Search

International audience; Brettanomyces bruxellensis is a unicellular fungus of increasing industrial and scientific interest over the past 15 years. Previous studies revealed high genotypic diversity amongst B. bruxellensis strains as well as strain-dependent phenotypic characteristics. Genomic assemblies revealed that some strains harbour triploid genomes and based upon prior genotyping it was inferred that a triploid population was widely dispersed across Australian wine regions. We performed an intraspecific diversity genotypic survey of 1488 B. bruxellensis isolates from 29 countries, 5 continents and 9 different fermentation niches. Using microsatellite analysis in combination with different statistical approaches, we demonstrate that the studied population is structured according to ploidy level, substrate of isolation and geographical origin of the strains, underlying the relative importance of each factor. We found that geographical origin has a different contribution to the population structure according to the substrate of origin, suggesting an anthropic influence on the spatial biodiversity of this microorganism of industrial interest. The observed clustering was correlated to variable stress response, as strains from different groups displayed variation in tolerance to the wine preservative sulfur dioxide (SO2). The potential contribution of the triploid state for adaptation to industrial fermentations and dissemination of the species B. bruxellensis is discussed.

For 15 years, non-Saccharomyces starter cultures represent a new interesting segment in the dynamic field of multinationals and national companies that develop and sell microbial-based biotechnological solutions for the wine sector. Although the diversity and the properties of non- Saccharomyces species/strains have been recently fully reviewed, less attention has been deserved to the commercial starter cultures in term of scientific findings, patents, and their innovative applications. : Considering the potential reservoir of biotechnological innovation, these issues represent an underestimated possible driver of coordination and harmonization of research and development activities in the field of wine microbiology. After a wide survey, we encompassed 26 different commercial yeasts starter cultures formulated in combination with at least one non-Saccharomyces strain. The most recent scientific advances have been explored delving into the oenological significance of these commercial starter cultures. Finally, we propose an examination of patent literature for the main yeasts species commercialised in non-Saccharomyces based products. : We highlight the presence of asymmetries among scientific findings and the number of patents concerning non-Saccharomyces-based commercial products for oenological purposes. Further investigations on these microbial resources might open new perspectives and stimulate attractive innovations in the field of wine-making biotechnologies.

Background Noninvasive ventilation (NIV) is the first-line treatment of adult patients with exacerbations of cystic fibrosis (CF). High-flow nasal oxygen therapy (HFNT) might benefit patients with hypoxemia and can reduce physiological dead space. We hypothesized that HFNT and NIV would similarly reduce work of breathing and improving breathing pattern in CF patients. Our objective was to compare the effects of HFNT versus NIV in terms of work of breathing, assessed noninvasively by the thickening fraction of the diaphragm (TFdi, measured with ultrasound), breathing pattern, transcutaneous CO2 (PtcCO2), hemodynamics, dyspnea and comfort. Methods Adult CF patients who had been stabilized after requiring ventilatory support for a few days were enrolled and ventilated with HFNT and NIV for 30 min in crossover random order. Results Fifteen patients were enrolled. Compared to baseline, HFNT, but not NIV, reduced respiratory rate (by 3 breaths/min, p = 0.01) and minute ventilation (by 2 L/min, p = 0.01). Patients also took slightly larger tidal volumes with HFNT compared to NIV (p = 0.02). TFdi per breath was similar under the two techniques and did not change from baseline. MAP increased from baseline with NIV and compared to HFNT (p ≤ 0.01). Comfort was poorer with the application of both HFNT and NIV than baseline. No differences were found for heart rate, SpO2, PtcCO2 or dyspnea. Conclusions In adult CF patients stabilized after indication for ventilatory support, HFNT and NIV have similar effects on diaphragmatic work per breath, but high-flow therapy confers additional physiological benefits by decreasing respiratory rate and minute ventilation. Clinical trial registration Ethics Committee of St. Michael’s Hospital (REB #14-338) and clinicaltrial.gov (NCT02262871).

Clinical and hematologic characteristics of beta(β)-thalassemia are determined by several factors resulting in a wide spectrum of severity. Phenotype modulators are: HBB mutations, HBA defects and fetal hemoglobin production modulators (HBG2:g.-158C>T polymorphism, HBS1L-MYB intergenic region and the BCL11A). We characterized 54 genetic variants at these five loci robustly associated with the amelioration of beta-thalassemia phenotype, to build a predictive score of severity using a representative cohort of 890 β-thalassemic patients. Using Cox proportional hazard analysis on a training set, we assessed the effect of these loci on the age at which patient started regular transfusions, built a Thalassemia Severity Score, and validated it on a testing set. Discriminatory power of the model was high (C-index=0.705; R(2)=0.343) and the validation conducted on the testing set confirmed its predictive accuracy with transfusion-free survival probability (P, peer-reviewed

International audience; Non-Saccharomyces (NS) species that are either naturally present in grape must or added in mixed fermentation with S. cerevisiae may impact the wine’s chemical composition and sensory properties. NS yeasts are prevailing during prefermentation and early stages of alcoholic fermentation. However, obtaining the correct balance between S. cerevisiae and NS species is still a critical issue: if S. cerevisiae outcompetes the non-Saccharomyces, it may minimize their impact, while conversely if NS take over S. cerevisiae, it may result in stuck or sluggish fermentations. Here, we propose an original strategy to promote the non-Saccharomyces consortium during the prefermentation stage while securing fermentation completion: the use of a long lag phase S. cerevisiae. Various fermentations in a Sauvignon Blanc with near isogenic S. cerevisiae displaying short or long lag phase were compared. Fermentations were performed with or without a consortium of five non-Saccharomyces yeasts (Hanseniaspora uvarum, Candida zemplinina, Metschnikowia spp., Torulaspora delbrueckii, and Pichia kluyveri), mimicking the composition of natural NS community in grape must. The sensorial analysis highlighted the positive impact of the long lag phase on the wine fruitiness and complexity. Surprisingly, the presence of NS modified only marginally the wine composition but significantly impacted the lag phase of S. cerevisiae. The underlying mechanisms are still unclear, but it is the first time that a study suggests that the wine composition can be affected by the lag phase duration per se. Further experiments should address the suitability of the use of long lag phase S. cerevisiae in winemaking.

