Search

The shelterin complex at mammalian telomeres contains the single-stranded DNA–binding protein Pot1, which regulates telomere length and protects chromosome ends. Pot1 binds Tpp1, the shelterin component that connects Pot1 to the duplex telomeric DNA–binding proteins Trf1 and Trf2. Control of telomere length requires that Pot1 binds Tpp1 as well as the single-stranded telomeric DNA, but it is not known whether the protective function of Pot1 depends on Tpp1. Alternatively, Pot1 might function similarly to the Pot1-like proteins of budding and fission yeast, which have no known Tpp1-like connection to the duplex telomeric DNA. Using mutant mouse cells with diminished Tpp1 levels, RNA interference directed to mouse Tpp1 and Pot1, and complementation of mouse Pot1 knockout cells with human and mouse Pot1 variants, we show here that Tpp1 is required for the protective function of mammalian Pot1 proteins.

This chapter presents unconventional electronic and magnetic features of nanographite and their possible applications to nanodevices. Nanographene is prepared by heat-treating nanodiamond particles. The presence of edge state and its magnetic properties can be investigated by magnetic measurements. The nanographite samples obtained by annealing nanodiamond particles have Pauli paramagnetic susceptibility or spin paramagnetic susceptibility of π-electrons. It is indicated that the susceptibility for the sample in the vicinity of the insulator–metal transition has a large field-cooling effect, especially around the temperature range in which the cusp emerges. The presence of a cusp and its large field-cooling effect is the consequence of the development of quenched disordered magnetic structure such as a spin-glass state. The magnetic feature of the edge-state spins is modified by chemical modification of the edges. It is found that at high temperatures above 800°C, the growth of nanographite domains contributes to the formation of infinite percolation path network of electron transport, resulting in the change from insulating state to metallic state. The chapter also elaborates the host–guest interaction and edge-state spins.

This paper describes a Web-based system for learning programming. The system is implemented as a Web-based application using Java Servlets and JSP. In order to motivate learners, it makes use of a standardized graphics/animation format SVG, which are popularly used on WWW. It offers templates and example programs and lets novice learners fill in short fragments of programs. The outputs of programs are graphics/animations written in SVG. The server side program also has a Bulletin Board System (BBS) to let learners contribute their programs and animations so that they can communicate with others - it takes advantage of using standardized Web formats. Moreover, the BBS also allows learners to contribute functions as well as complete pieces of programs, which motivates learners to write reusable components of programs.

Basic device characteristics were investigated for a new high-speed and non-volatile nano electro-mechanical systems (NEMS) memory device with nanocrystalline silicon (nc-Si) dots embedded in its movable floating gate beam.Over 1 GHz operation is possible due to the size reduction of the NEMS. From a simulation of mechanical properties of the movable floating gate beam, advantage of using the nc-Si dots array was shown for low power operation. The mechanical bistability of the fabricated SiO2 beam was clearly observed in both experimental and simulation studies.

The paper presents a more efficient noninteractive zero knowledge proof system (NIZK) for 3 colorability. The length of the proof is 1/3 and the length of the reference string is 1/4 of those of Blum et al. (1988) respectively. The proposed NIZK is based on the quadratic residuosity assumption. >

Ultra-large scale integration(ULSI) applications, where the critical dimensions of transistors are less than 0.15 μm, inevitably require annealing TiSi 2 , serving as electrode material, at temperatures slightly higher than 900°C for transformation from the metastable high-resistivity C49 TiSi 2 phase to the stable low-resistivity C54 TiSi 2 phase. In the interest of avoiding agglomeration of TiSi 2 and thermal damage to transistors, annealing temperature is desirably kept below about 850°C, which is the phase transformation temperature of blanket TiSi 2 . In the present study, we investigated ternary titanium silicide and pseudo-binary titanium disilicide systems for lowering C49 TiSi 2 to C54 TiSi 2 the phase transformation temperature. We drew new crystal structure maps using two electronic parameters, total bond order 〈Bo〉 and averaged d-orbital energy 〈Md〉 of metals, which were calculated by the Discrete Variational Xα Molecular-Orbital cluster method. On the basis of these maps and a critical review of literature on reported experimental results in relation to the phase transformation temperature of ternary titanium silicide and pseudo-binary titanium disilicide, we predicted candidates for new pseudo-binary titanium disilicides with third elements added to binary TiSi 2 in order to enhance the phase transformation from C49 TiSi 2 to the C54 TiSi 2 .

Pt/IrO/sub 2/ electrodes for sol-gel PbZr/sub x/Ti/sub 1-x/O/sub 3/ (PZT) capacitors were studied. The morphology, stress, and adhesion of the IrO/sub 2/ layer depended upon the sputter conditions. The electrical characteristics of the capacitor changed with the morphology of IrO/sub 2/.

