development of plant vascular tissue. Drought stress usually affects plant stem cell division and differentiation thereby limiting plant growth. However, the role of PXY in cambial activities of woody plants under drought stress is unclear. In this study, we analyzed the biological functions of two PXY genes (PagPXYa and PagPXYb) in poplar growth and development and in response to drought stress in a hybrid poplar (Populus alba × P. glandulosa, '84K'). Expression analysis indicated that PagPXYs, similar to their orthologs PtrPXYs in Populus trichocarpa, are mainly expressed in the stem vascular system, and related to drought. Interestingly, overexpression of PagPXYa and PagPXYb in poplar did not have a significant impact on the growth status of transgenic plants under normal condition. However, when treated with 8 % PEG6000 or 100 mM H 2 O 2 , PagPXYa and PagPXYb overexpressing lines consistently exhibited more cambium cell layers, fewer xylem cell layers, and enhanced drought tolerance compared to the non-transgenic control '84K'. In addition, PagPXYs can alleviate the damage caused by H 2 O 2 to the cambium under drought stress, thereby maintaining the cambial division activity of poplar under drought stress, indicating that PagPXYs play an important role in plant resistance to drought stress. This study provides a new insight for further research on the balance of growth and drought tolerance in forest trees., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Glutathione S-transferases (GSTs) constitute a protein superfamily encoded by a large gene family and play a crucial role in plant growth and development. However, their precise functions in wood plant responses to abiotic stress are not fully understood. In this study, we isolated a Phi class glutathione S-transferase-encoding gene, PtrGSTF8, from poplar (Populus alba × P. glandulosa), which is significantly up-regulated under salt stress. Moreover, compared with wild-type (WT) plants, transgenic tobacco plants exhibited significant salt stress tolerance. Under salt stress, PtrGSTF8-overexpressing tobacco plants showed a significant increase in plant height and root length, and less accumulation of reactive oxygen species. In addition, these transgenic tobacco plants exhibited higher superoxide dismutase, peroxidase, and catalase activities and reduced malondialdehyde content compared with WT plants. Quantitative real-time PCR experiments showed that the overexpression of PtrGSTF8 increased the expression of numerous genes related to salt stress. Furthermore, PtrMYB108, a MYB transcription factor involved in salt resistance in poplar, was found to directly activate the promoter of PtrGSTF8, as demonstrated by yeast one-hybrid assays and luciferase complementation assays. Taken together, these findings suggest that poplar PtrGSTF8 contributes to enhanced salt tolerance and confers multiple growth advantages when overexpressed in tobacco., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Masson SAS. All rights reserved.)

The expression of R2R3-MYB transcription factor PeRAX2 increased transiently upon CdCl 2 exposure (100 μM, 48 h) in leaves and roots of Populus euphratica. We observed that overexpression of PeRAX2 increased Cd 2+ concentration in Arabidopsis root cells and Cd 2+ amount in whole plant, which was due to the increased Cd 2+ influx into root tips. However, the Cd 2+ influx facilitated by PeRAX2 overexpression was substantially reduced by LaCl 3 (an inhibitor of Ca 2+ -channels), suggesting that PeRAX2 could promote the Cd 2+ entering through PM Ca 2+ -permeable channels (CaPCs) in the roots. It is noting that the expression of annexin1 (AtANN1), which mediates the influx of divalent cations through the PM calcium channels, was upregulated by Cd 2+ in PeRAX2-transgenic Arabidopsis. Bioinformatic analysis revealed that the AtANN1 promoter (AtANN1-pro) contains four cis-elements for MYB binding. The PeRAX2 interaction with AtANN1-pro was validated by LUC reporter assay, EMSA, and Y1H assay. Our data showed that PeRAX2 binds to the AtANN1 promoter region to regulate gene transcription and that AtANN1 mediates the Cd 2+ entry through CaPCs in the PM, leading to a Cd 2+ enrichment in transgenic plants. The PeRAX2-stimulated Cd 2+ enrichment consequently resulted in high H 2 O 2 production in root cells of transgenic plants. The expression of AtSOD and AtPOD and activities of CAT, SOD, POD increased in the transgenic lines under Cd 2+ stress. However, the Cd 2+ -upregulated expression and activity of antioxidative enzymes were less pronounced in the PeRAX2-overexpressed lines, compared to the wildtype and vector controls. As a result, root length and plant growth were more suppressed by Cd 2+ in the transgenic lines. Our data suggest that transcriptional regulation of AtANN1 by PeRAX2 can be utilized to improve Cd 2+ enrichment and phytoremediation, although the enriched Cd 2+ affected antioxidant defense system and plant growth in the model species., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