International audience

Trials 18(1), 247 (2017). doi:10.1186/s13063-017-1987-3

International audience

International audience; BACKGROUND: The role of microparticles (MPs) in the inflammatory process of cystic fibrosis (CF) airways is not known. Here, we have studied the pro-inflammatory potential of CF MPs in a model of acute lung injury.METHODS: Swiss mice were subjected to intratracheal administration of MPs obtained from CF and primary ciliary diskinesia (PCD) patients. Histopathology, total and differential cell counts in bronchoalveolar lavage fluid were used to evaluate the inflammatory reaction in the lung. Lipopolysaccharide (LPS)-like activity of MPs was studied by Limulus amebocyte lysate assay.RESULTS: MPs obtained from acute CF patients determined peribronchial and perivascular inflammatory infiltrates similar to those elicited by LPS. This inflammation was granulocyte-dominated and higher than that determined by MPs obtained from stable CF, whereas PCD MPs caused a macrophage-dominated inflammation. While LPS-activity was not found in circulating blood MPs prepared from CF patients, it was present in MPs obtained from CF sputum and sputum CD66b(+) neutrophils. Finally, LPS-like activity was only detected in circulating MPs after incubation with LPS as well as in MPs obtained from LPS-stimulated neutrophils obtained from healthy donors.CONCLUSIONS: These data suggest that the pro-inflammatory potential of neutrophil-derived MPs in the CF airways may be subsequent to the binding of shedded LPS.

International audience; The spoilage potential of Brettanomyces bruxellensis in wine is strongly connected with the aptitude of this yeast to enter in a Viable But Non Culturable (VBNC) state when exposed to the harsh wine conditions. In this work, we characterized the VBNC behaviour of seven strains of B. bruxellensis representing a regional intraspecific biodiversity, reporting conclusive evidence for the assessment of VBNC as a strain-dependent character. The VBNC behaviour was monitored by fluorescein diacetate staining/flow cytometry for eleven days after addition of 0.4, 0.6, 0.8, 1 and 1.2 mg/L of molecular SO2 (entrance in the VBNC state) and after SO2 removal (exit from the VBNC state). Furthermore, one representative strain was selected and RNA-seq analysis performed after exposure to 1.2 mg/L SO2 and during the recovery phase. 30 and 1634 genes were identified as differentially expressed following VBNC entrance and 'resuscitation', respectively. The results reported strongly suggested that the entrance in the SO2-induced VBNC state in B. bruxellensis is associated with both, sulfite toxicity and oxidative stress response, confirming the crucial role of genes/proteins involved in redox cell homeostasis. Among the genes induced during recovery, the expression of genes involved in carbohydrate metabolism and encoding heat shock proteins, as well as enriched categories including amino acid transport and transporter activity was observed. The evidences of a general repression of genes involved in DNA replication suggest the occurrence of a true resuscitation of cell rather than a simple regrowth

International audience

International audience; The knowledge of biopolymer changes by extrusion is very important for a wide range of industrial applications that spreads from extruded food to biodegradable packaging. In this article, the formation of starch-lipid and lipid-protein complexes that occurred during the extrusion cooking of wheat flour with the addition of fatty acids was studied. Results showed that the highest barrel temperature (128.3 degrees C) promoted the formation of starch-lipid complexes in samples made up of wheat starch and wheat flour with the addition of fatty acids. The maximum formation of protein-lipid complexes (68% fatty acid bound to protein) was observed at the highest barrel temperature and water feed content (

International audience; In light of the increasing attention towards "green" solutions to improve food quality, the use of aromatic-enhancing microorganisms offers the advantage to be a natural and sustainable solution that did not negatively influence the list of ingredients. In this study, we characterize, for the first time, volatile organic compounds (VOCs) associated with aromatic bakery yeasts. Three commercial bakery starter cultures, respectively formulated with three Saccharomyces cerevisiae strains, isolated from white wine, red wine, and beer, were monitored by a proton-transfer-reaction time-of-flight mass spectrometer (PTR-ToF-MS), a direct injection analytical technique for detecting volatile organic compounds with high sensitivity (VOCs). Two ethanol-related peaks (m/z 65.059 and 75.080) described qualitative differences in fermentative performances. The release of compounds associated to the peaks at m/z 89.059, m/z 103.075, and m/z 117.093, tentatively identified as acetoin and esters, are coherent with claimed flavor properties of the investigated strains. We propose these mass peaks and their related fragments as biomarkers to optimize the aromatic performances of commercial preparations and for the rapid massive screening of yeast collections.

Energy efficiency and the reduction of greenhouse gas emissions are actual key issues in all the economic sectors and, in particular, in buildings which is acknowledged worldwide as one of the most energy-consuming. In this context, it would be desirable to duly address those issues by searching for and assessing proper solutions and strategies: the usage of eco-friendly construction materials can be considered as one of those. This paper reports upon the performance of three facades containing sustainable products that are manufactured using natural resources and, alternatively, post-consumer waste based materials; those are: hemp-concrete; and Recycled PolyEthylene Terephthalate (R-PET), respectively. The energy performance of each facade was assessed in terms of cooling and heating demands, electrical consumptions and indoor thermal comfort including indoor temperature and relative humidity. Additionally, a Carbon Footprint (CF) assessment was carried out considering both the estimated energy demands and the life-cycle emission factors associated with the energy mix of the countries where the facades were located, i.e. France and Italy. Based upon the findings of the study, the R-PET facade represented the most performing solution between the three facades in all the scenarios considered and, moreover, the humidity-sensitive flow rate ventilation system came out as a solution able to reduce the electricity consumptions. Finally, considering the Carbon Footprint results, the energy country mix emerged as a key issue, making the Italian case study the worst one, though the total electrical energy consumption were comparable with those of the other case studies.