We developed the 1T/1C FRAM device technology using 0.5 /spl mu/m design rule which is perfectly compatible with 0.5 /spl mu/m CMOS logic process. This technology achieves the small 1T/1C FRAM cell size of 12.5 /spl mu/m/sup 2/, and minimized process degradations of ferroelectric material characteristics using low-power inter layer dielectric film deposition technique. Using this technology, we successfully integrated the 68 kbit-FRAM and 8 bit-MCU.

The CMA adaptive array was developed for capture of constant modulus signals. As is well known, the CMA adaptive array can suppress interferences successfully under multipath environments. In order to investigate the availability of CMA adaptive array for other non-constant modulus signals, this paper deals with performance of the CMA adaptive array for 16 QAM signals which have high bandwidth efficiency. Several CMA-based cost functions modified for the QAM signals are introduced and also an algorithm of switching those cost functions in the process of adaptation is proposed. Via computer simulation, it is shown that the CMA adaptive array with the cost functions changed in adaptation has significantly better convergence characteristics for the 16 QAM signals. In addition, the BER performance of the cost functions is clarified.

In the era of 22-oxacalcitriol (OCT), newly synthesized 1 alpha,25-dihydroxyvitamin D(3) analogue, against secondary hyperparathyroidism, the indications of parathyroidectomy (PTx) has been restricted. Recent investigations on animal models have revealed the inhibitory effects on PTH secretion after OCT treatment, whereas there has been no evidence about human parathyroid glands. A 38-year-old man with a 19-year history of hemodialysis was performed PTx after the failure of OCT treatment. Expressions of proliferative nuclear cell antigen (PCNA), calcium-sensing receptor (CaSR), vitamin D receptor (VDR), p53 and p21(WAF1/Cip1) were analyzed by Western blotting and immunohistochemistry on resected parathyroid glands. We confirmed up-regulations of CaSR and VDR, which contribute the reduction of serum PTH, by OCT treatment. Concomitant up-regulation of p21(WAF1/Cip1) but not p53, especially in nodular hyperplasia, can be considered to induce cell cycle arrest of the parathyroid cells, but not cytocidal effect of OCT.

Bile duct injury can occur more frequently during laparoscopic cholecystectomy than in open cholecystectomy. Three cases of common bile or hepatic duct injuries occurred in a series of eighty laparoscopic cholecystectomies; In case 1, the common bile duct was misidentified as the cystic duct. In case 2, bile peritonitis occurred on the fourth postoperative day caused by necrosis of the common hepatic duct involving the cautery surrounding it. In case 3, a bile leak occurred due to an incision at the confluence of the cystic and common duct. Dissection of the cystic duct at the infundibulum of the gallbladder, blunt dissection of the Calot's triangle, the handling of clips with special attention for safety were thought to be necessary in order to lower the risk of bile duct injury. Preoperative endoscopic retrograde cholangiography (ERCP) is recommended to avoid bile duct injury.

Knowledge of our Planet's biosphere has increased tremendously during the last 10 to 20 years. In the field of Microbiology in particular, scientists have discovered novel "extremophiles", microorganisms capable of living in extreme environments such as highly acidic or alkaline conditions, at high salt concentration, with no oxygen, extreme temperatures (as low as -20 degrees C and as high as 300 degrees C), at high concentrations of heavy metals and in high pressure environments such as the deep-sea. It is apparent that microorganisms can exist in any extreme environment of the Earth, yet already scientists have started to look for life on other planets; the so-called "Exobiology" project. But as yet we have little knowledge of the deep-sea and subsurface biosphere of our own planet. We believe that we should elucidate the Biodiversity of Earth more thoroughly before exploring life on other planets, and these attempts would provide deeper insight into clarifying the existence of extraterrestrial life. We focused on two deep-sea extremophiles in this article; one is "Piezophiles", and another is "Hyperthermophiles". Piezophiles are typical microorganisms adapted to high-pressure and cold temperature environments, and located in deep-sea bottom. Otherwise, hyperthermophiles are living in high temperature environment, and located at around the hydrothermal vent systems in deep-sea. They are not typical deep-sea microorganisms, but they can grow well at high-pressure condition, just like piezophiles. Deming and Baross mentioned that most of the hyperthermophilic archaea isolated from deep-sea hydrothermal vents are able to grow under conditions of high temperature and pressure, and in most cases their optimal pressure for growth was greater than the environmental pressure they were isolated from. It is possible that originally their native environment may have been deeper than the sea floor and that there had to be a deeper biosphere. This implication suggests that the deep-sea hydrothermal vents are the windows to a deep subsurface biosphere. A vast array of chemoautotrophic deep-sea animal communities have been found to exist in cold seep environments, and most of these animals are common with those found in hydrothermal vent environments. Thus, it is possible to consider that the cold seeps are also one of slit windows to a deep subsurface biosphere. We conclude that the deep-sea extremophiles are very closely related into the unseen majority in subsurface biosphere, and the subsurface biosphere probably concerns to consider the "exobiology".

