Search

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Rose rosette disease (RRD) caused by rose rosette emaravirus (RRV) is a major issue in the U.S. rose industry with no effective method for its management. This study evaluated the effect of foliar application of acibenzolar-S-methyl (ASM), a plant systemic acquired resistance inducer, in reducing RRD disease severity on Rosa species cv. Radtkopink (‘Pink Double Knock Out’) under greenhouse conditions, and the effect of ASM on plant growth under commercial nursery production conditions. ASM at 50- or 100-mg/liter concentrations at weekly intervals significantly reduced RRD severity compared with the untreated control in two of the three greenhouse trials (P < 0.05). The plants in these trials were subsequently pruned and observed for symptoms, which further indicated that application of ASM at 50- or 100-mg/liter concentrations lowered disease severity compared with the untreated control (P < 0.05) in these two trials. Plants treated with ASM at 50- or 100-mg/liter concentrations had delayed incidence of RRD compared with the nontreated controls. Plants treated with ASM at the 50- or 100-mg/liter rate in all three trials either did not have RRV present or the virus was present in fewer leaf samples than untreated controls as indicated by quantitative reverse transcription PCR analysis. Overall, plants treated with ASM at the 50-mg/liter concentration had 36 to 43% reduced RRD incidence compared with the water control. The treatment of two cultivars of rose, ‘Radtkopink’ and ‘Meijocos’ (‘Pink Drift’), with weekly foliar applications of ASM at the three rates (0.5, 0.75, and 1.0 oz/A) indicated that ASM had no negative effect on flowering or plant growth at even the highest rate of application.

Tomato (Solanum lycopersicum L.) is one of the most important vegetables in Togo. Unfortunately, tomato is susceptible to many diseases, among which bacterial wilt caused by Ralstonia solanacearum causes major yield losses. In this study, incidence of bacterial wilt and its distribution was evaluated in the central region of Togo, the major tomato-producing area in the country. Overall, 16 localities were surveyed in four prefectures. In each locality, three fields were visited, the incidence of the disease was recorded, and diseased samples were collected for laboratory investigation. The results showed that bacterial wilt occurred in all of the fields visited, indicating a field incidence of 100%, whereas the plant incidence ranged from 10.00 ± 00 to 43.33 ± 3.33%, with an average of 20.94 ± 1.77%. The antibody-based ImmunoStrip test was positive for R. solanacearum in 100% of the visited fields. From 144 samples collected from fields, 45 R. solanacearum isolates were isolated on modified selective medium from South Africa. These survey results show that tomato bacterial wilt is a real threat to tomato production in the central region of Togo.

Cucurbit leaf crumple virus (CuLCrV), a single-stranded DNA virus belonging to the species Cucurbit leaf crumple virus in the genus Begomovirus, causes cucurbit leaf crumple disease in many species of the Cucurbitaceae family. This report describes the development and standardization of field-based isothermal recombinase polymerase amplification (RPA) and exonuclease RPA (exo-RPA) assays for the detection and diagnosis of CuLCrV in the leaves of watermelon, squash and pumpkin, and the fruits of watermelon. The oligonucleotide primers were made to target a portion of the BL1 movement protein. The primer set used in the RPA was highly specific for CuLCrV and did not show a cross-reaction with other cucurbit viruses nor in tissues with co-infections of CuLCrV with cucurbit yellow stunting disorder virus (CYSDV) and/or squash vein yellowing virus (SqVYV). These assays were sensitive, producing a positive signal with 1 fg/uL of purified total DNA and at a dilution of 1 × 10–5 of crude extract from CuLCrV-infected watermelon plants. Incorporation of a 6-fluorescein amidite (6-FAM) probe into the exo-RPA assay enabled a total sample processing and detection time of 30 min and positive reactions were detectable in different tissues including watermelon leaves, fruits, and pips (seeds lacking an embryo). The exo-RPA was efficiently used in the detection of CuLCrV in 21 cucurbit plants growing in different regions of southeastern U.S. A sensitive, rapid and easy field-based method for the detection and diagnosis of CuLCrV in watermelon was developed.