International audience

International audience; The paper examines the biowaste management issues across rural areas of Romania in the context of poor waste management infrastructure in the last decade (2003-2012). Biowaste is the main fraction of municipal waste, thus a proper management is a key challenge in order to sustain a bioeconomy in the near future. The amount of biowaste generated and uncollected by waste operators is generally uncontrolled disposed if not recovered through home composting. The paper points out the role of home composting in diverting the biowaste from wild dumps and landfills for the regions covered or not by waste collection services. Home composting and the biowaste losses are further assessed based on several scenarios (worse-case, pessimistic, realistic, optimistic) where the net loads of greenhouse gasses (GHG) are calculated at national and regional levels. The transition of home composting techniques, from open piles to plastic bins with respect to standard guidelines will improve the home composting performance in terms of compost quality and net GHG's savings, supporting a bio-based economy which will lead towards a sustainable rural development. Regional disparities are revealed across Romanian counties and the paper opens new research perspectives regarding which options should be adopted by counties and rural municipalities in the biowaste management process.

International audience; Water-soluble biopolymers (SBO) were isolated from the alkaline hydrolysate of two materials sampled from an urban waste treatment plant; that is, an anaerobic fermentation digestate and a compost. The digestate biopolymers contained more lipophilic and aliphatic C, and less acidic functional groups than the compost biopolymers. The SBO were blended with poly (vinyl alcohol-co-ethylene), hereinafter EVOH. The blends were extruded and characterized by FTIR spectroscopy, size exclusion chromatography (SEC)-multi angle static light scattering (MALS) analysis, and for their thermal, rheological, and mechanical properties. The blends behavior depended on the type of SBO and its relative content. Evidence was obtained for a condensation reaction occurring between the EVOH and SBO. The best results were obtained with the blends containing up to 10% SBO isolated from the biowaste anaerobic digestate. Compared with the neat EVOH, these blends exhibited lower melt viscosity and no significant or great difference in mechanical properties. The results on the extrudates, compared with those previously obtained on the same blends obtained by solvent casting, indicate that the blends properties depend strongly also on the processing technology.

Oenococcus oeni is the main lactic acid bacteria found in spontaneous malolactic fermentation (MLF) of wine. During MLF, malic acid is converted into lactic acid, modulating wine’s acidity and improving its taste. The metabolic activity of O. oeni also produces changes in the composition of wine, modifying its aromatic profile. Previous studies have suggested that the species is divided in two major phylogenetic groups, namely A and B. We have examined O. oeni under comparative genomics approaches by the aid of bioinformatics tools developed in-place, unveiling the existence of more phylogenetic groups of O. oeni than previously thought. Moreover, our results suggest that certain groups are domesticated to specific products such as red wine, white wine, champagne and cider. This phenomenon is visible at different levels of the strains’ genomes: sequence identity, genomic signatures, and group-specific features such as presence/absence of genes and unique mutations. With the aim of understanding the impact of group-specific genomic features on the species adaptation to different products, we have selected a set of strains isolated from the same region, but belonging to two different genetic groups and adapted either to red wine, either to white wine. An integrated analysis of genomic and metabolomic data reveals that the genomic features of each genetic group have an impact on the strains adaptation to their respective niches, affecting the composition of the volatile fraction of wine.; Oenococcus oeni est la principale bactérie lactique retrouvée dans les fermentations malolactiques (FML) spontanées du vin. Pendant la FML, l’acide malique est converti en acide lactique, modulant l’acidité du vin et améliorant son goût. L’activité métabolique d’O. oeni produit aussi des changements dans la composition du vin, modifiant son profil aromatique. Des études précédentes ont suggéré que l’espèce est divisée en deux principaux groupes génétiques, désignés A et B. Nous avons examiné les souches d’O. oeni sous des approches de génomique comparative à l’aide d’outils bioinformatiques développés sur place, dévoilant l’existence de nouveaux de groupes et sous-groupes de souches. En outre, nos résultats suggèrent que certains groupes contiennent des souches qui sont adaptées à des produits spécifiques tels que le vin rouge, vin blanc, champagne et cidre. Ce phénomène est visible à différents niveaux des génomes des souches : l’identité de séquence, les signatures génomiques, et les caractéristiques génomiques spécifiques de groupes telles que la présence/absence de gènes et les mutations uniques. Afin de comprendre l’impact des caractéristiques génomiques dans l’adaptation de l’espèce à différents produits, nous avons sélectionné une collection de souches isolées de la même région, mais appartenant à deux groupes génétiques différents et adaptées soit au vin rouge, soit au vin blanc. Une analyse de données génomiques et métabolomiques intégrées révèle que les caractéristiques génomiques des souches de chaque groupe ont un impact sur l’adaptation des bactéries à leurs niches respectives et sur la composition de la fraction volatile du vin.

