Search

Aims This study was performed to examine whether acute pressure overload induced by transverse aortic constriction (TAC) inhibits the neurogenic vasopressor response and, if so, to check the role of cannabinoid CB 1 receptors and/or other mechanisms. Main methods TAC or a sham operation was performed in pithed and vagotomised rats; sham-operated rats were infused with vasopressin to ensure a basal systolic blood pressure (SBP) comparable to that of TAC animals. SBP was increased by 40 mm Hg by electrical stimulation of the preganglionic sympathetic nerve fibres or phenylephrine injection. At the end of the experiments, the atria and aorta were isolated. Key findings TAC reduced the electrically (but not the chemically) induced pressor response by 80%; sham operation plus vasopressin had no effect. While the cannabinoid receptor agonist CP55940 and antagonists of CB 1 receptors (AM251), α 2 -adrenoceptors (rauwolscine) and K ATP channels (glibenclamide) did not modify the inhibitory effect of TAC, adrenal medulla removal did prevent this effect. The contractile effects of noradrenaline and isoprenaline were reduced (isolated left atria), whereas their chronotropic effects (right atria) were not affected by TAC, which also spared the vasoconstrictor responses to phenylephrine (isolated aorta). Significance Acute pressure overload induced by TAC reduces the neurogenic vasopressor response via an unknown presynaptic mechanism, an increase in heart rate induced by catecholamines released from the adrenal medulla and a decrease in the catecholamine-induced heart contractility. A better understanding of the negative consequences induced by the acute pressure overload may help in the design of future heart failure therapies.

In previous studies, long-term cannabis use led to alterations of the endocannabinoid system including an increase in CB1 and/or CB2 receptor messenger RNA (mRNA) in blood cells and an increase in the serum level of the endocannabinoid 2-arachidonoyl glycerol. However, in those studies, cannabis use was stopped only few days before testing or not interrupted at all. Therefore, one cannot decide whether the alterations are due to long-term cannabis abuse or are confounded by acute effects of cannabis. Blood was sampled from donors that had smoked marijuana ≥20 times in their lives but had abstained from cannabis for ≥6 months (high-frequency users, HFU) and from controls (cannabis use ≤5 times lifetime). CB1 and CB2 mRNA was determined in peripheral mononuclear blood cells using the reverse transcriptase polymerase chain reaction. Serum anandamide level was assayed using electrospray tandem mass spectrometry. CB2 mRNA was increased by 45 % in HFU when compared to controls, whereas CB1 mRNA did not differ. The anandamide level in HFU exceeded that in controls by 90 %. Tobacco smoking could be excluded as a confounding factor. In conclusion, marijuana users that had smoked marijuana ≥20 times in their lives and stopped cannabis use at least 6 months before the study show an increase in CB2 receptor mRNA in the blood and in serum anandamide level. These alterations resemble those obtained for marijuana smokers that had stopped cannabis use only few days before testing and may be implicated in the pathogenesis of disorders associated with long-term cannabis use.

β-Adrenoceptor antagonists are important drugs for the treatment of cardiovascular diseases and some of those drugs also block the so-called low-affinity site of β1-adrenoceptors although at much higher concentrations. This low-affinity site, also identified in vivo and in human tissue, may come into play under certain pathophysiological situations including arrhythmias. The aim of our study was to determine the potency of 14 compounds chemically related to bupranolol or bevantolol and two xanthone derivatives at the low-affinity site of the β1-adrenoceptor. The potency of the compounds at the low- and high-affinity site of β1-adrenoceptors (β1L and β1H; both increasing heart rate) was compared in the pithed rat. One compound was also studied in the isolated rat heart and its α1-adrenolytic effect determined in the isolated rat mesenteric artery. In the pithed rat, four compounds blocked the β1L-adrenoceptor at a ≥10-fold lower potency than the β1H-adrenoceptor whereas the xanthone derivative (−)-MH-3 was equipotent. In the spontaneously beating right atrium (−)-MH-3 was a non-competitive antagonist of comparable potency at either receptor; its apparent pD′2 value for the β1L-adrenoceptor ranged from 5.6 to 6.4 under various conditions, including the Langendorff preparation. Its apparent pA2 at the α1-adrenoceptor in the mesenteric artery was 8.4. (−)-MH-3 is the first compound with virtually the same potency at the low- and high-affinity site of β1-adrenoceptors in vivo; it appears to be a non-competitive antagonist at either site in vitro.

We studied the effects of nociceptin, the endogenous ligand of the opioid OP4 receptor, and of two cannabinoid receptor agonists WIN 55,212-2 and CP-55,940 (0.001-1 micromol/kg each) on the neurogenic tachycardia and bradycardia in pithed rats. Electrical stimulation (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibres and injection of nicotine 2 micromol/kg or isoprenaline 0.5 nmol/kg increased heart rate by about 70 beats/min (bpm) in pithed rats pretreated with atropine 1.5-2 micromol/kg. The electrically induced tachycardia was reduced dose dependently by nociceptin, WIN 55,212-2 and CP-55,940 (by 60, 30 and 20% at the highest dose, respectively). The OP4 and cannabinoid receptor agonists diminished the nicotine- but not the isoprenaline-stimulated increase in heart rate. In pithed rats pretreated with propranolol 3 micromol/kg, vagal stimulation (5 Hz, 1 ms, 15 V for 10 s) or injection of methacholine (5-10 nmol/kg) decreased heart rate by about 30 bpm. Nociceptin, but not WIN 55,212-2 or CP-55,940 decreased the vagal bradycardia dose dependently (the inhibitory effect of 1 micromol/kg was about 40%). Nociceptin failed to modify the methacholine-induced decrease in heart rate. The OP4 receptor antagonists naloxone benzoylhydrazone 5 micromol/kg and/or [Phe1Psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 0.7 micromol/kg, but not the OP(1-3) receptor antagonist naloxone 10 micromol/kg, diminished the inhibitory action of nociceptin on the neurogenic tachycardia and bradycardia. The inhibitory effect of both cannabinoid receptor agonists on the neurogenic tachycardia was abolished by the CB1 receptor antagonist SR 141716 0.1 micromol/kg. The present data suggest that the postganglionic sympathetic nerve fibres innervating the rat heart are endowed with presynaptic opioid OP4 and cannabinoid CB1 receptors, activation of which inhibits the neurogenic tachycardia. The parasympathetic nerve fibres innervating the heart and causing bradycardia are endowed with presynaptic opioid OP4 but not cannabinoid receptors.

We determined the affinities of eight novel histamine H(3)-receptor ligands (ethers and carbamates) for H(3)-receptor binding sites and their agonistic/antagonistic effects in two functional H(3)-receptor models. The compounds differ from histamine in that the ethylamine chain is replaced by a propyloxy chain; in the three ethers mentioned below (FUB 335, 373 and 407), R is n-pentyl, 3-methylbutyl and 3,3-dimethylbutyl, respectively. The compounds monophasically inhibited [(3)H]-N(alpha)-methylhistamine binding to mouse cerebral cortex membranes (pK(i) 7.51 - 9.53). The concentration-response curve of histamine for its inhibitory effect on the electrically evoked [(3)H]-noradrenaline overflow from mouse cortex slices was shifted to the right by these compounds (apparent pA(2) 6.61 - 8.00). Only FUB 373 and 407 inhibited the evoked overflow by themselves (intrinsic activities 0.3 and 0.4); these effects were counteracted by the H(3)-receptor antagonist clobenpropit. [(35)S]-GTPgammaS binding to mouse cortex membranes was stimulated by the H(3)-receptor agonist (R)-alpha-methylhistamine in a manner sensitive to clobenpropit. Among the novel compounds only FUB 373 and 407 stimulated [(35)S]-GTPgammaS binding (intrinsic activities 0.6 and 0.4). In conclusion, the novel compounds are partial H(3)-receptor agonists (FUB 373 and 407) or H(3)-receptor antagonists; comparison with FUB 335 shows that the transition from antagonist to agonist is caused by a slight structural change. A protonated N atom in the side chain is not necessary for agonism at H(3) receptors, proposing a receptor-ligand interaction different from that of classical agonists.

We examined whether acetylcholine release in the hippocampus and striatum and noradrenaline release in the hippocampus is altered in CB(1) receptor-deficient mice. The electrically evoked tritium overflow from hippocampal slices preincubated with [(3)H]-choline was increased by about 100% in CB(1)(-/-) compared to CB(1)(+/+) mice whereas the electrically evoked tritium overflow from striatal slices preincubated with [(3)H]-choline and from hippocampal slices preincubated with [(3)H]-noradrenaline did not differ. The cannabinoid receptor agonist, WIN 55,212-2, inhibited, and the CB(1) receptor antagonist, SR 141716, facilitated, the evoked tritium overflow from hippocampal slices (preincubated with [(3)H]-choline) from CB(1)(+/+) as opposed to CB(1)(-/-) mice. Both drugs did not affect the evoked tritium overflow from striatal slices (preincubated with [(3)H]-choline) and from hippocampal slices (preincubated with [(3)H]-noradrenaline) from CB(1)(+/+) and CB(1)(-/-) mice. The selective increase in acetylcholine release in CB(1)(-/-) mice may indicate that the presynaptic CB(1) receptors on the cholinergic neurones of the mouse hippocampus are tonically activated and/or constitutively active in vivo.