Objectifs : Dans le cadre de la recherche de mesures de lutte efficace et durable contre le flétrissement bactérien causé par Ralstonia solanacearum (Rs), la présente étude s’est proposé d’évaluer les variétés de tomate pour leur résistance à la maladie. Méthodologie et Résultats : Six variétés de tomate cultivées aux Togo ont été inoculées par une suspension de la souche de Rs isolée du site de CECO de la prefecture de Sotouboua (Togo). Les résultats ont montré de fortes incidences et sévérités du flétrissement bactérien sur les variétés testées. Cependant, des différences de comportement vis-à-vis de cette maladie ont été observées entre les variétés. En considérant l’indice de maladie après inoculation et l’analyse des closters, deux groupes de variétés ont été identifiés parmi les six testées : un groupe “Résistant” constitué de la seule variété Cobra et un groupe “Sensible” constitué des variétés Petomech, Tropimech, Padma, Roma et Platinum. Conclusions et application des résultats : Cette étude a permis d’obtenir des données sur l’incidence et la sévérité du flétrissement bactérien cause par Rs et le comportement des variétés de tomate vis-à-vis de cette pathologie, et a permis aussi d’identifier les variétés Cobra, Roma et Platinum comme résistantes au flétrissement bactérien en conditions contrôlées. Ces résultats constituent une base de données importante pour des investigations futures en conditions de champs dans diverses zones agroécologiques du pays. Ces expérimentations permettront d’identifier des variétés résistantes pouvant être recommandées aux producteurs pour une gestion durable du flétrissement bactérien. Mots clés : R. solancearum, flétrissement bactérien de la tomate, criblage, résistance. Banito et al., J. Appl. Biosci. Vol : 166 2021 Criblage de variétés de tomate pour de la résistance au flétrissement bactérien causé par Ralstonia solanacearum au Togo 17213 ABSTRACT Objectives: In order to develop a control strategy against bacterial wilt caused by Ralstonia solanacearum (Rs), one of the most destructive diseases of tomato worldwide, the present study aimed to evaluate tomato varieties for resistance to Rs. Methodology and Results: Six tomato varieties cultivated in Togo were inoculated with Rs strain isolated from CECO site in the Prefecture of Sotouboua (Togo).The results revealed high incidence and severity occurring on these varieties. However, differences were observed among the tested varieties. The discrimination analysis based on the disease index after inoculation and the clusters analysis identified two groups of varieties: the resistant group composed of the varieties Cobra, Roma and Platinum and the susceptible group including the varieties Petomech, Tropimech, Padma. Conclusions and application of findings: The results provided useful information in terms of incidence and severity of Rs wilt on tomato and the behaviour of varieties against the disease. The results allowed identifying three tomato varieties, Cobra, Roma and Platinum as resistant to bacterial wilt under controlled conditions. These results are useful for further experiments under field conditions in different agroecological zones to find out resistant tomato varieties for sustainable management of bacterial wilt caused by Rs. Keywords: R. solancearum, bacterial wilt of tomato, screening, resistance.

Disease symptoms Symptoms include water‐soaked areas surrounded by chlorosis turning into necrotic spots on all aerial parts of plants. On tomato fruits, small, water‐soaked, or slightly raised pale‐green spots with greenish‐white halos are formed, ultimately becoming dark brown and slightly sunken with a scabby or wart‐like surface. Host range Main and economically important hosts include different types of tomatoes and peppers. Alternative solanaceous and nonsolanaceous hosts include Datura spp., Hyoscyamus spp., Lycium spp., Nicotiana rustica, Physalis spp., Solanum spp., Amaranthus lividus, Emilia fosbergii, Euphorbia heterophylla, Nicandra physaloides, Physalis pubescens, Sida glomerata, and Solanum americanum. Taxonomic status of the pathogen Domain, Bacteria; phylum, Proteobacteria; class, Gammaproteobacteria; order, Xanthomonadales; family, Xanthomonadaceae; genus, Xanthomonas; species, X. euvesicatoria, X. hortorum, X. vesicatoria. Synonyms (nonpreferred scientific names) Bacterium exitiosum, Bacterium vesicatorium, Phytomonas exitiosa, Phytomonas vesicatoria, Pseudomonas exitiosa, Pseudomonas gardneri, Pseudomonas vesicatoria, Xanthomonas axonopodis pv. vesicatoria, Xanthomonas campestris pv. vesicatoria, Xanthomonas cynarae pv. gardneri, Xanthomonas gardneri, Xanthomonas perforans. Microbiological properties Colonies are gram‐negative, oxidase‐negative, and catalase‐positive and have oxidative metabolism. Pale‐yellow domed circular colonies of 1–2 mm in diameter grow on general culture media. Distribution The bacteria are widespread in Africa, Brazil, Canada and the USA, Australia, eastern Europe, and south‐east Asia. Occurrence in western Europe is restricted. Phytosanitary categorization A2 no. 157, EU Annex designation II/A2. EPPO codes XANTEU, XANTGA, XANTPF, XANTVE., In this review we provide a historical perspective as well as an updated overview on the aetiology, epidemiology, and management strategies of bacterial spot of tomato and pepper.

