Search

Your search keyword '"De la Torre, L."' showing total 355 results

Search Constraints

Start Over You searched for: Author "De la Torre, L." Remove constraint Author: "De la Torre, L."
355 results on '"De la Torre, L."'

Search Results

51. Differential Association of Niemann-Pick C1 Gene Polymorphisms with Maternal Prepregnancy Overweight and Gestational Diabetes

52. Guidelines for the management of postoperative soiling in children with Hirschsprung disease.

56. Factors influencing metal price selection in mining feasibility studies

57. Follicular Development and Secretion of Ovarian Hormones during the Juvenile and Adult Reproductive Lives of the Myelin Mutant taiep Rat: An Animal Model of Demyelinating Diseases.

60. Corrigendum to 'Increase of upper troposphere/lower stratosphere wave baroclinicity during the second half of the 20th century'

61. One-way avoidance learning and diazepam in female roman high-avoidance and low-avoidance rats

62. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

64. ¿Internet: un medio de sociabilidad o de exclusión?

70. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1 and - -Mex2.

77. The differential of the strong product graphs.

87. Changes in methadone maintenance therapy during and after pregnancy.

88. Caracterización de las propiedades ópticas de Betacianinas y Betaxantinas por espectroscopía Uv-Vis y barrido en Z.

89. THE PORTRAITS OF TOBIAS SMOLLETT

90. El Jurásico calcáreo de Sot de Chera (Valencia)

92. El Jurásico calcáreo de Sot de Chera (Valencia)

94. Making sense of the geology in the copper mining economy.

95. Financing and competitiveness in copper mining.

96. Significance of the 'cut off - average grade - tonnage' sensitivity analysis in mining projects.

97. Analysis of the selection of the most suitable metal price for a mineral project design.

98. Factors influencing metal price selection in mining feasibility studies.

99. The need for iron ore and the environmental Kuznets curve: Spain.

Catalog

Books, media, physical & digital resources