Clenbuterol, a lipophilic beta2-adrenoceptor agonist, was investigated in various seizure models of experimental epilepsy. In the maximal electroshock seizure threshold test, clenbuterol (> or =4 mg/kg i.p.) increased the electroconvulsive threshold for tonic seizures in mice. In the traditional maximal electroshock seizure (MES) test in mice, ED50 values of 11 mg/kg i.p. or s.c. were determined. In both models, the beta2-receptor antagonist ICI 118.551 did not antagonize the anticonvulsant activity of clenbuterol. Combinations of clenbuterol with standard antiepileptics revealed additive anticonvulsant effects. Repeated administration of clenbuterol (5 mg/kg s.c., twice daily for 14 days) to mice did not significantly influence its anticonvulsant potency or the effectiveness of phenobarbital in the MES test. In various chemically-induced seizure tests with tonic convulsions, clenbuterol inhibited or tended to suppress the tonic phase. However, this drug was not effective in preventing clonic seizures in the pentylenetetrazol (85 mg/kg s.c.) seizure threshold test. In the rotarod ataxia test (mice), a minimal "neurotoxic" dose (TD50) of 41 mg/kg i.p. was determined. In unrestrained rats with chronically implanted electrodes in the dorsal hippocampus, clenbuterol (2 mg/kg and 4 mg/kg i.p.) significantly reduced the duration of electrically evoked hippocampal afterdischarges. In amygdala-kindled rats, clenbuterol (5 mg/kg and 10 mg/kg i.p.) reduced the seizure severity to stage 3. Additional studies indicated that clenbuterol (6 mg/kg i.p.) increased the heart rate and decreased the blood pressure, but this drug did not alter the plasma level of the two tested antiepileptics phenobarbital and carbamazepine. Furthermore, in whole-cell voltage-clamp experiments on cultured neonatal rat cardiomyocytes, clenbuterol (1-100 microM) depressed the fast sodium current in a concentration- and frequency-dependent manner. In conclusion, the anticonvulsant effects of higher doses of clenbuterol against generalized tonic-clonic and complex partial seizures seem to be related to the inhibition of voltage-dependent sodium channels and not to the modulation of beta-adrenoceptors.

Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The eletrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 microM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 microM abolished the effect of WIN 55,212-2 1 microM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.

Nociceptin, the endogenous ligand of the OP(4) or ORL(1) (opioid receptor-like(1)) receptor, decreases blood pressure and heart rate in anesthetized rats. Since the OP(4) receptor antagonist [Phe(1)Psi(CH(2)-NH)Gly(2)]-nociceptin(1-13)NH(2) possesses an agonistic effect in this model, we examined whether other purported OP(4) receptor antagonists, acetyl-RYYRIK-NH(2) and naloxone benzoylhydrazone, antagonize the depressant effects of nociceptin. Acetyl-RYYRIK-NH(2), like nociceptin and [Phe(1)Psi(CH(2)-NH)Gly(2)]-nociceptin(1-13)NH(2) and unlike naloxone benzoylhydrazone, decreased diastolic blood pressure and heart rate (rank order of potencies: nociceptin approximately equal to acetyl-RYYRIK-NH(2)[Phe(1)Psi(CH(2)-NH)Gly(2)]-nociceptin(1-13)NH(2)). The depressant effects were insensitive to the OP(1-3) receptor antagonist naloxone but diminished by naloxone benzoylhydrazone. In conclusion, the hypotensive and bradycardic effects of nociceptin in the anesthetized rat are mediated via OP(4) receptors, at which acetyl-RYYRIK-NH(2) is a highly potent and efficacious agonist.

In segments of rat vena cava preincubated with [(3)H]-noradrenaline and superfused with physiological salt solution, the influence of agmatine on the electrically evoked [(3)H]-noradrenaline release, the EP(3) prostaglandin receptor-mediated and the alpha(2D)-adrenoceptor-mediated inhibition of evoked [(3)H]-noradrenaline release was investigated. Agmatine (0.1-10 microM) by itself was without effect on evoked [(3)H]-noradrenaline release. In the presence of 10 microM agmatine, the prostaglandin E(2)(PGE(2))-induced EP(3)-receptor-mediated inhibition of [(3)H]-noradrenaline release was not modified, whereas the alpha(2D)-adrenoceptor-mediated inhibition of [(3)H]-noradrenaline release induced by noradrenaline, moxonidine or clonidine was more pronounced than in the absence of agmatine. However, 1 mM agmatine antagonized the moxonidine-induced inhibition of [(3)H]-noradrenaline release. Agmatine concentration-dependently inhibited the binding of [(3)H]-clonidine and [(3)H]-rauwolscine to rat brain cortex membranes (K(i) values 6 microM and 12 microM, respectively). In addition, 30 and 100 microM agmatine increased the rate of association and decreased the rate of dissociation of [(3)H]-clonidine resulting in an increased affinity of the radioligand for the alpha(2D)-adrenoceptors. [(14)C]-agmatine labelled specific binding sites on rat brain cortex membranes. In competition experiments. [(14)C]-agmatine was inhibited from binding to its specific recognition sites by unlabelled agmatine, but not by rauwolscine and moxonidine. In conclusion, the present data indicate that agmatine both acts as an antagonist at the ligand recognition site of the alpha(2D)-adrenoceptor and enhances the effects of alpha(2)-adrenoceptor agonists probably by binding to an allosteric binding site of the alpha(2D)-adrenoceptor which seems to be labelled by [(14)C]-agmatine.

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi

Nociceptin (or orphanin FQ), the endogenous ligand for the opioid receptor-like 1 (ORL1) receptor, decreases blood pressure in the conscious and anesthetized rat. This study examined whether prejunctional inhibitory ORL1 receptors located on the postganglionic sympathetic neurons innervating the resistance vessels are detectable in pithed rats. In pithed and vagotomized rats electrical stimulation of the preganglionic sympathetic nerve fibers, injection of nicotine (2 micromol/kg) or noradrenaline (1 nmol/kg) increased blood pressure by about 30 mmHg. The electrically induced vasopressor response was decreased dose-dependently by nociceptin (0.001-1 micromol/kg; decrease by about 60% at 1 micromol/kg). Nociceptin 0.1 micromol/kg reduced the nicotine-induced vasopressor response by about 40% but at doses up to 1 micromol/kg failed to affect the increase in blood pressure evoked by noradrenaline. The inhibitory action of nociceptin on the electrically and nicotine-induced increase in blood pressure was attenuated by the ORL1 receptor antagonists naloxone benzoylhydrazone (5 micromol/kg) and/or [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (1 micromol/kg) but was not affected by naloxone 10 micromol/kg. In conclusion, the present data suggest that the postganglionic sympathetic nerve fibers innervating the resistance vessels of the rat are endowed with prejunctional ORL1 receptors, activation of which causes inhibition of noradrenaline release.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Mouse brain slices preincubated with [3H]-noradrenaline or [3H]-serotonin were superfused with medium containing naloxone 10 μM; we studied whether nociceptin (the endogenous ligand at ORL1 receptors) affects monoamine release. Furthermore, the affinities of ORL1 ligands were determined using [3H]-nociceptin binding. The electrically (0.3 Hz) evoked tritium overflow in mouse cortex slices preincubated with [3H]-noradrenaline was inhibited by nociceptin and [Tyr14]-nociceptin (maximally by 80%; pEC50 7.52 and 8.28) but not affected by [des-Phe1]-nociceptin (pEC50

Selective H2- and H3-receptor agonists, exhibiting an at least tenfold higher potency than histamine itself at the respective receptors, have been known for several years. Selective H1-receptor agonists with a potency exceeding that of histamine have become available only recently; the most potent are methylhistaprodifen and dimethylhistaprodifen [Nalpha-methyl- and Nalpha,Nalpha-dimethyl-2(3,3-diphenylpropyl)histamine, respectively] with 3.4- and 2.4-fold higher potencies than histamine in vitro (in the guinea-pig ileum). The aim of the present study was to examine whether these compounds and the parent compound histaprodifen are potent H1-receptor agonists in the pithed and in the anaesthetized rat. In pithed, vagotomized rats diastolic blood pressure was decreased by 2-(2-thiazolyl)ethanamine i.v. (which was used as a reference H1-receptor agonist) and by histaprodifen, methylhistaprodifen, and dimethylhistaprodifen; the maximum decrease was about 45 mmHg for each compound, and the potencies, expressed as pED50, the negative logarithm of the dose (in mole per kilogram body weight) eliciting a half-maximal response, were 7.23, 7.55, 8.43 and 8.12, respectively. The dose/response curves of the four compounds were shifted to the right to about the same extent by the H1-receptor antagonist dimetindene (1 micromol/kg i.v.). The vasodepressor response was not affected by combined i.v. administration of the H2- and H3-receptor antagonists ranitidine and thioperamide, by combined i.v. administration of the alpha1- and alpha2-adrenoceptor antagonists prazosin and rauwolscine, and by the beta-adrenoceptor antagonist propranolol i.v. but was attenuated by the inhibitor of NO synthase, N(omega)-nitro-L-arginine methyl ester i.v. In anaesthetized rats 2-(2-thiazolyl)ethanamine, histaprodifen, methylhistaprodifen and dimethylhistaprodifen i.v. also decreased diastolic blood pressure in a manner sensitive to dimetindene i.v. Our data show that histaprodifen and, in particular, methyl and dimethylhistaprodifen are highly potent H1-receptor agonists in vivo.