As a promising model, genome-based plant breeding has greatly promoted the improvement of agronomic traits. Traditional methods typically adopt linear regression models with clear assumptions, neither obtaining the linkage between phenotype and genotype nor providing good ideas for modification. Nonlinear models are well characterized in capturing complex nonadditive effects, filling this gap under traditional methods. Taking populus as the research object, this paper constructs a deep learning method, DCNGP, which can effectively predict the traits including 65 phenotypes. The method was trained on three datasets, and compared with other four classic models-Bayesian ridge regression (BRR), Elastic Net, support vector regression, and dualCNN. The results show that DCNGP has five typical advantages in performance: strong prediction ability on multiple experimental datasets; the incorporation of batch normalization layers and Early-Stopping technology enhancing the generalization capabilities and prediction stability on test data; learning potent features from the data and thus circumventing the tedious steps of manual production; the introduction of a Gaussian Noise layer enhancing predictive capabilities in the case of inherent uncertainties or perturbations; fewer hyperparameters aiding to reduce tuning time across datasets and improve auto-search efficiency. In this way, DCNGP shows powerful predictive ability from genotype to phenotype, which provide an important theoretical reference for building more robust populus breeding programs., (© 2024 Society for Experimental Biology and John Wiley & Sons Ltd.)

While the diversity of species formation is broadly acknowledged, significant debate exists regarding the universal nature of hybrid species formation. Through an 18-year comprehensive study of all Populus species on the Qinghai-Tibet Plateau, 23 previously recorded species and 8 new species were identified. Based on morphological characteristics, these can be classified into three groups: species in section Leucoides, species with large leaves, and species with small leaves in section Tacamahaca. By conducting whole-genome re-sequencing of 150 genotypes from these 31 species, 2.28 million single nucleotide polymorphisms (SNPs) were identified. Phylogenetic analysis utilizing these SNPs not only revealed a highly intricate evolutionary network within the large-leaf species of section Tacamahaca but also confirmed that a new species, P. curviserrata, naturally hybridized with P. cathayana, P. szechuanica, and P. ciliata, resulting in 11 hybrid species. These findings indicate the widespread occurrence of hybrid species formation within this genus, with hybridization serving as a key evolutionary mechanism for Populus on the plateau. A novel hypothesis, "Hybrid Species Exterminating Their Ancestral Species (HSEAS)," is introduced to explain the mechanisms of hybrid species formation at three different scales: the entire plateau, the southeastern mountain region, and individual river valleys., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Population demographic changes, alongside landscape, geographic and climate heterogeneity, can influence the timing, stability and extent of introgression where species hybridise. Thus, quantifying interactions across diverged lineages, and the relative contributions of interspecific genetic exchange and selection to divergence at the genome-wide level is needed to better understand the drivers of hybrid zone formation and maintenance. We used seven latitudinally arrayed transects to quantify the contributions of climate, geography and landscape features to broad patterns of genetic structure across the hybrid zone of Populus trichocarpa and P. balsamifera and evaluated the demographic context of hybridisation over time. We found genetic structure differed among the seven transects. While ancestry was structured by climate, landscape features influenced gene flow dynamics. Demographic models indicated a secondary contact event may have influenced contemporary hybrid zone formation with the origin of a putative hybrid lineage that inhabits regions with higher aridity than either of the ancestral groups. Phylogenetic relationships based on chloroplast genomes support the origin of this hybrid lineage inferred from demographic models based on the nuclear data. Our results point towards the importance of climate and landscape patterns in structuring the contact zones between P. trichocarpa and P. balsamifera and emphasise the value whole genome sequencing can have to advancing our understanding of how neutral processes influence divergence across space and time., (© 2024 The Author(s). Molecular Ecology published by John Wiley & Sons Ltd.)

