Search

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 μl of sterile distilled water and 50 μl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5′GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5′CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Lablab bean (Lablab purpureus L. Sweet) is a widely cultivated, highly drought tolerant legume vegetable crop grown in diverse environmental conditions worldwide. In India and elsewhere, the young pods are consumed as a fresh vegetable and mature dry seeds are important in the diet of people preferring vegetarian food (2). Small-holding farmers use their own saved seeds for sowing. During October 2008, L. purpureus exhibiting symptoms of stunting, mosaic, vein-banding, vein-clearing, mottling, and blisters suggestive of a viral infection were observed in and around the Mysore District of Karnataka State, India. Incidence of the disease ranged from 1 to 10% in different fields. Symptomatic leaves were collected from fields of Daripura Village, Mysore District, Karnataka. Viruses that were tested by indirect ELISA included Cucumber mosaic virus, Tobacco mosaic virus, Cowpea aphid-borne mosaic virus, Cowpea mosaic virus, Cowpea mottle virus, Southern bean mosaic virus, and Bean common mosaic virus (BCMV). Results of the ELISA tests indicated that all 28 samples collected from different fields were infected with BCMV. Examination of tissue sap from symptomatic plants by electron microscopy revealed flexuous rod-shaped particles (~750 nm long). An immunocapture-reverse transcription (IC-RT)-PCR assay employing degenerate primers for amplifying partial coat protein (CP) and 3′-UTR of potyviruses (1) yielded a ~700-bp product that was cloned and sequenced (GenBank Accession No. HM776637). Sequence identity at the nucleotide level was 96% with BCMV strain NL-7n (GenBank Accession No. GQ456169) infecting common bean from Himachal Pradesh, India. RTPCR was performed with a virus-specific primer pair (FW3-5′-GCAGTAGCACAGATGAAGGCA-3′: Rv3-5′-GGTTCTTCCGGCTTACTCATAAACAT-3′) designed to amplify 340 bp, the partial coat protein gene of BCMV. All symptomatic L. purpureus field samples and screenhouse-grown seedlings manually inoculated with infected sap were positive for BCMV infection in RT-PCR assay employing specific primers with amplification of a 340-bp product. To our knowledge, this is the first report of BCMV infecting L. purpureus in India. BCMV has also been reported in L. purpureus in Uganda (4) and Nigeria (3). Plants that were confirmed by ELISA to be infected were tagged, and from these plants, seeds were collected and pooled. Four hundred seeds were germinated and a rate of 6.5% seed transmission was determined based on symptoms, ELISA, and PCR. From December 2008 to December 2010, different L. purpureus plantings were monitored for BCMV incidence. Plants infected at different growth stages were tagged and pods were harvested from infected and healthy plants. Data from at least 100 BCMV-infected L. purpureus plants from each of 12 different fields were recorded for yield loss analysis. In terms of number of pods per plant, number of seeds per pod, and seed weight, an average as much as 40% yield loss was recorded from 12 different fields. Because seeds collected from these plants are used for subsequent plantings, these plants may act as virus reservoirs or foci of infection. References: (1) A. S. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) M. N. Maruthi et al. Ann. Appl. Biol. 149:187, 2006. (3) O. O. Odedara et al. J. Gen. Virol. 74:322, 2008. (4) T. N. Sengooba et al. Plant Pathol. 46:95, 1997.

A protein secondary structure prediction protocol involving up to 800 neural network predictions has been developed by SBI-AT. An overall performance of 80% is obtained for three-state (helix, strand, coil) DSSP categories. Input to primary-layer neural networks includes sequence profiles, relative residue position, relative chain length, and amino-acid composition. Secondary structure predictions are made for three consecutive residues simultaneously - a technique which we describe as ‘output expansion’ - which boosts the performance of second-layer structure-to-structure networks. Independent network predictions arise from 10-fold cross validated training and testing of 1032 protein sequences at both primary and secondary network layers. Network output activities are converted to probabilities. Finally, 800 different predictions are combined using a novel balloting procedure.

Viral determinants for overcoming Pisum sativum recessive resistance, sbm-2, against the potyvirus Pea seed-borne mosaic virus (PSbMV) were identified in the region encoding the N-terminal part of the P3 protein. Codons conserved between sbm-2 virulent isolates in this region: Q21, K30 and H122 were found to specifically impair sbm-2 virulence when mutated in selected genetic backgrounds. The corresponding amino acids, Gln21 and Lys30, are neighbored by P3 residues strongly conserved among potyviruses and His122 is conserved particularly in potyviral species infecting legumes. The strongest selective inhibition of sbm-2 virulence, however, was observed by elimination of isolate specific length polymorphisms also located in the N-terminal part of the P3 protein. Length variation in N-terminal P3 is common between potyviral species. However, intra-species length polymorphism in this region was found only among PSbMV isolates. Our findings comply with a model for PSbMV pathotypes having evolved by a diversification of the P3 protein likely to extend to the level of function.