A 67-year-old man was admitted with erythematous skin papules, lymphadenopathy and liver dysfunction. The bone marrow was filled with atypical lymphoid cells, and a skin biopsy showed diffuse dermal infiltration of neoplastic cells, which were positive for CD2, CD8, CD56, TIA-1, Granzyme B and EBER (ISH), but negative for CD3, CD4, CD16 and CD57. Molecular analysis showed a germline configuration for T-cell receptor beta, gamma chain genes, and monoclonal integration of Epstein-Barr virus. The THP-COP regimen was not effective and the patient died of severe metabolic acidosis 2 months later. Autopsy revealed diffuse infiltration of neoplastic cells in almost all organs. Apoptosis of tumor cells and proliferation of hemophagocytic macrophages were remarkable. Neither angiocentricity nor necrosis was observed. The findings in this patient were indistinguishable from advanced-stage nasal-type NK cell lymphoma. However, the diagnosis of aggressive NK cell leukemia/lymphoma may be justified because of the marked involvement of the marrow at onset, fulminant clinical course and diffuse infiltration of tumor cells evident at autopsy.

A 66-year-old woman was admitted with high fever, systemic lymphadenopathy, hepatosplenomegaly and pancytopenia. Bone marrow aspiration showed infiltration of atypical lymphoid cells and hemophagocytic histiocytes. The findings of lymph node biopsy were compatible with angioimmunoblastic T-cell lymphoma (AILD). A diagnosis of lymphoma-associated hemophagocytic syndrome (LAHS) was made. Treatment with the THP-COP regimen achieved clinical remission except for mild splenomegaly, but relapse of LAHS was confirmed two years after diagnosis. The patient's condition deteriorated rapidly, and she died of multi-organ failure one month later. Autopsy revealed extended, diffuse infiltration of lymphoma cells in almost all organs. Numerous macrophages showing phagocytosis of erythrocytes and nucleated cells were found in the adrenal glands, lungs, bone marrow, spleen and liver. Epstein-Barr virus genomes were not detected by in situ hybridization, but cytotoxic molecules were immunostained with TIA-1 and granzyme B in the lymphoma cells. Elevated serum levels of sIL-2R, IFN-gamma, IL-6 and M-CSF were found at the onset and relapse of lymphoma. Overproduction of these cytokines was considered to have contributed to the pathogenesis of HPS.

We analyzed the expression pattern of adhesion molecules including beta 1-integrins (CD49c, CD49d, CD49e, CD49f), beta 2-integrins (CD11a, CD11b, CD11c), CD44, and CD54 in 141 children with B-cell precursor acute lymphoblastic leukemia (pre-B ALL) and in 21 children with B-cell ALL/non-Hodgkin's lymphoma (B-ALL/NHL). The frequencies of CD11a, CD49f, and CD44 expression were significantly higher in CD34+ pre-B ALL than in CD34- pre-B ALL. Although CD49d, CD49e, and CD44 were less frequently expressed in B-ALL/NHL than in pre-B ALL, the expression of CD11a and CD54 were more frequent in B-ALL/NHL. In pre-B ALL, expression of CD11a positively correlated with that of CD11b (P.05) and CD54 (P.01), and CD49c positively correlated with CD49f (P.01). Of the clinical parameters of patients with pre-B ALL, expression of CD11a was associated with a low leukocyte count (P.05). The presence of CD54 on the cell surface was an independent factor indicating a poor prognosis. The estimated 5-year event-free survival was 42.3% for CD54+ (n = 31) compared with 70.3% for CD54- patients (n = 38) (P.05). These findings demonstrated that expression of adhesion molecules is dependent on the phenotype of B-lineage cells and that the expression of some of these molecules has clinical significance.

A 72-year-old woman was given a diagnosis of severe aplastic anemia, and treated with anabolic steroid and cyclosporin A starting in October 1996. Because this treatment was ineffective, anti-thymocyte globulin (ATG) therapy was started in September 1997. In May 1998, chromosome analysis revealed transformation to myelodysplastic syndrome (MDS), refractory anemia with excess of blasts with monosomy 7 in 60% of metaphase cells. The patient showed gradual hematologic improvement and became transfusion independent. Despite progression to acute myeloid leukemia (FAB-M6) with monosomy 7 in 100% of metaphase cells in December 1998, the hemoglobin level recovered to 13.2 g/dl. In May 1999 the blasts increased rapidly and transformation to acute myelomonocytic leukemia (FAB-M4) was diagnosed. The patient was treated with low-dose Ara-C and aclarubicin with no improvement and died in August 1999. This case demonstrated the transformation of severe aplastic anemia to acute myeloid leukemia via MDS with monosomy 7 associated with transfusion independence after immunosuppressive therapy. These findings suggested a close relationship between aplastic anemia and hypoplastic MDS and the possibility of hematologic improvement based on the growth advantage of abnormal clones.