Due to the extended generation cycle of trees, the breeding process for forest trees tends to be time-consuming. Genetic engineering has emerged as a viable approach to expedite the genetic breeding of forest trees. However, current genetic engineering techniques employed in forest trees often utilize continuous expression promoters such as CaMV 35S, which may result in unintended consequences by introducing genes into non-target tissues. Therefore, it is imperative to develop specific promoters for forest trees to facilitate targeted and precise design and breeding. In this study, we utilized single-cell RNA-Seq data and co-expression network analysis during wood formation to identify three vascular tissue-specific genes in poplar, PP2-A10, PXY, and VNS07, which are expressed in the phloem, cambium/expanding xylem, and mature xylem, respectively. Subsequently, we cloned the promoters of these three genes from '84K' poplar and constructed them into a vector containing the eyGFPuv visual selection marker, along with the 35S mini enhancer to drive GUS gene expression. Transgenic poplars expressing the Pro PagPP2-A10 ::GUS, Pro PagPXY ::GUS, and Pro PagVNS07 ::GUS constructs were obtained. To further elucidate the tissue specificity of these promoters, we employed qPCR, histochemical staining, and GUS enzyme activity. Our findings not only establish a solid foundation for the future utilization of these promoters to precisely express of specific functional genes in stems but also provide a novel perspective for the modular breeding of forest trees., Competing Interests: Declaration of Competing Interest The authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Elsevier B.V. All rights reserved.)

The toxic metal cadmium (Cd) poses a serious threat to plant growth and human health. Populus euphratica calcium-dependent protein kinase 21 (CPK21) has previously been shown to attenuate Cd toxicity by reducing Cd accumulation, enhancing antioxidant defense and improving water balance in transgenic Arabidopsis. Here, we confirmed a protein-protein interaction between PeCPK21 and Arabidopsis nuclear transcription factor YC3 (AtNF-YC3) by yeast two-hybrid and bimolecular fluorescence complementation assays. AtNF-YC3 was induced by Cd and strongly expressed in PeCPK21 -overexpressed plants. Overexpression of AtNF-YC3 in Arabidopsis reduced the Cd inhibition of root length, fresh weight and membrane stability under Cd stress conditions (100 µM, 7 d), suggesting that AtNF-YC3 appears to contribute to the improvement of Cd stress tolerance. AtNF-YC3 improved Cd tolerance by limiting Cd uptake and accumulation, activating antioxidant enzymes and reducing hydrogen peroxide (H 2 O 2 ) production under Cd stress. We conclude that PeCPK21 interacts with AtNF-YC3 to limit Cd accumulation and enhance the reactive oxygen species (ROS) scavenging system and thereby positively regulate plant adaptation to Cd environments. This study highlights the interaction between PeCPK21 and AtNF-YC3 under Cd stress conditions, which can be utilized to improve Cd tolerance in higher plants.