Summary The formation of starch–lipid complexes plays an important role in extruded products. The effect of gluten proteins on thermal conditions at which the starch–lipid complexes formed during extrusion cooking of wheat flour with the addition of oleic acid was evaluated, considering wheat starch as a reference. The presence of gluten proteins in wheat flour extrudates brought about a reduction of the formation of starch–lipid complexes compared to blend of wheat starch and oleic acid extruded at the same operating conditions (melting enthalpy: 0.4 vs. 1.6 kJ kg−1). Moreover, the lubricant effect of oleic acid observed during extrusion of wheat starch (low values of specific mechanical energy and residence time) was not found during extrusion of wheat flour with addition of oleic acid because of the interaction between gluten proteins and oleic acid. This research points out the importance of proteins on biopolymer modifications and their effect on extrudate quality.

International audience

There is evidence that cystic fibrosis transmembrane conductance regulator (CFTR) interacting proteins play critical roles in the proper expression and function of CFTR. The Na(+)/H(+) exchanger regulatory factor isoform 1 (NHERF1) was the first identified CFTR-binding protein. Here we further clarify the role of NHERF1 in the regulation of CFTR activity in two human bronchial epithelial cell lines: the normal, 16HBE14o-, and the homozygous DeltaF508 CFTR, CFBE41o-. Confocal analysis in polarized cell monolayers demonstrated that NHERF1 distribution was associated with the apical membrane in 16HBE14o- cells while being primarily cytoplasmic in CFBE41o- cells. Transfection of 16HBE14o- monolayers with vectors encoding for wild-type (wt) NHERF1 increased both apical CFTR expression and apical protein kinase A (PKA)-dependent CFTR-mediated chloride efflux, whereas transfection with NHERF1 mutated in the binding groove of the PDZ domains or truncated for the ERM domain inhibited both the apical CFTR expression and the CFTR-dependent chloride efflux. These data led us to hypothesize an important role for NHERF1 in regulating CFTR localization and stability on the apical membrane of 16HBE14o- cell monolayers. Importantly, wt NHERF1 overexpression in confluent DeltaF508 CFBE41o- and DeltaF508 CFT1-C2 cell monolayers induced both a significant redistribution of CFTR from the cytoplasm to the apical membrane and a PKA-dependent activation of CFTR-dependent chloride secretion.

During February–March 1998, we observed a significant increase (6–8 dB) in the electric field of the CZE (f = 270 kHz, Czech Republic) broadcasting station at a site named AS and located in central Italy. On 13 March 1998 an earthquake (M = 5.2) occurred in Slovenia, starting a strong seismic crisis (M = 6.0 on 12 April, M = 5.1 on 6 May). The distances of the epicentres from the radio receiver were over 400 km, but the epicentres are located in a zone that is in the middle of the CZE-AS path. Previously, we advanced the hypothesis that the increase of radio-signal electric field detected could be a precursor of the Slovenia seismic crisis. At the purpose to precise the connection between this radio anomaly and the preparatory phase of the earthquakes, we analysed in detail the data collected. At first we carried out a FFT on the data and clear harmonic components with period 0.5d, 1d, 14d, 28d and 365d were revealed. These periods are characteristic of gravity tides and therefore, it seems reasonable to consider the previous harmonics in the electric field of the radio signal as components related to tides of the atmosphere, assuming as tides of the atmosphere only the linear action of gravity tides on atmosphere. Then, we carried out band pass filters on our data and we discovered that the February–March 1998 increase is mainly related to an exalting of the harmonics with period 0.5d, 1d, 14d and 28d, i.e. of the (semi)monthly and (semi)diurnal atmospheric tidal components in the radio signal. Supposing that this exalting is produced by a corresponding exalting of the atmospheric tides we propose a model able to explain the production of such an effect during the preparatory phase of the Slovenia earthquakes.

International audience; Oral mucosa is continuously exposed to environmental forces and has to be constantly renewed. Accordingly, the oral mucosa epithelium contains a large reservoir of epithelial stem cells necessary for tissue homeostasis. Despite considerable scientific advances in stem cell behavior in a number of tissues, fewer studies have been devoted to the stem cells in the oral epithelium. Most of oral mucosa stem cells studies are focused on identifying cancer stem cells (CSC) in oral squamous cell carcinomas (OSCCs) among other head and neck cancers. OSCCs are the most prevalent epithelial tumors of the head and neck region, marked by their aggressiveness and invasiveness. Due to their highly tumorigenic properties, it has been suggested that CSC may be the critical population of cancer cells in the development of OSCC metastasis. This review presents a brief overview of epithelium stem cells with implications in oral health, and the clinical implications of the CSC concept in OSCC metastatic dissemination.

In this study, we developed an eco-friendly dry alkaline chemomechanical pretreatment of wheat straw without production of waste and liquid fractions with objective to save energy input, to decrease the environmental impact and to increase enzymatic hydrolysis. Wheat straw was pretreated with NH 3 , NaOH H 2 O 2 , NH 3 H 2 O 2 and NaOH at high materials concentration (5 kg/L) equivalent to biomass/liquid ratio of 1/5 (dry chemomechanical) and at low materials concentration (0.2 kg/L) equivalent to biomass/liquid ratio of 5/1 (dilute chemomechanical). Untreated and chemical treated wheat straw samples were subjected to grinding and milling following by enzymatic hydrolysis with commercial cellulases. NaOH and NaOH H 2 O 2 dry chemomechanical pretreatments were found to be more effective in decreasing the particle size and energy consumption and increasing the surface area. However, alkaline dilute-chemomechanical treatments consumed higher amounts of water (5 L water/1 kg biomass) and energy compared to dry-chemomechanical treatments. In point of fact, the lowest energy efficiency obtained was 0.417 kg glucose kW h −1 for dilute-chemomechanical treatments compared to 0.888 kg glucose kW h −1 glucose kW h −1 for dry-chemomechanical treatments. Alkaline dry-chemomechanical pretreatments approach appears more attractive and efficient in terms of glucose, energy efficiency and environmental impact, compared to conventional alkaline chemomechanical pretreatments.