Summary: We herein present a case of an internal carotid artery embolism associated with a hidden internal carotid artery aneurysm. The aneurysm was visualized during successful endovascular treatment of the carotid embolism. In retrospect, the aneurysm was at risk of rupture during the procedure. In the endovascular treatment of cerebral embolism, the possibility that aneurysms are hidden by emboli must be borne in mind. Care should be taken not to injure unidentified arterial walls while advancing a catheter blindly.

We describe 2 cases of prostatic carcinoma with pulmonary metastasis. In the first case there was no lymph node or bone metastasis, and in the second case there was only one bony metastatic lesion. Presentation, etiology and management are discussed.

The codon-reading properties of wobble-position variants of the unmodified form of Escherichia coli tRNASer1 (the UGA anticodon) were measured in a cell-free translation system. Two variants, with the AGA and CGA anticodons, each exclusively read a single codon, UCU and UCG, respectively. The only case of efficient wobbling occurred with the variant with the GGA anticodon, which reads the UCU codon in addition to the UCC codon. Surprisingly, this wobble reading is more efficient than the Watson-Crick reading by the variant with the AGA anticodon. Furthermore, we prepared tRNA variants with AA, UC, and CU, instead of GA, in the second and third positions and measured their relative efficiencies in the reading of codons starting with UU, GA, and AG, respectively. The specificity concerning the wobble position is essentially the same as that in the case of the codons starting with UC.

The large species difference in the pharmacokinetics/pharmacodynamics of 7-hydroxystaurosporine (UCN-01) can be partially explained by the high affinity binding of UCN-01 to human alpha1-acid glycoprotein (AGP) (Fuse et al, Cancer Res., 58: 3248-3253, 1998). To confirm whether its binding to human AGP actually changes the in vivo pharmacokinetics, we have studied the alteration in its pharmacokinetics after simultaneous administration of human AGP to rats: (a) the protein binding of UCN-01 was evaluated by chasing its dissociation from proteins using dextran-coated charcoal. The UCN-01 remaining 0.1 h after adding dextran-coated charcoal to human plasma or AGP was approximately 80%, although the values for other specimens, except monkey plasma (approximately 20%), were1%, indicating that the dissociation from human AGP was specifically slower than from other proteins; and (b) the pharmacokinetics of UCN-01 simultaneously administered with human AGP has been determined. The plasma concentrations after i.v. administration of UCN-O1 with equimolar human AGP were much higher than those after administration of UCN-01 alone. The steady-state distribution volume and the systemic clearance were reduced to about 1/100 and 1/200, respectively. Human AGP thus reduced the distribution and elimination of UCN-01 substantially. On the other hand, dog AGP, which has a low binding affinity for UCN-01, did not change the pharmacokinetics of UCN-01 so much. Furthermore, human AGP markedly reduced the hepatic extraction ratio of UCN-01 from 0.510 to 0.0326. Also, human AGP (10 microM) completely inhibited the initial uptake of UCN-01 (1 microM) into isolated rat hepatocytes, whereas the uptake of UCN-01 was unchanged in the presence of human serum albumin (10 microM). In conclusion, the high degree of binding of UCN-01 to human AGP causes a reduction in the distribution and clearance, resulting in high plasma concentrations in humans.

Minor leucine tRNA species, tRNA(Leu)4 and tRNA(Leu)5, from Escherichia coli B have been reported to recognize leucine codons UUA and UUG [Goldman, E., Holmes, W. M., and Hatfield, G. W. (1979) J. Mol. Biol. 129, 567-585]. In the present study, these two tRNA(Leu) species were purified from E. coli A19, and the nucleotide sequences were determined by a post-labeling method. tRNA(Leu)5 was found to correspond to the tRNA gene reported as su degrees6 tRNA [Yoshimura, M., Inokuchi, H., and Ozeki, H. (1984) J. Mol. Biol. 177, 627-644]. The first letter of the anticodon was identified to be 2'-O-methylcytidine (Cm). tRNA(Leu)4 was identified as the minor leucine tRNA that has been sequenced previously (tRNA(Leu)UUR) [Yamaizumi, Z., Kuchino, Y., Harada, F., Nishimura, S., and McCloskey, J. A. (1980) J. Biol. Chem. 255, 2220-2225]. There was an unidentified modified nucleoside (N*) in the first position of the anticodon of tRNA(Leu)4. Nucleoside N* was isolated to homogeneity (1 A260 unit). By 1H NMR spectroscopy, nucleoside N was found to be a 2'-O-methyluridine derivative with a substituent having a -CH2NH2+CH2COO- moiety in position 5 of the uracil ring. On the basis of these NMR analyses together with mass spectrometry, the chemical structure of nucleoside N* was determined as 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um). Nucleoside N* was thus found to be a novel type of naturally occurring modified uridine. Because of the conformational rigidity of Cm and cmnm5Um in the first position of the anticodon, these tRNA(Leu) species recognize the leucine codons UUA++ and UUG correctly, but never recognize the phenylalanine codons UUU and UUC.