Lignocellulosic biomass is a highly sustainable and largely carbon dioxide neutral feedstock for the production of biofuels and advanced biomaterials. Although thermochemical pretreatment is typically used to increase the efficiency of cell wall deconstruction, genetic engineering of the major plant cell wall polymers, especially lignin, has shown promise as an alternative approach to reduce biomass recalcitrance. Poplar trees with reduced lignin content and altered composition were previously developed by overexpressing bacterial 3-dehydroshikimate dehydratase (QsuB) enzyme to divert carbon flux from the shikimate pathway. In this work, three transgenic poplar lines with increasing QsuB expression levels and different lignin contents were studied using small-angle neutron scattering (SANS) and wide-angle X-ray scattering (WAXS). SANS showed that although the cellulose microfibril cross-sectional dimension remained unchanged, the ordered organization of the microfibrils progressively decreased with increased QsuB expression. This was correlated with decreasing total lignin content in the QsuB lines. WAXS showed that the crystallite dimensions of cellulose microfibrils transverse to the growth direction were not affected by the QsuB expression, but the crystallite dimensions parallel to the growth direction were decreased by ∼20%. Cellulose crystallinity was also decreased with increased QsuB expression, which could be related to high levels of 3,4-dihydroxybenzoate, the product of QsuB expression, disrupting microfibril crystallization. In addition, the cellulose microfibril orientation angle showed a bimodal distribution at higher QsuB expression levels. Overall, this study provides new structural insights into the impact of ectopic synthesis of small-molecule metabolites on cellulose organization and structure that can be used for future efforts aimed at reducing biomass recalcitrance.

Populus pseudo-cathayana × Populus deltoides is a crucial artificial forest tree species in Northeast China. The presence of the fall webworm (Hyphantria cunea) poses a significant threat to these poplar trees, causing substantial economic and ecological damage. This study conducted an insect-feeding experiment with fall webworm on P. pseudo-cathayana × P. deltoides, examining poplar's physiological indicators, transcriptome, and metabolome under different lengths of feeding times. Results revealed significant differences in phenylalanine ammonia-lyase activity, total phenolic content, and flavonoids at different feeding durations. Transcriptomic analysis identified numerous differentially expressed genes, including AP2/ERF, MYB, and WRKY transcription factor families exhibiting the highest expression variations. Differential metabolite analysis highlighted flavonoids and phenolic acid compounds of poplar's leaves as the most abundant in our insect-feeding experiment. Enrichment analysis revealed significant enrichment in the plant hormone signal transduction and flavonoid biosynthetic pathways. The contents of jasmonic acid and jasmonoyl-L-isoleucine increased with prolonged fall webworm feeding. Furthermore, the accumulation of dihydrokaempferol, catechin, kaempferol, and naringenin in the flavonoid biosynthesis pathway varied significantly among different samples, suggesting their crucial role in response to pest infestation. These findings provide novel insights into how poplar responds to fall webworm infestation., Competing Interests: Declaration of competing interest The authors declare that there are no commercial or financial relationships in the study that may be considered a potential conflict of interest., (Copyright © 2024. Published by Elsevier Inc.)

MicroRNAs (miRNAs) and DNA methylation are both vital regulators of gene expression. DNA methylation can affect the transcription of miRNAs, just like coding genes, through methylating the CpG islands in the gene regions of miRNAs. Although previous studies have shown that DNA methylation and miRNAs can each be involved in the process of wood formation, the relationship between the two has been relatively little studied in plant wood formation. Studies have shown that the second internode (IN2) (from top to bottom) of 3-month-old poplar trees can represent the primary stage of poplar stem development and IN8 can represent the secondary stage. There were also significant differences in DNA methylation patterns and miRNA expression patterns obtained from PS and SS. In this study, we first interactively analyzed methylation and miRNA sequencing data to identify 43 differentially expressed miRNAs regulated by differential methylation from the primary stage and secondary stage, which were found to be involved in multiple biological processes related to wood formation by enrichment analysis. In addition, six miRNA/target gene modules were finally identified as potentially involved in secondary xylem development of poplar stems through degradome sequencing and functional analysis. In conclusion, this study provides important reference information on the mechanism of interaction between different regulatory pathways of wood formation., (© 2024 The Authors. The Plant Genome published by Wiley Periodicals LLC on behalf of Crop Science Society of America.)