Eight alternating polar/non-polar peptides derived from the self-assembling peptide EAK-16 (Ac- AEAEAKAKAEAEAKAK-NH2) were examined in comparison with the EAK-16 parent form (peptide 1), both as-synthesized and after gamma-radiation treatment in oxidative environment (formation of ∙OH radical), to mimic the inflammation process occurring during the first phases of implantation. The peptides were studied for their possible use as biomimetic materials [1] due to their self-assembling properties and to the presence, in two of them, of the RGD sequence, an active modulator of cell adhesion. Previous investigations on titanium surfaces [2] demonstrated that some oligopeptides, i.e. EAK16 (peptide 1), peptide 3 (obtained by K→Orn substitution), peptide 5 (A→Abu substitution), peptide 7 (insertion at the N-terminus of the RGD sequence), and peptide 8 (RGD insertion and “scrambling” of the sequence) were not severely affected by the treatment and retained their prevalent structure. The other peptides, i.e. peptide 2 (obtained by E→D substitution), peptide 4 (E→D and K→Orn substitutions) and peptide 6 (A→Y substitution), underwent significant conformational changes (i.e. increase in the á-helix content). Interestingly, these same last 3 peptides were severely affected also by the radical attack induced by irradiation [3], changing their secondary structure and lateral chains interactions. To better investigate the interaction between peptides and metallic surfaces, we carried out SERS experiments on silver nanoparticles. As regards the as-synthesized peptides, all of them interacted with the Ag colloid by the COO- lateral groups of aspartic or glutamic acid residues. Other observed interaction sites were: - NH2/NH3+ of basic aminoacidic residues (lysine and/or ornithine) in peptides 3, 4 and 7; - amide group in peptides 1, 2, 4 and 8; - the aromatic ring of Tyr side chains in peptide 6. As regards the peptides after irradiation, they still interact through the before-mentioned groups; however, those undergoing conformational changes showed differences in band intensities and positions (see Fig.1) References [1] A. Tinti, M. Di Foggia, P. Taddei, A. Torreggiani, M. Dettin, C. Fagnano, J. Raman Spetrosc. 39, 250 (2008) [2] M. Di Foggia, P. Taddei, A. Torreggiani, M. Dettin, A. Tinti, J. Raman Spetrosc. 42, 276 (2011) [3] M. Di Foggia, P. Taddei, A. Torreggiani, M. Dettin, A. Tinti, J. Raman Spetrosc. 44, 1446 (2013)

Dopo un'ampia introduzione storico-filologica, l'A. presenta l'edizione critica della "Vita et obitus s. Marciani", corredata dalla traduzione italiana. Originale è la soluzione proposta per l'identità storica del santo, un "vir Dei" italico dell'epoca tardoantica, trasfigurato dalla tradizione agiografica nel protovescovo della tarda diocesi di Frigento (Irpinia).

International audience; Aim: To determine the independent contribution of factors including IL28B polymorphisms, IFN-gamma inducible protein-10 (IP-10) levels and the homeostasis model assessment of insulin resistance (HOMA-IR) score in predicting response to therapy in chronic hepatitis C (CHC). Methods Multivariate analysis of factors predicting rapid (RVR) and sustained (SVR) virological response in 280 consecutive, treatment-naive CHC patients treated with peginterferon alpha and ribavirin in a prospective multicenter study. Results Independent predictors of RVR were HCV RNA < 400,000 IU/ml (OR11.37; 95% CI 3.03-42.6), rs12980275 AA (OR 7.09; 1.97-25.56) and IP-10 (OR 0.04; 0.003-0.56) in HCV genotype 1 patients and lower baseline g-glutamyl-transferase levels (OR = 0.02; 0.0009-0.31) in HCV genotype 3 patients. Independent predictors of SVR were rs12980275 AA (OR 9.68; 3.44-27.18), age < 40 yrs (OR = 4.79; 1.50-15.34) and HCV RNA < 400,000 IU/ml (OR 2.74; 1.03-7.27) in HCV genotype 1 patients and rs12980275 AA (OR = 6.26; 1.98-19.74) and age < 40 yrs (OR 5.37; 1.54-18.75) in the 88 HCV genotype 1 patients without a RVR. RVR was by itself predictive of SVR in HCV genotype 1 patients (OR 33.0; 4.06-268.32) and the only independent predictor of SVR in HCV genotype 2 (OR 9.0, 1.72-46.99) or 3 patients (OR 7.8, 1.43-42.67). Conclusions In HCV genotype 1 patients, IL28B polymorphisms, HCV RNA load and IP-10 independently predict RVR. The combination of IL28B polymorphisms, HCV RNA level and age may yield more accurate pre-treatment prediction of SVR. HOMA-IR score is not associated with viral response.

International audience; The influence of antiretroviral therapy on co-receptor tropism remains controversial. To verify if co-receptor tropism shift was affected by HAART, the evolution of proviral DNA V3 genotype after 12 months of a new antiretroviral regimen was compared between responder and non-responder patients. Baseline blood samples were collected from 36 patients infected with HIV-1 subtype-B (18 naïve and 18 experienced) for virus isolation and env V3 genotyping from plasma HIV-1 RNA and PBMC DNA. DNA V3 genotyping was repeated after 12 months from initiating HAART. WebPSSM was used for categorizing V3 sequences into X4 or R5; for analysis purposes, dual/mixed viruses were considered as X4. From the 10 (28%) patients changing their proviral DNA V3 genotype during therapy, six shifted from R5-to-X4 and four from X4-to-R5. The lack of reaching virological suppression was not associated with an X4-to-R5 (p=0.25) or R5-to-X4 (p=0.14) shift; time-to-viral suppression and CD4 increase were similar in both groups. No association was found between tropism shift and patient baseline characteristics including age, sex, CDC stage, CD4 count, viral load, exposure and length of previous HAART, enfuvirtide use in the new regimen, number of reverse-transcriptase and protease resistance-associated mutations. Conversely, CD4 nadir was correlated to emergence of X4 virus in proviral DNA (mean 27.2±30.6 in R5-to-X4 shifting patients vs 161.6±150.6 in non-shifting patients, p=0.02). The occurrence of a tropism shift in both directions was independent of HAART use, irrespective of its efficacy. The CD4 count nadir was the only baseline characteristic able to predict an R5-to-X4 viral shift.