We report a case of urolithiasis caused by surgical treatment for Crohn's disease. A 28-year-old woman was referred to our department for further examination of renal stones from the medical department in September, 1995. She suffered from Crohn's disease and had a history of jejuno-ileal resection because of perforation of the ileum in 1988. Radiographs revealed multiple bilateral renal stones, and the urine oxalate concentration was elevated. She was treated with extracorporeal shock wave lithotripsy and the administration of sodium bicarbonate and citrate, but these treatments did not prevent recurrence and enlargement of stones. Renal function was gradually worsened and we performed transurethral lithotomy and percutaneous nephrolithotripsy. The stones were mainly composed of oxalate calcium monohydrate. A renal biopsy was performed at the operation, showing deposition of crystals in almost all renal tubules. Diet therapy (low oxalate and low fat) and the administration of sodium bicarbonate and citrate were performed strictly and recurrence was not recognized 10 months after complete removal of the stones.

The incidence of urinary tract infections (UTIs) in 363 adult renal transplant recipients transplanted during the period 1990-96 has been analysed. UTI occurred in 96 patients (26%), most frequently during the first year after transplantation. Female recipients had significantly more UTI than male recipients (49% vs. 14%, p0.0001). There was no difference in the incidence of UTI between recipients receiving pig-tail catheters as ureteral stents or not, the figures being 21% vs. 28%, respectively. Age had no influence on the incidence of UTI. In 341 patients treated with cyclosporine the incidence of UTI was 28%, while in 15 patients treated with FK-506 only 1 patient (7%) had a UTI (ns). The majority of organisms cultured were gram-negative (76%), with approximately 1/3 being Escherichia coli and 1/5 being Enterococcus and Klebsiella/Enterobacter. The bacterial spectrum was not influenced by the recipient's age. UTI had no effect on the number of rejections, or on graft and patient survival in living donor transplant recipients. No significant difference was found in graft and patient survival rates at 3 yr between patients who had UTI or no UTI.

A 77-year-old man was admitted because of massive pericardial effusion and cardiac tumor. Cytological examination of the effusion and histological examination of a subcutaneous tumor in the chest wall revealed diffuse large B cell lymphoma. The immunophenotype of tumor cells was CD5+ CD20+ CD22+ CD38+ HLA-DR+ CD19-. Chromosome analysis revealed complex abnormal karyotypes containing t(8;14) (q24;q32). C-myc gene rearrangement was shown by Southern blotting. Chemotherapy with pirarubicin, cyclophosphamide, vincristin, and prednisolone (THP-COP) was not effective for his lymphoma. He suffered from cardiac tamponade and died at 5 months after diagnosis. Autopsy revealed a large cardiac tumor, extensive epicardial infiltration, tiny tumors in the lung and pancreas, but no lymphadenopathy, the combination of which suggested a primary cardiac lymphoma. Immunohistochemistry for p53 protein showed nuclear staining of more than 50% of the lymphoma cells. In situ hybridization for EBER-1 was negative. Rearrangement of c-myc gene and overexpression of p53 protein are usually observed in Burkitt's lymphoma and some cases of high grade lymphomas including AIDS-associated non-Hodgkin lymphomas. In this case the association of these molecular findings and resistance to chemotherapy is suggested.

We have demonstrated that Antisense phosphodiester (ODNs) and phosphorothioate oligonucleotides (S-ODNs) inhibit CAT (chloramphenicol acetyltransferase) protein expression in the clone 76 cell line, which is a derivative of the murine C127 cell line. This cell line expresses the influenza virus RNA polymerase and nucleoprotein (NP) genes in response to treatment with dexamethasone. Phosphodiester, phosphorothioate, and liposomally encapsulated oligonucleotides with four target sites (PB1, PB2, PA, and NP) were synthesized and tested for inhibitory effects by a CAT-ELISA assay using the clone 76 cell line. The liposomally encapsulated ODNs and S-ODNs complementary to the sites of the PB2-AUG and PA-AUG initiation codons showed highly inhibitory effects. On the other hand, the inhibitory effect of the S-ODNs targeted to PB1 was considerably decreased in comparison with the other three target sites. Liposome encapsulation afforded oligomer protection in serum-containing medium and substantially improved cellular accumulation. The liposomally encapsulated oligonucleotides exhibited higher inhibitory activity than the free oligonucleotides. Liposomal preparations of oligonucleotides facilitate release from endocytic vesicles, and thus, cytoplasmic and nuclear localization are observed following cell treatment. The activities of the unmodified oligonucleotides are effectively enhanced by using the liposomal carrier. In the observation of the endocapsulated antisense phosphodiester oligonucleotide, FITC-ODN-PB2-as treated clone 76 cells by a confocal laser scanning microscope, diffuse fluorescence was apparently observed in the cytoplasm. Interestingly, the endocapsulated antisense phosphorothioate oligonucleotide, FITC-S-ODN-PB2-as accumulated in the nuclear region of clone 76 cells. However, weak fluorescence was observed on the endosomes and in the cytoplasmes of the free antisense phosphorothioate oligonucleotides treated clone 76 cells.