Plants adjust their growth and development in response to changing light caused by canopy shade. The molecular mechanisms underlying shade avoidance responses have been widely studied in Arabidopsis and annual crop species, yet the shade avoidance signalling in woody perennial trees remains poorly understood. Here, we first showed that PtophyB1/2 photoreceptors serve conserved roles in attenuating the shade avoidance syndrome (SAS) in poplars. Next, we conducted a systematic identification and characterization of eight PtoPIF genes in Populus tomentosa. Knocking out different PtoPIFs led to attenuated shade responses to varying extents, whereas overexpression of PtoPIFs, particularly PtoPIF3.1 and PtoPIF3.2, led to constitutive SAS phenotypes under normal light and enhanced SAS responses under simulated shade. Notably, our results revealed that distinct from Arabidopsis PIF4 and PIF5, which are major regulators of SAS, the Populus homologues PtoPIF4.1 and PtoPIF4.2 seem to play a minor role in controlling shade responses. Moreover, we showed that PtoPIF3.1/3.2 could directly activate the expression of the auxin biosynthetic gene PtoYUC8 in response to shade, suggesting a conserved PIF-YUC-auxin pathway in modulating SAS in tree. Overall, our study provides insights into shared and divergent functions of PtoPIF members in regulating various aspects of the SAS in Populus., (© 2024 John Wiley & Sons Ltd.)

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter., (© 2024 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

MicroRNAs are essential in plant development and stress resistance, but their specific roles in drought stress require further investigation. Here, we have uncovered that a Populus-specific microRNAs (miRNA), miR6445, targeting NAC (NAM, ATAF, and CUC) family genes, is involved in regulating drought tolerance of poplar. The expression level of miR6445 was significantly upregulated under drought stress; concomitantly, seven targeted NAC genes showed significant downregulation. Silencing the expression of miR6445 by short tandem target mimic technology significantly decreased the drought tolerance in poplar. Furthermore, 5' RACE experiments confirmed that miR6445 directly targeted NAC029. The overexpression lines of PtrNAC029 (OE-NAC029) showed increased sensitivity to drought compared with knockout lines (Crispr-NAC029), consistent with the drought-sensitive phenotype observed in miR6445-silenced strains. PtrNAC029 was further verified to directly bind to the promoters of glutathione S-transferase U23 (GSTU23) and inhibit its expression. Both Crispr-NAC029 and PtrGSTU23 overexpressing plants showed higher levels of PtrGSTU23 transcript and GST activity while accumulating less reactive oxygen species (ROS). Moreover, poplars overexpressing GSTU23 demonstrated enhanced drought tolerance. Taken together, our research reveals the crucial role of the miR6445-NAC029-GSTU23 module in enhancing poplar drought tolerance by regulating ROS homeostasis. This finding provides new molecular targets for improving the drought resistance of trees., (© 2024 The Authors. New Phytologist © 2024 New Phytologist Foundation.)

Plants and insects coevolved as an evolutionarily successful and enduring association. The molecular arms race led to evolutionary novelties regarding unique mechanisms of defence and detoxification in plants and insects. While insects adopt mechanisms to conquer host defence, trees develop well-orchestrated and species-specific defence strategies against insect herbivory. However, current knowledge on the molecular underpinnings of fine-tuned tree defence responses against different herbivore insects is still restricted. In the current study, using a multi-omics approach, we unveiled the defence response of Populus tremula against aphids ( Chaitophorus populialbae ) and spongy moths ( Lymantria dispar ) herbivory. Comparative differential gene expression (DGE) analyses revealed that around 272 and 1203 transcripts were differentially regulated in P. tremula after moth and aphid herbivory compared to uninfested controls. Interestingly, 5716 transcripts were differentially regulated in P. tremula between aphids and moth infestation. Further investigation showed that defence-related stress hormones and their lipid precursors, transcription factors, and signalling molecules were over-expressed, whereas the growth-related counterparts were suppressed in P. tremula after aphid and moth herbivory. Metabolomics analysis documented that around 37% of all significantly abundant metabolites were associated with biochemical pathways related to tree growth and defence. However, the metabolic profiles of aphid and moth-fed trees were quite distinct, indicating species-specific response optimization. After identifying the suitable reference genes in P. tremula , the omics data were further validated using RT-qPCR. Nevertheless, our findings documented species-specific fine-tuning of the defence response of P. tremula, showing conservation on resource allocation for defence overgrowth under aphid and moth herbivory. Such findings can be exploited to enhance our current understanding of molecular orchestration of tree responses against herbivory and aid in developing insect pest resistance P. tremula varieties.