The effect of histamine and related drugs on the tritium overflow evoked electrically (0.3 Hz) or by introduction of Ca2+ ions into Ca2+-free K+-rich (25 mmol/l) medium containing tetrodotoxin was studied in superfused guinea-pig brain cortex, cerebellum, hippocampus or hypothalamus slices and in mouse brain cortex slices preincubated with 3H-noradrenaline. The electrically evoked tritium overflow in guinea-pig cortex slices was inhibited by histamine; the H3 receptor antagonist clobenpropit reversed the effect of histamine to a slight facilitation. The facilitatory effect of histamine (obtained in the presence of clobenpropit) was not affected by the H1 receptor antagonist mepyramine but abolished by the H2 receptor antagonist ranitidine. In the absence of clobenpropit, ranitidine augmented the inhibitory effect of histamine. In slices superfused in the presence of ranitidine, the evoked overflow was inhibited by histamine and, more potently, by the H3 receptor agonist R-alpha-methylhistamine in a concentration-dependent manner (maximum inhibitory effect obtained for both agonists 30-35%). The concentration-response curve of histamine was shifted to the right by the H3 receptor antagonist thioperamide. R-alpha-methylhistamine inhibited the electrically evoked tritium overflow also in guinea-pig cerebellar, hippocampal and hypothalamic slices. In cortex slices superfused in the presence of clobenpropit, the H2 receptor agonists impromidine and, less potently, R-sopromidine facilitated the evoked overflow in a concentration-dependent manner. S-Sopromidine only tended to increase the evoked overflow. The effect of impromidine was counteracted by the H2 receptor antagonists ranitidine and cimetidine. The extent of the maximum facilitatory effect of impromidine (by 15-20%) was about the same when (i) the Ca2+ concentration in the medium was reduced from 1.3 to 0.98 mmol/l, (ii) the time of exposure to impromidine was reduced from 28 to 8 min or (iii) cerebellar, hippocampal or hypothalamic slices were used instead of cortical slices. The Ca2+-induced tritium overflow in guinea-pig cortex slices was inhibited by histamine (in the presence of ranitidine); this effect was abolished by clobenpropit. In slices superfused in the presence of clobenpropit, impromidine failed to facilitate the Ca2+-evoked tritium overflow. The electrically evoked tritium overflow in mouse brain cortex slices was inhibited by histamine by about 60% (both in the absence or presence of ranitidine). The inhibitory effect of histamine was abolished (but not reversed) by clobenpropit. In conclusion, noradrenaline release in the guinea-pig brain cortex is inhibited via presynaptic H3 receptors and facilitated via H2 receptors not located presynaptically. In the mouse brain cortex, only inhibitory H3 receptors occur. The extent of the H3 receptor-mediated effect is more marked in the mouse than in the guinea-pig brain cortex.

1. We have previously shown (Malinowska & Schlicker, 1996) that the atypical beta-adrenoceptor involved in the positive chronotropic effect of the so-called non-conventional partial beta-adrenoceptor agonists CGP 12177 and cyanopindolol in the pithed rat possesses properties markedly different from those observed for beta3-adrenoceptors in the literature. In the present study, we have directly compared the pharmacological properties of the atypical cardiostimulant beta-adrenoceptor and of the beta3-adrenoceptor mediating the thermogenic response in the brown adipose tissue in pithed and vagotomized rats. 2. Heart rate was dose-dependently increased by CGP 12177 and cyanopindolol by maximally 150 and 100 beats min(-1), yielding pED50 values of 8.0 and 7.3, respectively (pED50, -log10 of the dose in mol kg(-1) body weight i.v. causing the half-maximum effect), but not affected by the selective beta3-adrenoceptor agonist CL 316243 (pED50 > 6.0). 3. CGP 12177, cyanopindolol and CL 316243 increased temperature in the brown adipose tissue by maximally 1 degree C (pED50 values 7.4, 6.3 and 8.6, respectively). 4. The beta1-adrenoceptor antagonist CGP 20712 10 micromol kg(-1), attenuated the cardiostimulatory effect of CGP 12177 and, at a still higher dose (30 micromol kg(-1)), also antagonized its thermogenic effect. The -log10 values of the doses causing a two fold shift of the dose-response curves (DRCs) of CGP 12177 to the right were 6.1 and 5.2, respectively, and were much lower than the corresponding value for the antagonism of CGP 20712 against the beta1-adrenoceptor-mediated positive chronotropic effect which was 8.6. 5. The cardiostimulant and the thermogenic effect of CGP 12177 were not affected by the beta2-adrenoceptor antagonist ICI 118551 10 micromol kg(-1). 6. The beta3-adrenoceptor antagonist SR 59230A (which, by itself, caused a beta1-adrenoceptor-mediated increase in heart rate and, for this reason, was studied after administration of a low dose of CGP 20712) attenuated the cardiostimulant and the thermogenic effect of CGP 12177 to a similar extent. The -log10 values of the doses causing two fold rightward shifts of the DRCs of CGP 12177 were 5.9 and 5.7, respectively. 7. The non-selective beta-adrenoceptor antagonist bupranolol diminished the cardiostimulant and thermogenic response to a very similar extent. The -log10 values causing two fold rightward shifts of the DRCs of CGP 12177 were 5.6 and 5.7, respectively, and were much lower than the corresponding values for the antagonism of bupranolol against the beta1-adrenoceptor-mediated positive chronotropic effect and the beta2-adrenoceptor-mediated decrease in diastolic blood pressure which were 7.6 and 8.3, respectively. 8. The rank order of agonistic potencies for the cardiostimulant effect (CGP 12177 > cyanopindolol > CL 316243) differs from that for the thermogenic response in the brown adipose tissue (CL 316243 > CGP 12177 > cyanopindolol); furthermore, there is a difference with respect to the rank orders of antagonistic potencies for cardiostimulation (CGP 20712 > or = SR 59230A > or = bupranolol > ICI 118551) and thermogenesis (SR 59230A = bupranolol > CGP 20712 > ICI 118551). 9. In conclusion, our study provides further evidence that the atypical cardiostimulant beta-adrenoceptors (causing an increase in heart rate) and beta3-adrenoceptors are pharmacologically different.

Human cerebral cortical slices and synaptosomes, guinea-pig cerebral cortical slices and human right atrial appendages were used to study the effects of SB-216641, a preferential h5-HT1B receptor ligand, and of BRL-15572, a preferential h5-HT1D receptor ligand, on the presynaptic h5-HT1B and h5-HT1B-like autoreceptors in the human and guinea-pig brain preparations, respectively, and on the presynaptic h5-HT1D heteroreceptors in the human atrium. The brain preparations, preincubated with [3H]serotonin ([3H]5-HT), and the segments of atrial appendages, preincubated with [3H]noradrenaline, were superfused with modified Krebs' solution and tritium overflow was evoked electrically (human and guinea-pig cerebral cortex slices and human atrial appendages) or by high K+ (human cerebral cortex synaptosomes). The electrically evoked tritium overflow from guinea-pig cerebral cortex slices was reduced by the 5-HT receptor agonist 5-carboxamidotryptamine (5-CT). This effect was not modified by BRL-15572 (2 microM; concentration 154 times higher than its Ki at h5-HT1D receptors) but was antagonized by SB-216641 (0.1 microM; concentration 100 times higher than its Ki at h5-HT1B receptors; apparent pA2 8.45). SB-216641 (0.1 microM) by itself facilitated, whereas BRL-15572 (2 microM) did not affect, the evoked overflow. In human cerebral cortex slices SB-216641 (0.1 microM) also facilitated, and BRL-15572 (2 microM) again failed to affect, the electrically evoked tritium overflow. In human cerebral cortical synaptosomes, 5-CT reduced the K+-evoked tritium overflow. This response was unaffected by BRL-15572 (300 nM) but antagonized by SB-216641 (15 nM; drug concentrations 23 and 15 times higher than their Ki at h5-HT1D and h5-HT1B receptors, respectively). Both drugs, given alone, did not modify the K+-evoked tritium overflow. In human atrial appendages, the electrically evoked tritium overflow was inhibited by 5-HT in a manner susceptible to antagonism by BRL-15572 (300 nM; 23 times Ki at h5-HT1D receptors) but not by SB-216641 (30 nM; 30 times Ki at h5-HT1B receptors). Both drugs by themselves did not change the electrically evoked tritium overflow. In conclusion, SB-216641 behaves as a preferential antagonist at native human 5-HT1B receptors and BRL-15572 as a preferential antagonist at native human 5-HT1D receptors. These compounds are clearly useful tools for the differentiation between human 5-HT1B and 5-HT1D receptors in functional studies.