The facilitation of dissecting the vesical pedicles and undisturbed preservation of the membranous urethra were investigated during radical cystectomy using the retrograde technique.First, just as with radical prostatectomy, the prostate and the rectum were separated by blunt digital dissection. After the deep dorsal vein complex and the urethra were cut, the bladder and the rectum were also separated in a retrograde manner towards the Denonvillier's fascia. Then the peritoneum was opened and its lowest part was incised above the cul-de-sac. A tunnel was made beginning at the cut-end of the urethra to the cul-de-sac. Consequently, the bladder was lifted up by hand inserted this "vesico-rectal tunnel" and the bilateral remaining lateral pedicles were ligated and transsected without difficulty.Fourteen patients underwent radical cystectomy using this technique. Among them, the average operating time and blood loss in 4 patients received retrograde radical cystectomy accompanied with ileal conduit were 5 hours 15 minutes and 1606 ml, respectively. These in 9 patients received retrograde radical cystectomy followed by bowel orthotopic urinary reservoir were 7 hours and 6 minutes and 1086 ml, respectively. Another patient received ureterocutaneoustomy.Creating a "vesico-rectal tunnel" during radical cystectomy primarily by the retrograde extraperitoneal technique can afford to preserve the urethral sphincter and to ligate the pedicles easily. This method is fundamentally familiar to us because retrograde radical prostatectomy is now widely adopted and it may help to reduce the operating time even when there is a shortage of manpower.

The hepatic extraction ratios (EH) of adriamycin (ADR) and mitomycin C (MMC), which were administered clinically by an intra-hepatic arterial route, were measured in rats to clarify the disposition of ADR and MMC in liver. EH values of ADR and MMC were determined by comparing the femoral arterial and hepatic venous plasma concentrations at steady state during continuous intravenous administration. The EH value of ADR in rats at each infusion rate of 2, 10 and 50 micrograms/kg/min, was 0.290, 0.286 and 0.251, respectively. There was no significant difference between the EH values (p0.05). The systemic clearance (CLtot) at each infusion rate was 108, 77.6 and 72.9 ml/min/kg, respectively. The EH value of MMC in rats at each infusion rate of 2.5, 7.5 and 25 micrograms/kg/min, was 0.332, 0.358 and 0.360, respectively. There was no significant difference between the EH values, the same as for ADR. The systemic clearance (CLtot) at each infusion rate was 38.3, 36.1 and 35.3 ml/min/kg.

This study investigated the effect of the four different combinations of metamotivational state and felt arousal level (telic-low, paratelic-low, relic-high, paratelic-high) on archery performance. Skilled, average, and novice archers ( n = 28) were voluntary subjects, randomly divided into 2 groups, balanced for ability. Each group performed 2 out of the 4 experimental conditions. In this reversal theory-based field experiment, telic and paratelic metamotivational states and arousal level were manipulated prior to archery performance. The hypothesis that archery performance would be superior under telic-low arousal conditions was rejected, but evidence pointed to the possible importance of hedonic tone in performance. Post hoc analysis showed differences between combined high (telic-low, paratelic-high) and combined low (telic-low, paratelic-high) hedonic-tone groups which fell short of significance. This observation is taken as justification for further exploration of the relationship between hedonic tone and sports performance.

The cell-free system for biosynthesis of proteins is becoming an important tool for protein engineering. In particular, introduction of the unnatural amino acids is achieved though cell-free protein synthesis with the use of chemically acylated tRNA that recognizes a specific codon. In the original method, however, it was difficult to control the system through changing tRNA composition, as the endogenous tRNAs are involved in the reaction. Thus, in the present study, we digested the tRNA within Escherichia coli S30 extract with resin-bound RNase A, and estimated the protein synthesis activity. It was revealed that this digestion process does not damage the activity, if a protease inhibitor, phenylmethylsulfonyl fluoride (PMSF), is present in the digestion reaction.

Effects of base substitution within tRNA anticodon loop on the codon reading activities were quantitatively analyzed with the use of a set of unmodified tRNA molecules with GGA anticodon. The first (position 32) and the last (position 38) nucleotides of the anticodon loop of the wild-type molecule was changed from C32A38 to U32A38, U32G38, and C32G38. The codon reading activities of these variants relative to that of the wild type molecule were measured in a cell-free translation system. The reading of both the UCU and UCC codons were lower in all the three variants than in the wild-type molecule.

The precursor of an RNA molecule from bacteriophage T4 infected Escherichia coli cell (p2Sp1 RNA) has the ability to cleave itself. It has been found that the site specific RNA cleavage reaction occurred at the pyridine-adenosine sequence in the presence of a monovalent cation and a non-ionic detergent. In order to investigate the mechanism of this cleavage reaction, we designed a RNA oligonucleotide (UUUAUU) and this RNA was cleavage activity at the U-A sequence.