WOX11/12 is a homeobox gene of WOX11 and WOX12 in Arabidopsis that plays important roles in crown root development and growth. It has been reported that WOX11/12 participates in adventitious root (AR) formation and different abiotic stress responses, but the downstream regulatory network of WOX11/12 in poplar remains to be further investigated. In this study, we found that PagWOX11/12a is strongly induced by PEG-simulated drought stress. PagWOX11/12a-overexpressing poplar plantlets showed lower oxidative damage levels, greater antioxidant enzyme activities and reactive oxygen species (ROS) scavenging capacity than non-transgenic poplar plants, whereas PagWOX11/12a dominant repression weakened root biomass accumulation and drought tolerance in poplar. RNA-seq analysis revealed that several differentially expressed genes (DEGs) regulated by PagWOX11/12a are involved in redox metabolism and drought stress response. We used RT-qPCR and yeast one-hybrid (Y1H) assays to validate the downstream target genes of PagWOX11/12a. These results provide new insights into the biological function and molecular regulatory mechanism of WOX11/12 in the abiotic resistance processes of poplar., Competing Interests: Declaration of competing interest The authors declare that they have no known competing interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Masson SAS. All rights reserved.)

Blue light photoreceptor cryptochrome 1 (CRY1) in herbaceous plants plays crucial roles in various developmental processes, including cotyledon expansion, hypocotyl elongation and anthocyanin biosynthesis. However, the function of CRY1 in perennial trees is unclear. In this study, we identified two ortholog genes of CRY1 (PagCRY1a and PagCRY1b) from Populus, which displayed high sequence similarity to Arabidopsis CRY1. Overexpression of PagCRY1 substantially inhibited plant growth and promoted secondary xylem development in Populus, while CRISPR/Cas9-mediated knockout of PagCRY1 enhanced plant growth and delayed secondary xylem development. Moreover, overexpression of PagCRY1 dramatically increased anthocyanin accumulation. The further analysis supported that PagCRY1 functions specifically in response to blue light. Taken together, our results demonstrated that modulating the expression of blue light photoreceptor CRY1 ortholog gene in Populus could significantly influence plant biomass production and the process of wood formation, laying a foundation for further investigating the light-regulated tree growth., (© 2024 John Wiley & Sons Ltd.)

The plant cell wall serves as a critical interface between the plant and its environment, offering protection against various stresses and contributing to biomass production. Hemicellulose is one of the major components of the cell wall, and understanding the transcriptional regulation of its production is essential to fully understanding cell wall formation. This study explores the regulatory mechanisms underlying one of the genes involved in hemicellulose biosynthesis, PtrPARVUS2. Six transcription factors (TFs) were identified from a xylem-biased library to negatively regulate PtrPARVUS2 expression. These TFs, belonging to diverse TF families, were confirmed to bind to specific cis-elements in the PtrPARVUS2 promoter region, as validated by Yeast One-Hybrid (Y1H) assays, transient expression analysis, and Chromatin Immunoprecipitation sequencing (ChIP-seq) assays. Furthermore, motif analysis identified putative cis-regulatory elements bound by these TFs, shedding light on the transcriptional regulation of SCW biosynthesis genes. Notably, several TFs targeted genes encoding uridine diphosphate glycosyltransferases (UGTs), crucial enzymes involved in hemicellulose glycosylation. Phylogenetic analysis of UGTs regulated by these TFs highlighted their diverse roles in modulating hemicellulose synthesis. Overall, this study identifies a set of TFs that regulate PARVUS2 in poplar, providing insights into the intricate coordination of TFs and PtrPARVUS2 in SCW formation. Understanding these regulatory mechanisms enhances our ability to engineer plant biomass for tailored applications, including biofuel production and bioproduct development., (© 2024. The Author(s).)