The effects of two cannabinoid receptor agonists, R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]pyrrolo[1,2,3-de]-1,4- benzoxazin-yl]-(1-naphthalenyl)-methanone (WIN 55,212-2) and (-)-cis-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-trans-4-(3-hydr oxypropyl)-cyclohexanol (CP-55,940), were studied on (i) the vasopressor response elicited in pithed rats by electrical stimulation of the sympathetic outflow and (ii) the release of 3H-noradrenaline and the vasoconstriction elicited in isolated rat tail arteries by transmural electrical stimulation. In pithed rats, the electrical (1 Hz for 10 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 30 mmHg. This neurogenic vasopressor response (which under the conditions of our study was almost exclusively due to the release of catecholamines) was decreased by WIN 55-212,2 and CP-55,940 in a dose-dependent manner (inhibition by WIN 55,212-2 and CP-55,940, 0.1 micromol/kg each, about 25-30%). The inhibition was identical in adrenalectomized rats and in animals with intact adrenals. The inhibitory action of WIN 55,212-2 and CP-55,940 was abolished by a dose of 0.03 micromol/kg of the CB1 receptor antagonist N-piperidino-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-3-pyrazo le-carboxamide (SR 141716), which, by itself, had no effect. WIN 55,212-2, CP-55,940 and SR 141716 failed to affect the vasopressor response to exogenous noradrenaline (1 nmol/kg), which also increased diastolic blood pressure by about 30 mmHg. In isolated rat tail arteries, the electrically (0.4 Hz) evoked tritium overflow and vasoconstriction were not modified by WIN 55,212-2 and CP-55,940 (1 micromol/l each). In conclusion, the neurogenic vasopressor response in the pithed rat can be modulated via cannabinoid CB1 receptors probably located presynaptically on the postganglionic sympathetic nerve fibres innervating resistance vessels.

Our previous results demonstrate the occurrence of presynaptic inhibitory histamine H3 receptors on sympathetic neurons innervating resistance vessels of the pithed rat. The present study, in which new H3 receptor ligands with increased potency and selectivity (imetit, clobenpropit) were used, was designed to further explore the role of H3 receptors in the regulation of the rat cardiovascular system. In particular we were interested whether these receptors may be activated by endogenous histamine and whether they are detectable in an experimental model of hypertension. All experiments were performed on pithed and vagotomized rats treated with rauwolscine 1 mumol/kg. In normotensive Wistar rats the electrical (1 Hz, 1 ms, 50 V for 20 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 35 mmHg. Two H3 receptor agonists, R-(-)-alpha-methylhistamine and imetit, inhibited the electrically induced increase in diastolic blood pressure in a dose-dependent manner. The maximal effect (about 25%) was obtained for R-(-)-alpha-methylhistamine at about 10 mumol/kg and for imetit at about 1 mumol/kg. Two H3 receptor antagonists, thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg, attenuated the inhibitory effect of imetit. The neurogenic vasopressor response was increased by about 15% by thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg and decreased by 25% by the histamine methyltransferase inhibitor metoprine 37 mumol/kg. R-(-)-alpha-Methylhistamine, imetit, thioperamide, clobenpropit and metoprine did not affect the vasopressor response to exogenously added noradrenaline 0.01 mumol/kg (which increased diastolic blood pressure by about 40 mmHg). Metoprine had only a very low affinity for H3 binding sites (labelled by 3H-N alpha-methylhistamine; pKi 4.46). In pithed Wistar Kyoto (WKY) and spontaneously hypertensive (SHR) rats, electrical (1 Hz, 1 ms, 50 V for 10 s) stimulation increased diastolic blood pressure by 28 and 37 mmHg, respectively. Imetit inhibited the neurogenic vasopressor response to about the same extent in WKY and SHR rats (maximal effect of about 30%). The inhibitory influence of imetit was diminished by thioperamide 1 mumol/kg to about the same degree in rats of either strain. The present study confirms the occurrence of presynaptic H3 receptors on sympathetic nerve fibres involved in the inhibition of the neurogenic vasopressor response. Moreover, it demonstrates that these H3 receptors are probably activated by endogenous histamine and appear to be operative in hypertension.

The possible occurrence of cannabinoid (CB) receptors was studied on superfused guinea-pig retinal discs preincubated with [3H]dopamine or [3H]noradrenaline. Tritium overflow was evoked either electrically (3 Hz) or by re-introduction of Ca2+ 1.3 mM after superfusion with Ca(2+)-free medium containing K+ 30 mM. The accumulation of [3H]dopamine ([3H]DA) and [3H]noradrenaline ([3H]NA) was inhibited by the selective inhibitor of the neuronal dopamine transporter GBR-12909 (pIC50% 7.29 and 7.41, respectively) but not by the selective inhibitor of the neuronal noradrenaline transporter desipramine (1 microM). The electrically or Ca(2+)-evoked tritium overflow in retinal discs preincubated with [3H]DA or [3H]NA was reduced by the CB receptor agonists CP-55,940 and WIN 55,212-2 (pIC50% in discs preincubated with [3H]NA, electrical stimulation: 7.03 and 6.70, respectively) but not affected by the inactive S(-)enantiomer of the latter, WIN 55,212-3 (up to 10 microM). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2: 8.29) which, by itself, increased the evoked overflow. The facilitatory effect of SR 141716 was not affected by GBR-12909 and the dopamine receptor antagonist haloperidol. In conclusion, the dopaminergic neurones of the guinea-pig retina can be labelled by both [3H]DA and [3H]NA. Transmitter release from the dopaminergic neurones is inhibited by activation of cannabinoid receptors of the CB1 type, which appear to be tonically activated by an endogenous CB receptor ligand.

In view of the potential pathophysiological and therapeutic implications, presynaptic 5-HT auto- and heteroreceptors have been identified and characterized in isolated human tissues and their functional role has been determined. Such investigations have been carried out in different laboratories including that of the authors. Basic evidence for the involvement of inhibitory 5-HT receptors in modulation of 5-HT release in the cerebral cortex was obtained in slices: exogenous 5-HT inhibited 5-HT release in a manner susceptible to blockade by methiothepin, which given alone facilitated 5-HT release, probably by preventing endogenous 5-HT from activating the inhibitory receptors. The latter receptors are located on the 5-HT nerve terminals themselves, since 5-HT (and sumatriptan) also inhibited 5-HT release from cortical synaptosomes. Their pharmacological properties conform to those of the 5-HT1D class. Subclassification (5-HT1D alpha or 5-HT1D beta) has been tried with ketanserin which has an at least 60 times higher affinity for 5-HT1D alpha (pki = 7.1) than 5-HT1D beta receptors. Since ketanserin (0.32 microM) did not affect the concentration-response curve for 5-carboxamidotryptamine (5-CT), the presynaptic 5-HT autoreceptor may belong to the 5-HT1D beta rather than the 5-HT1D alpha subtype. The sympathetic nerve terminals of the human saphenous vein are endowed with inhibitory 5-HT1D beta heteroreceptors, as indicated by the potency ratio of several 5-HT receptor agonists in inhibiting noradrenaline release in strips of this blood vessels and by the ability of methiothepin, but not of ketanserin 0.3 microM, to act as an antagonist. Noradrenergic nerves in the dura mater, which probably innervate its microvasculature, may also be endowed with inhibitory 5-HT receptors, since 5-HT inhibited noradrenaline release from this tissue. In strips of atrial appendages, 5-HT receptor agonists (e.g. 5-HT, 5-CT and sumatriptan) inhibited noradrenaline release at potencies which are correlated with their ki values at 5-HT1D alpha and 5-HT1D beta receptors. Since this inhibitory effect was antagonized by ketanserin (0.3 but not 0.03 microM) and methiothepin, the presynaptic 5-HT receptor in this tissue may belong to the 5-HT1D alpha subtype. However, this conclusion needs further confirmation by experiments with more potent and subtype-selective antagonists of 5-HT1D alpha and 5-HT1D beta receptors.