Five bacterial strains were isolated from symptomatic leaves of Achillea millefolium, Delphinium sp. and Hydrangea sp. in California. Colonies isolated on King’s medium B (KMB) appeared white, mucoid and round, similar to Pseudomonas species. Phylogenetic analyses based on 16S rRNA, rpoB, rpoD and gyrB genes placed the bacteria into three distinct groups within Pseudomonas that were most closely related to Pseudomonas viridiflava , Pseudomonas cichorii or Pseudomonas caspiana . To further characterize the strains, phenotypic analyses and the following tests were performed: fatty acid methyl ester composition, LOPAT, fluorescence on KMB, Biolog assay, and transmission electron microscopy. Finally, whole genome sequencing of the strains was conducted, and the sequences were compared with reference genomes of Pseudomonas species based on average nucleotide identity (ANI). The first group, which consists of three strains isolated from delphinium, hydrangea and achillea, had 95.6–96.9 % pairwise ANI between each other; the second group consists of two strains isolated from delphinium that had 100 % pairwise ANI. Although comparisons of the two groups with publicly available genomes revealed closest relationships with P. viridiflava (91.6 %), P. caspiana (88.3 %) and P. asturiensis (86.7 %), ANI values were less than 95 % compared to all validly published pseudomonads. Combining genomic and phenotypic data, we conclude that these strains represent two new species and the names proposed are Pseudomonas quasicaspiana sp. nov. (type strain DSMZ 11 30 42T=LMG 32 434T) for the strains isolated from delphinium, achillea and hydrangea and Pseudomonas californiensis sp. nov. (DSMZ 11 30 43T=LMG 32 432T) for the two strains isolated from delphinium. The specific epithets quasicaspiana and californiensis were selected based on the close phylogenetic relationship of strains with P. caspiana and on the geographic location of isolation, respectively.

The pathogen that causes stem gall in Loropetalum chinense was first identified in Florida and Alabama in 2018 and named Pseudomonas amygdali pv. loropetali. We report the genome sequence of the pathotype strain of this pathogen, Pseudomonas amygdali pv. loropetali DSM105780 PT.

Bacterial diseases are a constant threat to crop production globally. Current management strategies rely on an array of tactics, including improved cultural practices; application of bactericides, plant activators, and biocontrol agents; and use of resistant varieties when available. However, effective management remains a challenge, as the longevity of deployed tactics is threatened by constantly changing bacterial populations. Increased scrutiny of the impact of pesticides on human and environmental health underscores the need for alternative solutions that are durable, sustainable, accessible to farmers, and environmentally friendly. In this review, we discuss the strengths and shortcomings of existing practices and dissect recent advances that may shape the future of bacterial disease management. We conclude that disease resistance through genome modification may be the most effective arsenal against bacterial diseases. Nonetheless, more research is necessary for developing novel bacterial disease management tactics to meet the food demand of a growing global population.