Plants trigger a robust immune response by activating massive transcriptome reprogramming through crosstalk between PTI and ETI. However, how PTI and ETI contribute to the quantitative or/and qualitative output of immunity and how they work together when both are being activated were unclear. In this study, we performed a comprehensive overview of pathogen-triggered transcriptomic reprogramming by analyzing temporal changes in the transcriptome up to 144 h after Colletotrichum gloeosporioides inoculated in Populus. Moreover, we constructed a hierarchical gene regulatory network of PagWRKY18 and its potential target genes to explore the underlying regulatory mechanisms of PagWRKY18 that are not yet clear. Interestingly, we confirmed that PagWRKY18 protein can directly bind the W-box elements in the promoter of a transmembrane leucine-rich repeat receptor-like kinase, PagSOBIR1 gene, to trigger PTI. At the same time, PagWRKY18 functions in disease tolerance by modulation of ROS homeostasis and induction of cell death via directly targeting PagGSTU7 and PagPR4 respectively. Furthermore, PagPR4 can interact with PagWRKY18 to inhibit the expression of PagPR4 genes, forming a negative feedback loop. Taken together, these results suggest that PagWRKY18 may be involved in regulating crosstalk between PTI and ETI to activate a robust immune response and maintain intracellular homeostasis., (© 2024 John Wiley & Sons Ltd.)

Wide variation in amenability to transformation and regeneration (TR) among many plant species and genotypes presents a challenge to the use of genetic engineering in research and breeding. To help understand the causes of this variation, we performed association mapping and network analysis using a population of 1204 wild trees of Populus trichocarpa (black cottonwood). To enable precise and high-throughput phenotyping of callus and shoot TR, we developed a computer vision system that cross-referenced complementary red, green, and blue (RGB) and fluorescent-hyperspectral images. We performed association mapping using single-marker and combined variant methods, followed by statistical tests for epistasis and integration of published multi-omic datasets to identify likely regulatory hubs. We report 409 candidate genes implicated by associations within 5 kb of coding sequences, and epistasis tests implicated 81 of these candidate genes as regulators of one another. Gene ontology terms related to protein-protein interactions and transcriptional regulation are overrepresented, among others. In addition to auxin and cytokinin pathways long established as critical to TR, our results highlight the importance of stress and wounding pathways. Potential regulatory hubs of signaling within and across these pathways include GROWTH REGULATORY FACTOR 1 (GRF1), PHOSPHATIDYLINOSITOL 4-KINASE β1 (PI-4Kβ1), and OBF-BINDING PROTEIN 1 (OBP1)., (© 2024 The Authors. New Phytologist © 2024 New Phytologist Foundation.)

Thaumatin-like proteins (TLPs) in plants are involved in diverse biotic and abiotic stresses, including antifungal activity, low temperature, drought, and high salinity. However, the roles of the TLP genes are rarely reported in early flowering. Here, the TLP gene family was identified in P. trichocarpa . The 49 PtTLP genes were classified into 10 clusters, and gene structures, conserved motifs, and expression patterns were analyzed in these PtTLP genes. Among 49 PtTLP genes, the PtTLP6 transcription level is preferentially high in stems, and GUS staining signals were mainly detected in the phloem tissues of the PtTLP6 pro::GUS transgenic poplars. We generated transgenic Arabidopsis plants overexpressing the PtTLP6 gene, and its overexpression lines showed early flowering phenotypes. However, the expression levels of main flowering regulating genes were not significantly altered in these PtTLP6 -overexpressing plants. Our data further showed that overexpression of the PtTLP6 gene led to a reactive oxygen species (ROS) burst in Arabidopsis , which might advance the development process of transgenic plants. In addition, subcellular localization of PtTLP6 -fused green fluorescent protein (GFP) was in peroxisome, as suggested by tobacco leaf transient transformation. Overall, this work provides a comprehensive analysis of the TLP gene family in Populus and an insight into the role of TLPs in woody plants.