Replication of retroviral RNA into double-stranded DNA is catalyzed by reverse transcriptase (RT). The polypurine tract (PPT) serves as a primer for plus-strand DNA synthesis and is highly conserved among HIV-1. The PPT region is a possible target for triple-helix formation. Here, we show the effects of triple-helix formation by analyses of melting temperature and gel shift using a foldback triplex-forming-oligonucleotides (FTFOs). We found that the FTFOs containing phosphorothioate groups at the 3'- and 5'-ends, or inside the hairpin loop, exhibited greater exonuclease resistance than the unmodified FTFOs. Several triplex oligonucleotides have thermal stability. The abilities of the FTFOs (DsDG-37) containing the guanosine in place of the cytidine in the third Hoogsteen base-pairing strand to inhibit HIV-1 replications were examined. The FTFOs (DsDG-37) inhibit the replication of HIV-1 more efficiently than the FTFOs (DsD-37) indicating sequence-specific inhibition of HIV-1 replication.

We have designed a new type of antisense oligonucleotide, containing two hairpin loop structures with RNA/DNA base pairs (sense (RNA) and antisense (DNA)) in the double helical stem (nicked and circular dumbbell DNA/RNA chimeric oligonucleotides). The reaction of the nicked and circular dumbbell DNA/RNA chimeric oligonucleotides with RNase H gave the corresponding anti-DNA together with the sense RNA cleavage products. These oligonucleotides were more resistant to exonuclease attack. We also describe the anti-Fluv activities of circular dumbbell DNA/RNA chimeric oligonucleotides.

The hepatic extraction ratios (EH) of 5-fluorouracil (FUra) in rats were studied to clarify the disposition of FUra in the liver. The EH of FUra in rats at infusion rates ranging from 0.375 to 3 mg/kg/min decreased from 0.750 to 0.225. The EH of values of tegafur, a pro-drug of FUra, were 0.076 to 0.103 over the range of infusion rates, 0.577 to 4.616 mg/kg/min, and were much lower than those of FUra. The EH of FUra at an infusion rate of 0.375 mg/kg/min combined with uracil (0.323 mg/kg/min) was 0.646, which was significantly lower than that of FUra alone, 0.750 (P0.001). The EH of FUra combined with interleukin-2 (IL-2) at an infusion rate of 7500 U/kg/min was significantly higher than that of FUra alone (P0.01). The dose dependence of the EH of FUra and the effects of uracil and IL-2 on the EH of FUra corresponded with clinical findings. These results suggest that this experimental model in rats may be useful for predicting the clinical pharmacokinetics and efficacy of FUra. We also studied the effect of IL-2 on the EH of mitomycin C (MMC). The EH of MMC combined with IL-2 was higher than that of MMC alone, but the difference was not significant.

Among 120 non-gonococcal male urethritis, 83 were found to be Chlamydia trachomatis (CT) positive by Chlamydiazyme with 2 to 5 times repeated urethral swab collection during pre-treatment period. Among 97 female partner of male CT urethritis, 76 were CT positive by the same repeated specimen collection from cervix. In the 83 male CT urethritis and the 76 female CT cervicitis, EIA reactive values by Chlamydiazyme and serum CT antibody titer by FA at the first visit were investigated. The EIA reactive values of cervicitis were lower than those of urethritis. There was no case of "CT negative at the first visit and positive at repeated detection" in male urethritis. 3 case of "CT negative at the first visit and CT positive at repeated detection" were experienced among females who were the partner of male CT urethritis. The sensitivity of Chlamydiazyme was found to be enough to decide presence or absence of CT by single specimen collection in male urethritis but not enough in female cervicitis. It could be assumed that by the improved sensitivity of CT detection, CT detection rate would be raised among female cervicitis but not in male urethritis. Positive rate CT serum antibody were 63.9% in male urethritis and 100% in female cervicitis. The clinical value of CT antibody detection might be not as detection method of CT infection in progress, but as non-invasive screening for CT infection up to the present, namely the risk factor of STD, especially in females in whom detection of CT is not complete.

Kinetic analysis of the in vivo tissue distribution of the recombinant human granulocyte colony-stimulating factor (rhG-CSF) derivative, nartograstim (NTG; nartograstim is an international nonproprietary name of KW-2228, Kyowa Hakko Kogyo, Tokyo, Japan) was studied in rats to determine the mechanism of the growth factor's nonlinear pharmacokinetic properties. The early-phase tissue uptake clearance (CL(uptake)) by each tissue was determined within 5 min after the i.v. administration of 125I-NTG. Coadministration of various amounts (0.6-150 microgram/kg) of unlabeled NTG did not produce any significant change in CL(uptake) by kidneys and liver. The hepatic and renal extraction ratios of NTG were low, 0.10 to 0.15, which suggests that there is no saturable uptake system in either of these organs. CL(uptake) by the kidneys was comparable to the glomerular filtration rate of unbound NTG. By contrast, a dose-dependent reduction in CL(uptake) by bone marrow and spleen was clearly observed with increasing doses of unlabeled NTG, i.e., at the maximal dose, these values were 14% and 20%, respectively, of those after a tracer dose. A saturable process was, therefore, involved in the tissue uptake of 125I-NTG by bone marrow and spleen. The intrinsic clearance (Vmax/Km) of this saturable uptake by bone marrow, 1.4 ml min-1 kg-1, was greater than that by the spleen, 0.09 ml min-1 kg-1. The sum of the intrinsic clearances of the saturable process was comparable with the value for the clearance of the saturable elimination process of NTG obtained previously by nonlinear pharmacokinetic analysis.(ABSTRACT TRUNCATED AT 250 WORDS)