The eriophyid mite, Phyllocoptes fructiphilus, vectors the causal agent, Rose rosette virus (RRV), that results in rose rosette disease. Parts of the southeastern United States have remained free of the disease, except for infected plant material introductions that were eradicated. A survey of sampling points through Alabama, Georgia, and Mississippi (n = 204) revealed the southeastern border of RRV. The presence of RRV in symptomatic plant tissue samples (n = 39) was confirmed by TaqMan-quantitative reverse transcription polymerase chain reaction (RT-qPCR). Samples were also collected at every plot for detection of eriophyid mites, specifically for P. fructiphilus. Three different species of eriophyid mites were found to be generally distributed throughout Alabama, Georgia, and Mississippi. Most of these sites (n = 60) contained P. fructiphilus, found further south than previously thought, but in low populations (P. fructiphilus or the presence of RRV. The reason for the absence of RRV and low populations of P. fructiphilus in this southeast region of the United States are unclear.

Nanotechnology offers potential solutions for sustainable agriculture, including increasing nutrient utilization efficiency, improving the efficacy of pest management, mitigating the impacts of climate change, and reducing adverse environmental impacts of agricultural food production. Many promising nanotechnologies have been proposed and evaluated at different scales, but several barriers to implementation must be addressed for technology to be adopted, including efficient delivery at field scale, regulatory and safety concerns, and consumer acceptance. Here we explore these barriers, and rank technology readiness and potential impacts of a wide range of agricultural applications of nanotechnology. We propose pathways to overcome these barriers and develop effective, safe and acceptable nanotechnologies for agriculture. Nanotechnology holds great application potential in plant agriculture. This Review Article identifies the technological readiness, addresses the primary barriers to adopting nano-enabled technologies and proposes a roadmap to advance nanotechnology-enabled agriculture.

Gummy stem blight, caused by Stagonosporopsis spp., is a major disease of cucurbits in the United States and China that is managed primarily through the use of fungicides. The objective of this study was to monitor and compare the recent fungicide resistance profiles of Stagonosporopsis spp. in Florida open-field and East China protected-structure production systems. Isolates of Stagonosporopsis spp. were evaluated for sensitivity to the commonly used fungicides azoxystrobin, boscalid, tebuconazole, and thiophanate-methyl at discriminatory rates of 0.096, 0.034, 0.128, and 100 mg/liter, respectively. Isolates were collected from Jiangsu, Jiangxi, Zhejiang, and Anhui provinces in China (n = 69), 12 counties in Florida (n = 89), and one county in Georgia (n = 6). More than 50% of isolates from Florida and East China were resistant to thiophanate-methyl. Boscalid resistance was detected in both isolate collections but was two times more frequent in China. Resistance to azoxystrobin was detected in 66% of isolates in Florida but only 7% in China. Tebuconazole was effective in controlling the mycelia growth of Stagonosporopsis spp. in both collections. The results indicate that both production systems currently face similar challenges related to the development of fungicide resistance in Stagonosporopsis spp. However, the resistance profiles are unique for both production systems.

Crop yield loss due to bacterial plant pathogens need to be reduced to increase global food production demand. Currently available disease management strategies involving copper-based bactericides and antibiotics are losing efficacy due to development of resistance in bacteria. There is long familiar demand of environmentally friendly and sustainable strategies to control bacterial diseases. Bacteriophages are virus that kill target bacteria without affecting another microorganism and environment. Bacteriophage efficiency on phyllosphere is mainly affected by ultraviolet (UV) light. Use of combination of phage, mixture with phage carrier bacteria and optimizing time of application helps in persistence of bacteriophage. There are several bacteriophage products already available in the market to control destructive bacterial diseases. Unlike chemical based traditional control measure, bacteriophage mixture can be easily amended to reduce resistance development in bacteria. In this chapter, the authors discuss from phage isolation to interaction with bacteria and control mechanism of plant diseases.