The basic helix-loop-helix (bHLH) gene family is integral to various aspects of plant development and the orchestration of stress response. This study focuses on the bHLH genes within Populus × canescens , a poplar species noted for its significant tolerance to cadmium (Cd) stress. Through our comprehensive genomic analysis, we have identified and characterized 170 bHLH genes within the P. canescens genome. These genes have been systematically classified into 22 distant subfamilies based on their evolutionary relationships. A notable conservation in gene structure and motif compositions were conserved across these subfamilies. Further analysis of the promoter regions of these genes revealed an abundance of essential cis-acting element, which are associated with plant hormonal regulation, development processes, and stress response pathway. Utilizing quantitative PCR (qPCR), we have documented the differential regulation of PcbHLHs in response to elevated Cd concentrations, with distinct expression patterns observed across various tissues. This study is poised to unravel the molecular mechanism underpinning Cd tolerance in P. canescens , offering valuable insights for the development of new cultivars with enhanced Cd accumulation capacity and tolerance. Such advancements are crucial for implementing effective phytoremediation strategies to mitigate soil pollution caused by Cd., Competing Interests: The authors declare there are no competing interests., (©2024 Yao et al.)

Background: Afforestation of non-forestland is a new measure by the European Union to enhance climate mitigation and biodiversity. Hybrid aspen (Populus tremula L. × P. tremuloides Michx.) is among the suitable tree species for afforestation to produce woody biomass. However, the best performing genotypic material for intensive biomass production and its physiological adaptation capacity is still unclear. We compared 22 hybrid aspen genotypes growth and leaf physiological characteristics (stomatal conductance, net photosynthesis, intrinsic water-use efficiency) according to their geographical north- or southward transfer (European P. tremula parent from 51° to 60° N and North American P. tremuloides parent from 45° to 54° N) to hemiboreal Estonia (58° N) in a completely randomized design progeny trial. We tested whether the growth ranking of genotypes of different geographical origin has changed from young (3-year-old) to mid-rotation age (13-year-old). The gas exchange parameters were measured in excised shoots in 2021 summer, which was characterised with warmer (+ 4 °C) and drier (17% precipitation from normal) June and July than the long-term average., Results: We found that the northward transfer of hybrid aspen genotypes resulted in a significant gain in growth (two-fold greater diameter at breast height) in comparison with the southward transfer. The early selection of genotypes was generally in good accordance with the middle-aged genotype ranking, while some of the northward transferred genotypes showed improved growth at the middle-age period in comparison with their ranking during the early phase. The genotypes of southward transfer demonstrated higher stomatal conductance, which resulted in higher net photosynthesis, and lower intrinsic water-use efficiency (iWUE) compared with northward transfer genotypes. However, higher photosynthesis did not translate into higher growth rate. The higher physiological activity of southern transferred genotypes was likely related to a better water supply of smaller and consequently more shaded trees under drought. Leaf nitrogen concentration did not have any significant relation with tree growth., Conclusions: We conclude that the final selection of hybrid aspen genotypes for commercial use should be done in 10-15 years after planting. Physiological traits acquired during periods of droughty conditions may not fully capture the growth potential. Nonetheless, we advocate for a broader integration of physiological measurements alongside traditional traits (such as height and diameter) in genotype field testing to facilitate the selection of climate-adapted planting material for resilient forests., (© 2024. The Author(s).)