The present study was carried out to examine whether acute experimental myocardial infarction affects the sympathetic transmission to vessels and the heart of pithed rats via a presynaptic mechanism and, if so, to check whether inhibitory presynaptic cannabinoid (CB) receptors and endocannabinoids are involved in this response. In pithed and vagotomized rats, electrical stimulation (0.75 Hz; 1 ms; 50 V; 5 or 15 pulses for increases in heart rate or blood pressure, respectively) of the preganglionic sympathetic nerve fibers or intravenous injection of isoprenaline (0.1 nmol/kg) or noradrenaline (1 nmol/kg) increased heart rate and blood pressure by approximately 50 beats/min and 40 mm Hg, respectively. Ligation of the left coronary artery reduced the electrically (as opposed to the chemically) induced tachycardic and pressor responses by approximately 30 to 40%. The inhibitory effect of myocardial infarction was prevented by the CB(1) receptor antagonist rimonabant but not by the CB(2) receptor antagonist N-[(1S)-endo-1,3,3-trimethyl-bicyclo[2.2.1]heptan-2-yl]-5-(4-chloro-3-methylphenyl)-1-(4-methylbenzyl)-pyra-zole-3-carboxamide (SR144528) and the transient receptor potential vanilloid 1 receptor antagonist capsazepine. The inhibitory effect of myocardial infarction was slightly enhanced by the inhibitors of anandamide and 2-arachidonyl glycerol degradation, 3'-(aminocarbonyl)[1,1'-biphenyl]-3-yl)-cyclohexylcarbamate (URB597) and 4-nitrophenyl-4-(dibenzo[d][1,3]dioxol-5-yl(hydroxy)methyl)piperidine-1-carboxylate (JZL184), respectively. Rimonabant increased myocardial infarction-induced mortality. Our results demonstrate that during the early phase of myocardial infarction the activation of presynaptic CB(1) receptors by endogenously formed cannabinoids contributes to the inhibition of the neurogenic tachycardic and vasopressor responses. Thus, the CB(1) receptor-mediated inhibition of excessive noradrenaline release from the sympathetic nerve fibers innervating the heart and vessels might play a protective role in myocardial ischemia.

It was the aim of the present study to determine the affinities of four neuroleptics and five antidepressants for histamine H3 receptors. In rat brain cortex membranes, the specifically bound [3H]-N alpha-methylhistamine was monophasically displaced by clozapine (pKi 6.15). The other drugs did not completely displace the radioligand even at 100 microM; the pKi values were: haloperidol (4.91); sulpiride (4.73); amitriptyline (4.56); desipramine (4.15); levomepromazine (4.14); fluovoxamine (4.13); maprotiline (4.09); moclobemide (< 4.0). The effect of clozapine was further examined in a functional H3 receptor model, i.e., in superfused mouse brain cortex slices preincubated with [3H]-noradrenaline. The electrically evoked tritium overflow was not affected by clozapine 0.5-32 microM. However, clozapine shifted the concentration-response curve of histamine for its inhibitory effect on the evoked overflow to the right, but did not affect the maximum effect of histamine. The Schild plot yielded a pA2 value of 6.33. In conclusion, clozapine shows an intermediate affinity and potency (as a competitive antagonist) at H3 receptors. The Ki value of clozapine at H3 receptors resembles its Ki value at D2 receptors (the target of the classical neuroleptics), but is higher than its Ki values at D4, 5-HT2 or muscarinic acetylcholine receptors, which according to current hypotheses, might be involved in the atypical profile of clozapine.

1. We determined the affinities of ten novel H3 receptor antagonists in an H3 receptor binding assay and their potencies in two functional H3 receptor models. The novel compounds differ from histamine in that the aminoethyl side chain is replaced by a propyl or butyl chain linked to a polar group (amide, thioamide, ester, guanidine, guanidine ester or urea) which, in turn, is connected to a hexocyclic ring or to an alicyclic ring-containing alkyl residue [corrected]. 2. The specific binding of [3H]-N alpha-methylhistamine to rat brain cortex membranes was monophasically displaced by each of the ten compounds at pKi values ranging from 7.56 to 8.68. 3. Inhibition by histamine of the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]-noradrenaline was antagonized by the ten compounds and the concentration-response curve was shifted to the right with apparent pA2 values ranging from 7.07 to 9.20. 4. The electrically induced contraction in guinea-pig ileum strips (which was abolished by atropine) was inhibited by the H3 receptor agonists R-(-)-alpha-methylhistamine (pEC50 7.76), N alpha-methylhistamine (7.90) and imetit (8.18). The concentration-response curve of R-(-)-alpha-methylhistamine was shifted to the right by thioperamide (apparent pA2 8.79) and by the ten novel compounds (range of pA2 values 6.64-8.81). 5. The affinities and potencies were compared by linear regression analysis. This analysis was extended to thioperamide, the standard H3 receptor antagonist, which is also capable of differentiating between H3A and H3B sites. Comparison of the apparent pA2 values in the two functional H3 receptor models yielded a regression coefficient of 0.77 (P0.02). When the pA2 of the drugs in the mouse brain cortex were compared to the pXj for H3 sites (ten novel compounds) and for H3A sites (thioperamide), a significant correlation (r = 0.87; P0.001) was obtained. There was, however, no significant correlation when the pKi of thioperamide for H3B sites was used instead (r = 0.52). In a similar manner, comparison of the pA2 in the guinea-pig ileum with the pKi in the binding assay yielded a significant correlation(r = 0.70, P0.05) only when the pKi of thioperamide for H3A sites was used but not when its pKi forH3B sites was considered (r = 0.17, NS).6 On the basis of these results, structure-activity relationships for the novel H3 receptor antagonists,and the nature of the H3 receptors in the guinea-pig ileum and mouse brain, are considered.

In pithed rats, we studied the effects of prostaglandin E2 and of subtype-selective prostaglandin E receptor (EP receptor) ligands on the rise in blood pressure induced by electrical stimulation of the preganglionic sympathetic nerves. Prostaglandin E2, the EP1/EP3 receptor agonist sulprostone and the EP2/EP3 receptor agonist misoprostol inhibited the electrically induced increase in diastolic blood pressure (rank order of potencies sulprostoneor = misoprostolor = prostaglandin E2); the rise in blood pressure induced by exogenously added noradrenaline was not affected by these compounds. The inhibitory effect of sulprostone on the electrically induced vasopressor response was not significantly changed by indomethacin. Iloprost (an agonist at EP1 and prostacyclin receptors (IP receptors)) failed to affect the electrically evoked increase in blood pressure. The present study suggests that prostaglandin E2 inhibits the release of catecholamines in pithed rats via prostanoid receptors of the EP3 subtype, probably located presynaptically on the postganglionic sympathetic nerve fibres.

Different types of presynaptic inhibitory Gα(i/o) protein-coupled receptors usually do not act independently of each other but rather pre-activation of receptor X impairs the effect mediated via receptor Y. It is, however, unknown whether this interaction extends to the cannabinoid CB(1) receptor on cholinergic neurones and hence we studied whether its activation, pharmacological blockade, or genetic inactivation affects the function of other presynaptic inhibitory receptors. The electrically evoked acetylcholine or noradrenaline release was determined in superfused rodent tissues preincubated with (3)H-choline or (3)H-noradrenaline. The muscarinic M(2) receptor, Gα(i), and Gα(o) proteins were determined in hippocampal synaptosomes by Western blotting. Hippocampal anandamide and 2-arachidonoyl glycerol levels were determined by LC-MS/MS. The inhibitory effect of the muscarinic receptor agonist oxotremorine on acetylcholine release in hippocampal slices was increased by genetic CB(1) receptor ablation (mouse) and the CB(1) antagonist rimonabant (rat but not mouse) and decreased by a cannabinoid receptor agonist (mouse). In mouse tissues, CB(1) receptor ablation also increased the effect of a δ opioid receptor agonist on acetylcholine release in the hippocampus and the effect of oxotremorine on noradrenaline release in the vas deferens. CB(1) receptor ablation, to a very slight extent, increased Gα(o) protein levels without affecting either Gα(i) and M(2) receptor protein or the levels of anandamide and 2-arachidonoyl glycerol in the hippocampus. In conclusion, the CB(1) receptor shows an inhibitory interaction with the muscarinic and δ opioid receptor on cholinergic neurones in the rodent hippocampus and with the muscarinic receptor on noradrenergic neurones in the mouse vas deferens.