Microparticles (MPs) are membrane vesicles harboring cell surface proteins and containing cytoplasmic components of the original cell. High levels of circulating MPs have been detected in pathological states associated with vascular dysfunction. We took advantage of the self-assembly method of tissue engineering to produce in vitro three vascular constructs from human vascular smooth muscle cells and fibroblasts to investigate the role of the adventitia in the modulation of vascular tone by MPs, comparing the contractile response of each of these constructs to histamine. The first two were composed of an adventitia (tissue-engineered vascular adventitia (TEVA)) or a media (tissue-engineered vascular media (TEVM)) solely, and the third one contained a media and an adventitia (tissue-engineered vascular media and adventitia (TEVMA)). In the three constructs, the results show that histamine induces contraction insensitive to blockade of inducible nitric oxide (NO) synthase (iNOS) and cyclooxygenase-2 (COX-2) and not affected by MP treatment. MPs decreased NO production and nuclear factor (NF)-kappaB expression but did not affect superoxide anion (O(2)(-)) release in TEVA. MPs enhanced NF-kappaB expression but did not affect iNOS and COX-2 expression or NO or O(2)(-) release in TEVM. In TEVMA, MPs did not enhance NF-kappaB expression, but COX-2 expression was higher, and O(2)(-) release was lower. Thus, MPs affected NO, O(2)(-), NF-kappaB, and COX-2 in a subtle fashion to maintain the contractile response to histamine. The use of tissue-engineered vascular constructs results in a better understanding of the effect of MPs on human adventitia and media.

Date du colloque: 10/2009; International audience

International audience; Microparticles (MPs) are small fragments generated from the plasma membrane after cell stimulation or apoptosis. We have recently shown that MPs harboring the morphogen Sonic Hedgehog (MPsShh+) correct endothelial injury by release of nitric oxide from endothelial cells [Agouni, Mostefai, Porro, Carusio, Favre, Richard, Henrion, Martínez and Andriantsitohaina (2007) FASEB J., 21, 2735–2741]. Here, we show that MPsShh+ induce the formation of capillary-like structures in an in vitro model using human endothelial cells, although they inhibited cell migration. Besides, MPsShh+ regulate cell proliferation. Both cell adhesion and expression of proteins involved in this process such as Rho A and phosphorylation of focal-activated kinase were increased by MPsShh+, via a Rho-associated coiled-coil-containing protein kinase inhibitor-sensitive pathway. We demonstrate that MPsShh+ increase messenger RNA and protein levels of proangiogenic factors as measured by quantitative reverse transcription–polymerase chain reaction and western blot. In spite of vascular endothelial growth factor expression, conditioned media from endothelial cells treated avec MPsShh+ reduces angiogenesis. Interestingly, the effects induced by MPsShh+ on the formation of capillary-like structures, expression of adhesion molecules and proangiogenic factors were reversed after silencing of the Shh receptor, using small interfering RNA or when Sonic Hedgehog (Shh) signaling was pharmacologically inhibited with cyclopamine. Taken together, we show that Shh carried by MPsShh+ regulate angiogenesis probably through both a direct and an indirect mechanisms, and we propose that MPs harboring Shh may contribute to the generation of a vascular network in pathologies associated with tumor growth.

International audience; Hedgehog (Hh) proteins belong to a class of morphogens involved in many biological processes during embryonic development; they are relatively silent during normal adult life although they may be recruited postnatally in response to tissue injury. Three secreted proteins have been identified: Sonic hedgehog (Shh), Desert hedgehog and Indian hedgehog. The interaction of Hh ligand with its receptor Patched-1 triggers the activation of smoothened and initiates transduction events that lead to the regulation of transcriptional factors belonging to the Gli family. Hh pathway orchestrates both coronary development and adult coronary neovascularisation by controlling the expression of multiple proangiogenic genes and anti-apoptotic cytokines. Shh pathway enhances the recruitment of endothelial progenitor cells in addition to the mechanisms described for other Hh and concurs to its myocardial protection. In cerebral ischemia, Hh mimicking molecules has been reported to limit damages caused by vessel occlusion. Besides, Shh carried by microparticles corrects endothelial injury through nitric oxide release. Anomalous activations of Hh pathway are implicated in various types of tumours including medulloblastoma, carcinoma of esophagus, stomach, pancreas and colon. Hh can influence angiogenesis in both positive and negative manner and they may have implication for therapeutic strategies to treat either ischemic or cancer diseases.

Objective: Langerhans cell histiocytosis (LCH) is a clonal proliferative multisystem disease. Although bone and mucosae have been classified as non-risk organs, their involvement may increase the risk of disease progression. Oral and periodontal lesions are burdened with a significant impairment of quality of life for associated signs, symptoms and loss of function. Most of information regards paediatric disease; the disease in adults has received limited attention. Subjects and Methods: A total of 31 adult patients affected by immuno-histopathology confirmed LCH have been prospectively examined; attention was paid to the occurrence and characterization of oral lesions. Results: Twelve patients developed oral lesions. Posterior regions of jawbones were always affected; the involvement of anterior regions was not constant. Unifocal oral involvement was significantly associated with multisystemic disease while multifocal lesions were associated with unisystemic disease. Oral disease presented with soft tissue ulcers (50% of cases), gingival bleeding (66.7%), pain (83.4%), periodontal damage (50%), tooth mobility (16.7%), non-healing extraction socket (8.3%); 41.6% of patients complained of negative outcomes on quality of life. Oral lesions were easily handled with local measures. Conclusions: Posterior regions require attention; single oral lesions may be part of multisystemic disease; oral and periodontal lesions may be early signs of disease reactivation.