A 20-year-old female was admitted because of high fever, hepatosplenomegaly, severe hepatic dysfunction and coagulopathy. Peripheral blood showed pancytopenia and granular lymphocytes bearing the natural killer cell phenotype (CD2+CD3-CD16+CD56+CD57-TCR alpha beta-TCR gamma delta-) constituted 97% of leucocytes. Southern blot analysis of DNA obtained from peripheral blood mononuclear cells showed germ-line configuration of TCR beta, gamma and delta chain genes. EBV-DNA was detected in a single episomal form by using EBV-terminal repeat probe. Bone marrow findings were consistent with hemophagocytic syndrome and administration of VP-16 was effective transiently. After ten months she died from massive gastrointestinal bleeding. An in situ hybridization study identified EBV-RNA (EBER-1) in atypical lymphocytes infiltrating bone marrow, spleen and lymph nodes. Sections of liver showed steatosis and infiltration of T cells (CD3+ and EBER-1-negative) in the portal areas and few atypical lymphocytes in sinusoids. The patients developed an EBV-associated clonal proliferation of natural killer (NK) cells, but the clinical features were suggestive of chronic active EBV infection or virus-associated hemophagocytic syndrome (VAHS) rather than leukemia. Bone marrow transplantation for NK cell leukemia is an issue to be discussed.

Between 1983 and 1991, 465 gonococcal strains isolated in the urological department of Japanese Red Cross Medical Center. The minimum inhibitory concentration (MIC) of these isolates to 22 kinds of antibiotics including penicillins (PC), cephems, tetracyclins (TC) and new quinolons (NQ) were determined and the annual difference of MIC was studied. The annual incidence of penicillinase producing neisseria gonorrhoeae (PPNG) of these 9 years were distributed in 3 to 17% and increasing tendency was not observed. As for Penicillin G, the MIC 90 of PPNG was seven fold higher than that of non-PPNG. No remarked difference was observed between MIC 90 of Cephems, TC and NQ of PPNG and non-PPNG. No annual difference was observed in MIC of PC, Cephems and SPCM. However the rising tendency of MIC was observed in NQ.

We demonstrated that unmodified and modified (phosphorothioate) oligonucleotides prevent cDNA synthesis by AMV, MMLV, or HIV reverse transcriptases. Antisense oligonucleotide/RNA hybrids specifically arrest primer extension. The blockage involves the degradation of the RNA fragment, bound to the antisense oligonucleotide, by reverse transcriptase associated RNase H activity. However, the phosphorothioate oligomer inhibited polymerization, by binding to the AMV- and MMLV-RTs, rather than to the template RNA, whereas there was no competitive binding of the phosphorothioate oligomer on the HIV RT during reverse transcription. Furthermore, the RNase H activity of HIV-RT was only slightly affected by the phosphorothioate oligonucleotide. The anti-HIV activities of phosphorothioate- or 5'-linked lipid-oligonucleotides are also described and some of the problems that still need to be solved are pointed out.

Effects of a single nucleoside modification at the first position of the anticodon of a transfer RNA molecule on its codon reading properties were investigated by use of a cell-free protein synthesis. We prepared two artificial tRNA molecules that differ only in the nucleotide at the first position of the anticodon. One has an unmodified uridine and the other has a 5-methoxyuridine (mo5U). These molecules were charged with labeled serine and introduced into a cell-free protein synthesis directed by a designed mRNA, and the relative codon reading efficiencies were calculated. The results showed that the modification of U into mo5U elevates the reading efficiencies of the UCU and UCG codons but reduces that of the UCA codon.

The ability of homopyrimidine oligonucleotides containing 8-oxo-2'-deoxyadenosine (dAOH) and/or 2'-methoxyuridine (Um) or 2'-fluorouridine (Uf) to form stable, triple helical structures with the sequences containing the recognition site for the class II-S restriction enzyme, Ksp632-I, was studied as a function of pH. The 8-oxo-2'-deoxyadenosine substituted oligomers were shown to bind within the physiological pH range in a pH-independent fashion, without a compromise specificity. On the other hand, the oligonucleotides containing 2'-modified nucleosides (Uf ,Um, dAOH-Um, and dAOH-Uf) bind in a pH-dependent mannerto the target duplex.

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.