The aim of our study was (1) the pharmacological characterization of EP(3) receptors in human pulmonary arteries and (2) the examination of the potential involvement of these receptors in the regulation of neurogenic tachycardia in pithed rats. L-826266 served as the EP(3) receptor antagonist.Experiments were performed on isolated human pulmonary arteries and pithed rats.The prostanoid EP(1)/EP(3) receptor agonist sulprostone (1 nM - 100 μM) concentration-dependently contracted isolated human pulmonary arteries (pEC50, 6.88 ± 0.10). The EP(1) receptor antagonist SC 19920 (100 μM) did not affect the vasoconstriction induced by sulprostone, the TP receptor antagonist sulotroban (10 μM) only slightly attenuated the effects elicited by sulprostone3 μM, whereas L-826266 (10 μM) shifted its concentration-response curve to the right (apparent pA(2) value 6.18; incubation time 0.5 h). In rings exposed to L-826266 (0.1, 1 or 10 μM) for 3 h, a concentration-dependent inhibitory effect against the sulprostone-induced vasoconstriction was obtained, yielding a Schild plot-based pA(2) value of 7.39. In pithed rats, sulprostone (10 - 1,000 nmol/kg), but not the IP/EP(1) receptor agonist iloprost (1-100 nmol/kg), inhibited the electrically evoked increase in heart rate (HR) dose-dependently, maximally by at least 80%. L-826266 (3 μmol/kg) did not affect basal HR and diastolic blood pressure, but reduced the inhibitory effect of sulprostone 1,000 nmol/kg by about 20%.EP(3) receptors (1) located postsynaptically strongly contract human pulmonary arteries and (2) located presynaptically on sympathetic nerve fibers supplying the heart of pithed rats strongly inhibit the neurogenic tachycardia.

In superfused pig retina discs, preincubated with 3H-nor-adrenaline, the electrically (3 Hz) evoked tritium overflow was inhibited by γ-aminobutyric acid (GABA) and the GABAB rec

We studied whether noradrenaline release is affected by interleukin-1β and the neuropeptides urotensin II, melanin-concentrating hormone (MCH), neuropeptide W (NPW) and neuropeptide FF (NPFF). Rodent tissues preincubated with [3H]noradrenaline were superfused, and the effect of peptides on the electrically-evoked tritium overflow ("noradrenaline release") was studied. In mouse brain cortex, interleukin-1β at 0.3 nM and the prostaglandin E2 analogue sulprostone at 3 nM inhibited noradrenaline release by about 40% the effect of interleukin-1β developed gradually, whereas the effect of sulprostone occurred promptly. Urotensin II at 0.001-1 μM did not affect noradrenaline release in rat kidney cortex, whereas 0.01 μM angiotensin II increased it (positive control). MCH at 0.01-1 μM did not alter noradrenaline release in the rat brain cortex, and NPW 1 μM did not affect noradrenaline release in the mouse hypothalamus or hippocampus. In each model, 0.1 μM sulprostone inhibited noradrenaline release (positive control). NPFF and the NPFF2 receptor agonist dNPA (1 μM) did not affect noradrenaline release in the mouse atria; the inhibitory effect of the δ opioid receptor agonist 1 μM DPDPE on noradrenaline release in this tissue was not altered by NPFF or dNPA at 0.32 μM but was counteracted by the δ opioid antagonist naltrindole at 0.001 μM. In conclusion, interleukin-1β inhibits noradrenaline release in the mouse cortex; the effect develops gradually, suggesting that it affects protein biosynthesis. Noradrenergic neurons in various tissues from rodents are devoid of presynaptic receptors for urotensin II, MCH, NPW and NPFF. Finally, an interaction between a δ opioid agonist and NPFF could not be detected.

The human saphenous vein was used to examine whether presynaptic histamine receptors can modulate noradrenaline release and, if so, to determine their pharmacological characteristics. Strips of this blood vessel were incubated with [3H]noradrenaline and subsequently superfused with physiological salt solution containing desipramine and corticosterone. Electrically (2 Hz) evoked 3H overflow was inhibited by histamine and the H3 receptor agonist R-(-)-alpha-methylhistamine. Histamine-induced inhibition of electrically evoked tritium overflow was not affected by alpha 2-adrenoceptor blockade by rauwolscine. S-(+)-alpha-methylhistamine (up to 10 mumol/l) as well as the histamine H1 and H2 receptor agonists 2-(2-thiazolyl)ethylamine (up to 3 mumol/l) and dimaprit (up to 30 mumol/l), respectively, were ineffective. The selective histamine H3 receptor antagonist thioperamide abolished the inhibitory effect of histamine. The histamine H2 and H1 receptor antagonists ranitidine and pheniramine, respectively, did not affect the histamine-induced inhibition of evoked tritium overflow. The present results are compatible with the suggestion that the sympathetic nerves of the human saphenous vein are endowed with inhibitory presynaptic histamine receptors of the H3 class.

Mouse brain cortex slices preincubated with3H-noradrenaline were superfused and the effect of histamine on the electrically (0.3 or 3 Hz) evoked tritium overflow was examined. The evoked overflow was inhibited by histamine and R-(−)-α-methylhistamine but not by 2-(2-thiazolyl)ethylamine and dimaprit. The effect of histamine was antagonized by thioperamide but not by dimethindene and ranitidine. The degree of inhibition produced by histamine was more marked at 0.3 than at 3 Hz and was attenuated by the α2-adrenoceptor agonist talipexole (the former B-HT 920) but increased by phentolamine and the α2-adrenoceptor antagonist rauwolscine. Pre-exposure of slices toN-ethylmaleimide attenuated the inhibitory effect of histamine. The results suggest that histamine inhibits nordrenaline release in the mouse brain cortex via H3 receptors which interact with presynaptic α2-adrenoceptor and may be coupled to a G (e.g. Gi or Go) protein. The extent of H3 receptor-mediated inhibition of nordrenaline release in the mouse brain is more marked than that in the rat brain.

Brain cortex slices were preincubated with 3H-noradrenaline and superfused with physiological salt solution containing desipramine. We studied the inhibition of the electrically evoked tritium overflow caused by histamine in the presence of α-adrenoceptor ligands (mouse and rat brain cortex), and the inhibition caused by talipexole (the former B-HT 920) in the presence of H3-receptor ligands (mouse brain cortex). In mouse brain cortex slices, the inhibitory effect of histamine on the tritium overflow evoked by 36 pulses, 0.3 Hz was not changed by the α1-adrenoceptor antagonist prazosin, but increased by the α2-adrenoceptor antagonist rauwolscine. When the current strength or the duration of electrical pulses was reduced to compensate for the increase in evoked tritium overflow produced by rauwolscine, the latter still. enhanced the effect of histamine. The histamine-induced inhibition of tritium overflow evoked by 360 pulses, 3 Hz was not affected by the α1-adrenoceptor agonist phenylephrine but attenuated by the α2-adrenoceptor- agonist talipexole. Finally, the inhibition by histamine of the tritium overflow evoked by 3 pulses, 100 Hz was attenuated by talipexole but not affected by rauwolscine. Conversely,. the inhibitory effect of talipexole on tritium overflow elicited by 360 pulses, 3 Hz was slightly attenuated by the H3-receptor agonist R-(−)-α-methylhistamine but not, affected by the H3- receptor antagonist thioperamide. In rat brain cortex slices, histamine only tended to inhibit tritium overflow evoked by 360 pulses, 3 Hz, both in the absence of α-adrenoceptor antagonists and in the presence of prazosin. However, histamine markedly inhibited the evoked overflow in the presence of rauwolscine. Again, enhancement of the histamine-induced inhibition also occurred when the current strength or the duration of pulses was reduced in order to compensate for the increase in evoked tritium overflow produced by rauwolscine. The results suggest that the α2-autoreceptors and the H3-heteroreceptors at the noradrenergic nerve endings in the brain of mouse and rat interact with each other. Activation of the α2-autoreceptors decreases, whereas blockade of the activated (but not of the non-activated) α2-autoreceptors increases, the inhibitory effect of histamine. Activation of the H3-heteroreceptors slightly decreases, whereas blockade of the H3-receptors fails to affect, the inhibitory effect of talipexole.

1. The purpose of the present study was to relate the effects of the novel drug, anpirtoline, on 5-hydroxytryptamine (5-HT) receptor subtypes to its antinociceptive and antidepressant-like actions in rodents. 2. Binding assays with rat brain membranes have shown that anpirtoline bound with a much higher affinity to 5-HT1B receptor (Ki = 28 nM) than to 5-HT1A (Ki = 150 nM) and 5-HT2 (Ki = 1.49 microM) receptors. 3. Like 5-HT, anpirtoline concentration-dependently inhibited forskolin-stimulated adenylate cyclase activity in homogenates from the rat substantia nigra. Both effects were not additive, and could be prevented by 5-HT1B receptor antagonists such as propranolol and penbutolol. 4. In superfused rat and pig brain cortex slices preincubated with [3H]-5-HT, the electrically evoked tritium overflow was inhibited by anpirtoline and 5-HT. Whereas 5-HT was equipotent in both tissues (EC50 = 69 nM), anpirtoline was markedly less potent in pig brain cortex slices (EC50 = 1190 nM) than in rat brain cortex slices (EC50 = 55 nM). The concentration-response curve for anpirtoline was shifted to the right by metitepine in both preparations. 5. In the social behaviour deficit test, anpirtoline and trifluoromethylphenyl-piperazine were effective in reversing the isolation-induced impairments in mice, an effect shown only by compounds with agonist properties at the 5-HT1B receptor. 6. In the electrostimulated pain test using mice, anpirtoline dose-dependently increased the pain threshold with an ED50 of 0.52 mg kg-1, i.p. The antinociceptive activity of anpirtoline was abolished by pretreatment with cyproheptadine or propranolol.7. In the forced swimming test in rats, anpirtoline induced a dose-related increase in swimming activity. With an ED50 value of 4.6mgkg-1, i.p., anpirtoline was 4 times more potent than the two standard compounds imipramine and desipramine. The decrease of immobility time or the increase of active periods in this model of behavioural despair is suggested to be characteristic of antidepressant drugs.8. Anpirtoline exhibits both antinociceptive and antidepressant-like activities in animals. It is probable that anpirtoline elicits these pharmacological effects via its agonist effect on 5-HT1B and 5-HT1A receptors.