The eriophyid mite Phyllocoptes fructiphilus Keifer (Acari: Eriophyidae) transmits rose rosette virus to rose (Rosa spp.; Rosaceae) while feeding, which causes serious disease referred to as rose rosette disease. Although there is no cure once rose plants are infected with rose rosette virus, understanding the response of P. fructiphilus and rose rosette disease to abiotic factors such as relative humidity may help to develop management strategies for the disease. The major objective of the current study was to determine the effect of relative humidity on the abundance of P. fructiphilus, as well as the incidence and severity of rose rosette disease symptoms. An experiment was conducted in environmentally controlled chambers where potted pink double knock-out rose plants were maintained at 20, 60, and 95% relative humidity after introducing about 20 P. fructiphilus individuals by attaching a 7-cm-long, field-collected terminal to the branches of potted plants. The densities of P. fructiphilus were recorded at biweekly intervals for 12 wk. The proportion of terminals with rose rosette disease symptoms (disease incidence) and severity of rose rosette disease symptoms was assessed using the Horsfall-Barratt scale at biweekly intervals for 14 wk. The results show that the number of P. fructiphilus individuals was significantly greater under a moderate 60% relative humidity than under a high (95%) or low (20%) relative humidity (P < 0.05). However, the incidence and severity of rose rosette disease symptoms were significantly higher under 95% relative humidity relative humidity regimen than under 20% relative humidity regimen (P < 0.05). The implications of these results on the breeding program and management of P. fructiphilus and the incidence of rose rosette disease are discussed.

On April 2017, four out of 10,000 Double Knock Out Red roses were observed presenting partially wilted and chlorotic foliage in a commercial nursery in Gadsden Co., Florida. Closer examination of the plant crown revealed brown discoloration of the woody tissue. Under high temperature (85°F) and humidity (70%), shoots progressively turned chlorotic and necrotic, leading to plant death in 4 months. A rapid-growing fungus presenting orange-brown mycelium and abundant cylindrical spores was isolated from infected woody crown tissue. BLAST analysis of the resulting sequence (GenBank no. MT019606) of this pathogen had 100% identity to Calonectria cylindrospora β-tubulin gene (GenBank no. FJ918509.1). Koch’s postulates were conducted on healthy Double Knock Out roses. Two weeks after inoculation, shoots of inoculated plants turned progressively chlorotic and then necrotic, leading to plant death in 2 months. The same pathogen was reisolated from infected plant parts, which sequence also had 100% identity to C. cylindrospora β-tubulin gene (GenBank no. FJ918509.1). This pathogen is the same as one of three isolated from crown rot of roses back in 1994 and identified as Cylindrocladium scoparium (teleomorph: C. cylindrospora [Ellis & Everh.]). In this new occurrence, all infected plants were removed from the nursery, and no further infections were detected. This finding is important for commercial growers to be aware of the potential presence of this pathogen in their nurseries. Knowing the symptoms will help them recognize the disease and take action to prevent spread of the disease.

Rose rosette disease (RRD) is a serious rose disease in North America. RRD is caused by rose rosette virus transmitted by Phyllocoptes fructiphilus (Acari: Eriophyidae).

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Chapter 4 of the Vegetable Production Handbook.

This study explores the development of Loop-mediated isothermal amplification of DNA (LAMP) for detection of rose rosette emaravirus (RRV), a technique with the potential to be translated to rose nurseries. RRV is a negative-sense single-stranded RNA Emaravirus and causal agent of the rose rosette disease (RRD). Transmission of RRV is by Phyllocoptes fructiphilus, an eriophyid mite. Although RRV symptoms are characteristics, early visual diagnosis of RRD can be misleading and confusing since it may appear similar to herbicide damage. Two sets of RRV gene sequences composed of twenty-two accessions of RRV-P3 (RNA 3) and another twenty-four from RRV-P4 (RNA 4) were analyzed and two sets of four LAMP primers were designed for broad-range detection of RRV isolates. The direct antigen-capture method for direct trapping of RRV in plastic was used for RNA extraction followed by cDNA synthesis. LAMP reactions were optimized for Bst 2.0 DNA polymerase using the outer RRV-F3/RRV-B3 primers, and internal RRV-FIP/RRV-BIP primers. LAMP reactions were for 1 hour at 64°C (RRV-P3) and 66.5°C (RRV-P4) using either a thermocycler or a portable dry bath. LAMP was also optimized using DNA polymerase GspSSD LD using the same RRV sets of primers. RRV was detected in symptomatic and non-symptomatic RRD tissue from Oklahoma. The limit of detection (LoD) using Bst 2.0 LAMP was 1pg/μL and 1 fg/μL with GspSSD LD quantitative LAMP. The LoD of pre-reaction hydroxy naphthol blue (HNB, 120 μM) for colorimetric (visual) reactions was 10 pg/μL and 0.1 pg/μL using SYBR green I (1:10 dilution) in colorimetric post-reactions. No cross-reactivity was detected in LAMP reaction testing cDNAs of eight commonly co-infecting rose viruses (INSV, ArMV, MSpV, TSWV, ApMV, PNRSV, ToRSV, and TMV), and one virus taxonomically related to RRV (HPWMoV). RNA from healthy rose tissues and non-template controls (water) were included in all LAMP assays.