National audience

In February 2002, a receiver was put into operation at the Department of Physics of Bari University (Southern Italy) to record VLF-LF radio signals. The intensity and the phase of the signals transmitted by GB (f=16 kHz, United Kingdom), FR (f=20.9 kHz, France), GE (f=23.4 kHz, Germany), IC (f=37.5 kHz, Island) and IT (f=54 kHz, Sicily, Italy) has been monitored with a 5 s sampling rate. The intensity raw data averaged over 10 min, from February 2002 to April 2006, have been analysed. Several decreases of the electric field intensity of the radio signals with a duration of some days were revealed, generally occurring in not concomitant periods. The GE signal decreases systematically in winter and summer each year and so, it could be supposed that such decreases are related to the transmitter. On the contrary, all the other decreases pointed out are sporadic and the previous justification does not seem realistic. On the time occurrence of these decreases, the geomagnetic activity, the meteorological conditions in the receiver area and the regional seismic activity were investigated. The main result is that, generally, a pre or post seismic effect seems to give the most convincing justification. The effect seems to appear for earthquakes with magnitude M≥4.3, when the epicentres are within the third Fresnel zone of the radio signals or near enough to some radio path.

Paolino di Nola illustra con una pluralità di espressioni la funzione di mediazione e protezione che i santi svolgono a favore degli uomini. In special modo il XIX carme natalizio sviluppa l’idea della distribuzione geografica del patronato dei santi: Dio ha assegnato un santo a ciascun paese o città nel suo disegno di salvezza del mondo. Con una metafora suggestiva il Nolano rappresenta i santi martiri come le stelle che secondo l’astrologia antica e la credenza popolare presiedono alla sorte di ciascun uomo e regione del mondo (carm. 19, 15 martyr stella loci) L’Autore dapprima focalizza il background ideologico e spirituale di tale concezione, che deriva in vario modo e misura dall’angelologia giudaica e dalla demonologia pagana; infine, dopo aver evidenziato la fortuna di tale metafora nella letteratura patristica, analizza lo sviluppo dell’idea paoliniana nella prima parte del carme (vv. 1-377).

During winter 2005, an unusual virus-like yellow leaf disorder associated to interveinal leaf yellowing and marbling on fruits, was observed in some greenhouse tomato crops in Sicily, exactly in province of Ragusa. Two leaves from 250 symptomatic tomato plants were serologically tested by DAS-ELISA technique using the sera to Tomato spotted wilt virus (TSWV), Impatiens necrotic spot virus (INSV), Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV) and Pepino mosaic virus (PepMV). Of the 250 samples tested, 215 were positive to PepMV presence. This virus was mechanically transmitted to Cucumis sativus “Cubit”, Datura metel, Nicotiana benthamiana and tomato “Rio Grande”. The host range of PepMV-Ragusa differed from that of PepMV found infecting in 2002 tomato “Camone” in Sardinia. To amplify PepMV were utilized primers PepMV-TGB and PepMV-UTR that amplify a fragment of 844 bp containing CP gene, part of TGB gene and UTR3 (14) for PepMV PCR fragments were cloned in apCR2.1 – TOPO vector. Purified recombinant plasmids were sequenced on an ABI PRISM DNA 377 sequencer using standard M13 forward and reverse primers. To compare the PepMV-Ragusa (genbank acc. N. DQ517884) isolate, 14 nucleotide sequences were retrieved from the GenBank entries: nucleotide sequences alignments of CP-PepMV-Ragusa showed homology of 99% with both isolates US2 and Spain-Murcia. From an epidemiological point of view, aspects of the long-distance dissemination of PepMV should be considered, like the trade of living plantlets, seeds, contaminated pots in Southern Italy, occur together, indifferently in the open and greenhouse crops. Restrictive measures are required to avoid the PepMV spreading in others Italian regions.

Seven new AMV (Alfalfa mosaic virus) isolates from officinal plants have been characterized at molecular level. Isolates were from symptomatic plants of Lavandula hybrida (three varieties of lavandins), Lavandula x alardii (one hybrid) and single plants of Lippia citriodora, Ocimum basilicum and Symphytum tuberosum. In all instances symptoms consisted in a more or less extended yellow bright mosaic of the leaves. The nucleotidic and aminoacidic sequences of the coat protein (CP) and movement protein (MP) have been determined for each of them. Phylogenetic relationships conducted on the CP and MP set of sequences showed that all isolates belonged to subgroup I of AMV isolates with the exception for that from the “Sumiens” variety of L. hybrida which was related to subgroup II of AMV isolates. Data were confirmed by RFLPs of the amplicons corresponding to the CP and MP. Since subgroup II have been detected so far only in France, the detection of a subgroup II isolate in Italy could be explained with the accidental introduction of infected vegetative propagate material form France where the “Sumiens” variety was constituted several years ago. The possibility of the diffusion of subgroup II isolates in Italy and related consequences are discussed.