1 Segments of the rat vena cava preincubated with [3H]-noradrenaline were superfused with [3H]-noradrenaline-free solution containing desipramine and corticosterone and the effects of γ-aminobutyric acid (GABA) receptor ligands and of histamine on tritium overflow evoked by transmural electrical stimulation were studied. 2 GABA inhibited, and histamine failed to affect, the electrically (0.66 Hz) evoked tritium overflow both in the absence and presence of rauwolscine (which was present in the superfusion medium in the subsequent experiments). The effect of GABA was less pronounced at a stimulation frequency of 2 Hz. 3 The inhibitory effect of GABA (pIC35 5.83) on the electrically (0.66 Hz) evoked overflow was mimicked by the GABAB receptor agonist, R-(−)-baclofen (6.07) and less potently by S-(+)-baclofen (3.30) and the GABAA receptor agonist, muscimol (3.70). The concentration-response curve of GABA was shifted to the right by the GABAB receptor antagonist, CGP 35348 (P-(3-aminopropyl)-P-diethoxymethyl-phosphinic acid; apparent pA2 4.76), but not affected by the GABAA receptor antagonist, (−)-bicuculline methiodide 100 μmol1−1. Given alone, (−)-bicuculline methiodide slightly increased, and CGP 35348 did not affect, the evoked overflow. 4 The effect of GABA in veins from rats treated for 14 days with RS-baclofen (10 mg kg−1, i.p. once daily) did not differ from that in veins from rats which received the vehicle instead. The effect of GABA also did not differ in veins from rats treated once either with RS-baclofen or with its vehicle. 5 The results suggest that the postganglionic sympathetic nerve fibres in the rat vena cava are endowed with presynaptic GABAB receptors, but not with receptors for histamine. (−)-Bicuculline methiodide increases noradrenaline release by a mechanism not related to GABAA, GABAB, α2-receptors or noradrenaline uptake.

The effects of neuropeptide Y (NPY), peptide YY (PYY), pancreatic polypeptide and of another four peptides on the electrically evoked 3H overflow were studied in superfused rat brain cortex slices preincubated with 3H-serotonin. In addition, we determined the effect of NPY on the Ca2(+)-induced 3H overflow from rat brain cortex slices and synaptosomes (preincubated with 3H-serotonin) and on the forskolin-stimulated accumulation of cAMP in a membrane fraction from rat brain cortex. The electrically (3 Hz) evoked 3H overflow was inhibited by PYY, NPY and pancreatic polypeptide (decreasing order of potency), but not affected by ACTH1-24, angiotensin II, bradykinin and delta-sleep-inducing peptide. The inhibitory effect of NPY did not change when the stimulation frequency was lowered to 1 Hz, but was markedly reduced at 10 Hz. The inhibitory effect of a presumably maximally active concentration of PYY was not altered in the presence of NPY or pancreatic polypeptide (effects not additive), whereas the inhibition produced by a maximally active concentration of the alpha 2-adrenoceptor agonist clonidine was further increased by NPY. NPY also inhibited (1) the tritium overflow, evoked by introduction of Ca2+, in slices superfused with Ca2(+)-free and K(+)-rich medium containing tetrodotoxin, (2) the tritium overflow, evoked by simultaneously increasing Ca2+ and K+ in the superfusion fluid of synaptosomes previously superfused with Ca2(+)-free medium and (3) the forskolin-stimulated accumulation of cAMP in rat brain cortex membranes. The present results suggest that NPY inhibits serotonin release in the rat brain via presynaptic NPY receptors, which are also activated by PYY and pancreatic polypeptide and may be negatively coupled to an adenylate cyclase.

Rat brain cortex slices preincubated with [ 3 H]serotonin or [ 3 H]noradrenaline (25 100 nmol/l each) were superfused and the effects of serotonin and histamine on the electrically (0.3 or 3 Hz) evoked tritium overflow were studied. In slices preincubated with [ 3 H]serotonin the extent of inhibition of the electrically (3 Hz) evoked tritium overflow produced by histamine was increased when the concentration of [ 3 H]serotonin used for incubation was decreased. The evoked overflow tended to be lower in slices from 2-year-old rats than in slices from 6-month-old animals whereas the inhibitory effect of histamine on the evoked overflow did not differ. Treatment of rats with nimodipine for at least 6 weeks did not significantly affect the evoked overflow in slices from 6-month and 2-year-old rats nor did it significantly alter the serotonin- and histamine-mediated inhibition of the evoked overflow in slices from young adult rats. The extent of histamine-mediated inhibition of the electrically evoked tritium overflow from slices (of young adult rats) preincubated with [ 3 H]noradrenaline did not change when the concentration of [ 3 H]noradrenaline used for incubation was decreased; the degree of inhibition markedly increased when the frequency of stimulation was lowered from 3 to 0.3 Hz. The inhibitory effect of histamine on the electrically (0.3 Hz) evoked overflow was mimicked by the H 3 receptor agonist R-(−)-α-methylhistamine and antagonized by the H 3 receptor antagonist thioperamide. The electrically evoked overflow and its inhibition by histamine were not affected by nimodipine, irrespective of whether the Ca 2+ antagonist was administered in vivo (for at least 6 weeks) or added to the superfusion medium in vitro . It is concluded that (1) the extent of the H 3 receptor-mediated effect in rat brain cortex slices can be markedly increased by lowering the concentration of the tracer in slices preincubated with [ 3 H]serotonin and by lowering the stimulation frequency in slices preincubated with [ 3 H]noradrenaline; (2) the H 3 receptor-mediated inhibition of serotonin release is not changed during aging and (3) nimodipine does not significantly influence serotonin release and noradrenaline release and their serotonin and/or histamine receptor-mediated modulation.

Stimulation-evoked 3 H-noradrenaline release in human cerebrocortical slices was inhibited by histamine (in a manner sensitive to clobenpropit) and by imetit, suggesting H 3 receptor-mediated inhibition of noradrenaline release in human brain.

Rimonabant is an inverse agonist specific for cannabinoid receptors and selective for their cannabinoid-1 (CB(1)) subtype. Although CB(1) receptors are more abundant in the central nervous system, rimonabant has many effects in the periphery, most of which are related to prejunctional modulation of transmitter release from autonomic nerves. However, CB(1) receptors are also expressed in, e.g., adipocytes and endothelial cells. Rimonabant inhibits numerous cardiovascular cannabinoid effects, including the decrease of blood pressure by central and peripheral (cardiac and vascular) sites of action, with the latter often being endothelium dependent. Rimonabant may also antagonize cannabinoid effects in myocardial infarction and in hypotension associated with septic shock or liver cirrhosis. In the gastrointestinal tract, rimonabant counteracts the cannabinoid-induced inhibition of secretion and motility. Although not affecting most cannabinoid effects in the airways, rimonabant counteracts inhibition of smooth-muscle contraction by cannabinoids in urogenital tissues and may interfere with embryo attachment and outgrowth of blastocysts. It inhibits cannabinoid-induced decreases of intraocular pressure. Rimonabant can inhibit proliferation of, maturation of, and energy storage by adipocytes. Among the many cannabinoid effects on hormone secretion, only some are rimonabant sensitive. The effects of rimonabant on the immune system are not fully clear, and it may inhibit or stimulate proliferation in several types of cancer. We conclude that direct effects of rimonabant on adipocytes may contribute to its clinical role in treating obesity. Other peripheral effects, many of which occur prejunctionally, may also contribute to its overall clinical profile and lead to additional indications as well adverse events.

Presynaptic receptors for four families of neuropeptides will be discussed: opioids, neuropeptide Y, adrenocorticotropic hormone (ACTH), and orexins. Presy- naptic receptors for the opioids (µ, δ, κ, and ORL1) and neuropeptide Y (Y2) inhibit transmitter release from a variety of neurones, both in the peripheral and cen- tral nervous systems. These receptors, which were also identified in human tissue, are coupled to Gi/o proteins and block voltage-dependent Ca 2+ channels, activate voltage-dependent K + channels, and/or interfere with the vesicle release machin- ery. Presynaptic receptors for ACTH (MC2 receptors) have so far been identified almost exclusively in cardiovascular tissues from rabbits, where they facilitate nora- drenaline release; they are coupled to Gs protein and act via stimulation of adenylyl cyclase. Presynaptic receptors for orexins (most probably OX2 receptors) have so far almost exclusively been identified in the rat and mouse brain, where they fa- cilitate the release of glutamate and γ-aminobutyric acid (GABA); they are most probably linked to Gq and directly activate the vesicle release machinery or act via a transduction mechanism upstream of the release process. Agonists and an- tagonists at opioid receptors owe at least part of their therapeutic effects to actions on presynaptic receptors. Therapeutic drugs targeting neuropeptide Y and orexin receptors and presynaptic ACTH receptors so far are not available.