Chapter 7 of the Vegetable Production Handbook.

Copper (Cu) is the most extensively used bactericide worldwide in many agricultural production systems. However, intensive application of Cu bactericide have increased the selection pressure toward Cu-tolerant pathogens, including Xanthomonas perforans, the causal agent of tomato bacterial spot. However, alternatives for Cu bactericides are limited and have many drawbacks including plant damage and inconsistent effectiveness under field conditions. Also, potential ecological risk on nontarget organisms exposed to field runoff containing Cu is high. However, due to lack of alternatives for Cu, it is still widely used in tomato and other crops around the world in both conventional and organic production systems. In this study, a Cu-tolerant X. perforans strain GEV485, which can tolerate eight tested commercial Cu bactericides, was used in all the field trials to evaluate the efficacy of MgO nanomaterial. Four field experiments were conducted to evaluate the impact of intensive application of MgO nanomaterial on tomato bacterial spot disease severity, and one field experiment was conducted to study the impact of soil accumulation of total and bioavailable Cu, Mg, Mn, and Zn. In the first two field experiments, twice-weekly applications of 200 μg/mL MgO significantly reduced disease severity by 29-38% less in comparison to a conventional Cu bactericide Kocide 3000 and 19-30% less in comparison to the water control applied at the same frequency (p = 0.05). The disease severity on MgO twice-weekly was 12-32% less than Kocide 3000 + Mancozeb treatment. Single weekly applications of MgO had 13-19% higher disease severity than twice weekly application of MgO. In the second set of two field trials, twice-weekly applications of MgO at 1000 μg/mL significantly reduced disease severity by 32-40% in comparison to water control applied at the same frequency (p = 0.05). There was no negative yield impact in any of the trials. The third field experiment demonstrated that application of MgO did not result in significant accumulation of total and bioavailable Mg, Mn, Cu, or Zn in the root-associated soil and in soil farther away from the production bed compared to the water control. However, Cu bactericide contributed to significantly higher Mn, Cu, and Zn accumulation in the soil compared to water control (p = 0.05). This study demonstrates that MgO nanomaterial could be an alternative for Cu bactericide and have potential in reducing risks associated with development of tolerant strains and for reducing Cu load in the environment.

Multispectral imaging is increasingly used in specialty crops, but its benefits in assessment of disease severity and improvements in conventional scouting practice are unknown. Multispectral imaging was conducted using an unmanned aerial vehicle (UAV), and data were analyzed for five flights from Florida and Georgia commercial watermelon fields in 2017. The fields were rated for disease incidence and severity by extension agents and plant pathologists at randomized locations (i.e., conventional scouting) followed by ratings at locations that were identified by differences in normalized difference vegetation index (NDVI) and stress index (i.e., UAV-assisted scouting). Diseases identified by the scouts included gummy stem blight, anthracnose, Fusarium wilt, Phytophthora fruit rot, Alternaria leaf spot, and cucurbit leaf crumple disease. Disease incidence and severity ratings were significantly different between conventional and UAV-assisted scouting (P < 0.01, Bhapkar/exact test). Higher severity ratings of 4 and 5 on a scale of 1 to 5 from no disease to complete loss of the canopy were more consistent after the scouts used the multispectral images in determining sampling locations. The UAV-assisted scouting locations had significantly lower green, red, and red edge NDVI values and higher stress index values than the conventional scouting areas (P < 0.05, ANOVA/Tukey), and this corresponded to areas with higher disease severity. Conventional scouting involving human evaluation remains necessary for disease validation. Multispectral imagery improved watermelon field scouting owing to increased ability to identify disease foci and areas of concern more rapidly than conventional scouting practices with early detection of diseases 20% more often using UAV-assisted scouting.