1. The effects of gamma-aminobutyric acid (GABA) and related drugs on the vasopressor response induced by electrical stimulation (single pulse of 30 V and 1 ms) of the preganglionic sympathetic nerve fibres or by injection of noradrenaline 0.3 nmol kg-1 were studied in the pithed rat. 2. The electrically-induced increase in diastolic blood pressure was inhibited by GABA and the GABAB-receptor agonist R-(--)-baclofen but was not affected by its S-(+)-enantiomer and by the GABAA-receptor agonists muscimol and 3-aminopropane sulphonic acid. 3. The dose-response curve of R-(--)-baclofen for its inhibitory effect on the electrically-induced vasopressor response was shifted to the right by the GABAB-receptor antagonist 2-hydroxysaclofen, but was not affected by the GABAA-receptor antagonist bicuculline. 2-Hydroxysaclofen and bicuculline by themselves did not affect the electrically-induced vasopressor response. 4. The increase in diastolic blood pressure induced by exogenous noradrenaline was not affected by the GABA-related drugs, which also had no (or very slight) effects on the basal diastolic blood pressure. 5. It is concluded that GABA inhibits catecholamine release in the resistance vessels of the rat via GABAB-receptors, probably located presynaptically on the postganglionic sympathetic nerve fibres.

The dose-response curve for the vasopressor effect of alpha, beta-methylene ATP in pithed rats was influenced by four suramin-related drugs (each at 100 mumol/kg). The curve was shifted to the right by a factor of 8 by 'compound 3' and by a factor of 2 by two other derivatives, but was not affected by the fourth analogue. Compound 3 had no effect on the vasopressor response to noradrenaline or neuropeptide Y. In conclusion, compound 3 is a purine P2X receptor antagonist which is approximately as potent as suramin, and which, like suramin, does not exhibit antagonistic properties at alpha-adrenoceptors and neuropeptide y receptors.

Serotonin (5-HT) plays a major role as a neurotransmitter in the brain and large amounts are found in blood platelets. 5-HT release can be induced by action potentials invading the nerve terminals and by platelet aggregation. The targets of 5-HT are specific receptors mediating a wide variety of central and peripheral effects. For two of the main 5-HT receptor classes, the 5-HT2 and 5-HT3 receptors, selective antagonists are available, but this is not the case for the heterogeneous population of 5-HT1 receptors. In addition, the drugs with antagonistic properties at the 5-HT1A, 5-HT1B, 5-HT1C, and 5-HT1D receptors block other 5-HT receptors or even entirely different receptors (e.g., beta-adrenoceptors); as a rule, they do not discriminate between the four 5-HT receptor subtypes. Identification and characterization of these subtypes is further complicated by the fact that, with the exception of drugs activating 5-HT1A receptors, e.g., 8-hydroxy-2-(di-n-propylamino)tetralin (8-OH-DPAT) and urapidil; no subtype-selective agonists are available. Hence, the pharmacological characterization of a 5-HT1 receptor must be based on experiments with several putative 5-HT receptor agonists and antagonists with an overlapping profile of affinities for the various 5-HT1 receptor subclasses. The 5-HT1A receptor is the best-defined subclass and has already been cloned. It has been identified on cell bodies of 5-HT neurons in the raphe nuclei, and it mediates inhibition of cell firing.(ABSTRACT TRUNCATED AT 250 WORDS)

Allergic contact dermatitis affects about 5% of men and 11% of women in industrialized countries and is one of the leading causes for occupational diseases. In an animal model for cutaneous contact hypersensitivity, we show that mice lacking both known cannabinoid receptors display exacerbated allergic inflammation. In contrast, fatty acid amide hydrolase–deficient mice, which have increased levels of the endocannabinoid anandamide, displayed reduced allergic responses in the skin. Cannabinoid receptor antagonists exacerbated allergic inflammation, whereas receptor agonists attenuated inflammation. These results demonstrate a protective role of the endocannabinoid system in contact allergy in the skin and suggest a target for therapeutic intervention.

The CB1 cannabinoid receptor is widely distributed in the central and peripheral nervous system. Within the neuron, the CB1 receptor is often localised in axon terminals, and its activation leads to inhibition of transmitter release. The consequence is inhibition of neurotransmission via a presynaptic mechanism. Inhibition of glutamatergic, GABAergic, glycinergic, cholinergic, noradrenergic and serotonergic neurotransmission has been observed in many regions of the central nervous system. In the peripheral nervous system, CB1 receptor-mediated inhibition of adrenergic, cholinergic and sensory neuroeffector transmission has been frequently observed. It is characteristic for the ubiquitous operation of CB1 receptor-mediated presynaptic inhibition that antagonistic components of functional systems (for example, the excitatory and inhibitory inputs of the same neuron) are simultaneously inhibited by cannabinoids. Inhibition of voltage-dependent calcium channels, activation of potassium channels and direct interference with the synaptic vesicle release mechanism are all implicated in the cannabinoid-evoked inhibition of transmitter release. Many presynaptic CB1 receptors are subject to an endogenous tone, i.e. they are constitutively active and/or are continuously activated by endocannabinoids. Compared with the abundant data on presynaptic inhibition by cannabinoids, there are only a few examples for cannabinoid action on the somadendritic parts of neurons in situ.

The mechanism of action of cannabidiol, one of the major constituents of cannabis, is not well understood but a noncompetitive interaction with mu opioid receptors has been suggested on the basis of saturation binding experiments. The aim of the present study was to examine whether cannabidiol is an allosteric modulator at this receptor, using kinetic binding studies, which are particularly sensitive for the measurement of allosteric interactions at G protein-coupled receptors. In addition, we studied whether such a mechanism also extends to the delta opioid receptor. For comparison, (-)-Delta9-tetrahydrocannabinol (THC; another major constituent of cannabis) and rimonabant (a cannabinoid CB1 receptor antagonist) were studied. In mu opioid receptor binding studies on rat cerebral cortex membrane homogenates, the agonist 3H-DAMGO bound to a homogeneous class of binding sites with a KD of 0.68+/-0.02 nM and a Bmax of 203+/-7 fmol/mg protein. The dissociation of 3H-DAMGO induced by naloxone 10 microM (half life time of 7+/-1 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 12 and 2, respectively. The respective pEC50 values for a half-maximum elevation of the dissociation rate constant k(off) were 4.38 and 4.67; 3H-DAMGO dissociation was not affected by rimonabant 10 microM. In delta opioid receptor binding studies on rat cerebral cortex membrane homogenates, the antagonist 3H-naltrindole bound to a homogeneous class of binding sites with a KD of 0.24+/-0.02 nM and a Bmax of 352+/-22 fmol/mg protein. The dissociation of 3H-naltrindole induced by naltrindole 10 microM (half life time of 119+/-3 min) was accelerated by cannabidiol and THC (at 100 microM, each) by a factor of 2, each. The respective pEC50 values were 4.10 and 5.00; 3H-naltrindole dissociation was not affected by rimonabant 10 microM. The present study shows that cannabidiol is an allosteric modulator at mu and delta opioid receptors. This property is shared by THC but not by rimonabant.

We examined whether the beta2-adrenoceptor agonists fenoterol and salbutamol, the beta3-adrenoceptor agonists CL 316243 and ZD 2079, and the agonists of the low-affinity state of beta-adrenoceptors, cyanopindolol and CGP 12177 block alpha1-adrenoceptors in that concentration range in which they relax the human pulmonary and rat mesenteric arteries preconstricted with phenylephrine 10 microM and 1 microM, respectively. For quantification of vasodilatation pEC25 values and for the antagonism toward alpha1-adrenoceptors, pA2 values were determined. We found that in the rat mesenteric artery, (1) the pEC25 values of the beta-adrenoceptor ligands resemble their respective pA2 values (differenceor = 0.9 log units), and (2) the order of potencies is the same for both parameters, ie, cyanopindolol approximately fenoterolCGP 12177salbutamolZD 2079CL 316243. In the human pulmonary artery, (1) the pEC25 values are slightly lower (by 0.6-1.3 log units) than their respective pA2 values, and (2) the rank order of potencies is the same for both parameters. In conclusion, the present study suggests that ligands of beta2-adrenoceptors and of non-beta1-non-beta2-adrenoceptors relax rat and human vessels preconstricted with phenylephrine or norepinephrine mainly through their alpha1-adrenolytic effects. Hence, for the investigation of the role of beta-adrenoceptors in vessels, the constrictor agent should be chosen with great caution.