During an epidemiological survey carried out in the Botanical Garden at Bologna University, Cucumber mosaic virus (CMV) has been detected by applying PAS-ELISA technique infecting some ornamental species exhibiting a severe symptomatology on the leaves. Datura innoxia Miller. showed mosaic and leaf-curling; Globularia nudicaulis L. produced narrowed leaves with a yellow mosaic and/or variegation; Eupatorium cannabinum L. showed a systemic chlorotic and/or yellow mosaic and stunting. Reverse transcription-polymerase chain reaction (RT-PCR) and single strand conformation polymorphism (SSCP) were employed to characterise these CMV isolates. Total RNA was extracted from symptomatic leaf samples with a Qiagen RNeasy Plant Minikit (Qiagen S.P.A., Milan, Italy) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP+ CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt). All samples from the three ornamental species, yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with CMV isolates from other ornamental species present in the same Botanical Garden (Thevetia nereifolia and Nandina domestica) (1). The results showed a different sequence variant for each CMV isolate, indicating that these tree isolates are a new accession in the Botanical Garden. Probably these isolates came from the original Country of the plants. 1) Davino et al., 2005. Cucumber mosaic virus infecting Thevetia nereifolia Juss. ex Stedu. and Nandina domestica Thumb. J. Plant Path., 87(4), 292-293.

International audience; On February 1996, a receiver able to measure the electric field strength of LF radio broadcastings, with a sampling frequency of ten minutes, was put into operation in a site (AS) located in central Italy. One of the broadcasting stations selected is MCO (f=216 kHz), located in southeast France, 518 km far from the receiver. The MCO data collected since February 1996 up to September 2004 were examined and, at first, the night time data and the day time data (in winter and summer) were separated. Then, the wavelet analysis on the night and day time data was applied. The main result of the analysis was the appearance of a very clear anomaly during summer (July?August) 1998, at day time and at night time. The anomaly is a strong exaltation of the signal components with period in the 25?40 days range. Theoretical calculations of electric field strength were made and the only way to justify this anomaly seems to be the occurrence of an increase of the ground wave propagation mode of the radio signal. Such an increase could have been produced by an increase of the ground conductivity and by modifications of some parameter of the troposphere, mainly the refractive index. On 15 August 1998 a seismic sequence started with 17 earthquakes (M=2.2?4.6) on the Reatini mountains, a seismogenic zone located 30 km far from the AS receiver along the path MCO-AS. In this paper, the possibility that the previous radio anomaly can be a precursor of this seismic sequence is proposed.

At the beginning of 2002 an OmniPAL receiver was put into operation at the Department of Physics of Bari University (Southern Italy). The electric field strength of five VLF-LF signals transmitted from United Kingdom (f=16kHz), France (f=20.9kHz), Germany (f=23.4kHz), Iceland (f=37.5kHz) and Italy (f=54kHz) has been monitoring with a 5s sampling frequency. In a first step we reduced the amount of the data taking one datum each 10min (mean of the ±5min raw data) and then we smoothed these data by a running adjacent averaging over 7 days. Analysing the trends we obtained, we revealed at first in the signal from the Italian transmitter two clear intensity decreases in April 2002 and in August-September 2002. At these times we observed earthquakes with M=4.3 and M=5.6 respectively near the transmitter-receiver path and a precursory effect in the previous decreases appeared. Then, we noted that all of the five radio trends in the time interval March 2002-February 2003 are more disturbed than in other periods; in particular an evident simultaneous decrease appears in January-February 2003. We propose that these disturbances are related to general excitation of the margin between the African and European plates. In a second step we examined the terminator time (evening) changes for the Italian transmitter in July-September 2002, and we found significant deviations from the mean value at the end of August, which is supportive for some precursory ionospheric signature of earthquakes.

We examined the groundwater Argon content data sampled from 1988 to 2001 at two wells in Kamchatka (Russia) and anomalous increases appeared clearly during June-July 1996. On 21 June, a shallow (1km) earthquake with M=7.1 occurred at a distance less than 250km from the wells and so the previous increases could be related to this earthquake and, in particular, could be considered premonitory anomalies. In order to support this raw interpretation, we analysed the data collected in details. At first we smoothed out the high frequency fluctuations arising from the errors in a single measurement. Next we considered the known external effects on the water of a well that are the slow tectonic re-adjustment processes, the meteorology and the gravity tides and we separated these effects applying band-pass filters to the Argon content raw trends. Then we identified the largest fluctuations in these trends applying the 3 σ criterion and we found three anomalies in a case and two anomalies in other case. Comparing the time occurrence of the anomalies at the two wells we found out that a coincidence exists only in the case of the premonitory anomalies we are studying. The simultaneous appearance of well definite anomalies in the residual trends of the same parameter at two different sites supports their meaning and the possibility that they are related to some large scale effect, as the occurrence of a strong earthquake. But, other earthquakes similar to the June 1996 event took place during the Argon content measurements time and no anomaly appeared in this content. In the past, some of the authors of this paper studied the Helium content data collected in three natural springs of the Caucasus during seven years. A very similar result, that is the simultaneous appearance of clear premonitory anomalies only on the occasion of a strong (M=7.0) but shallow (2–4km) earthquake, was obtained. The correspondence with the case of the Caucasus validates the interpretation of the Kamchatkian anomalies as precursors.

Starting from 1992 geochemical data are being collected with a mean sampling frequency of three days in the form of the pH value and of the most common ions and gases in the groundwater in one deep well located in Petropavlovsk, the capital city of Kamchatka (Russia). On 1 January 1996 a strong eruption started from the Karymsky volcano, that is located about 100km far from the well, in the north-northeastern direction. At the same time, a large earthquake (M=6.9) occurred in the Karymsky area. On 5 December 1997 a very large earthquake (M=7.7) occurred offshore, at a distance of 350km from the well and towards the same direction. The analysis of the geochemical data shows clear variations in the raw temporal trends on both cases. For the first event, a clear premonitory phase appeared; for the second one, some pre-seismic variations could be revealed but permanent modifications of the chemistry of the water subsequent to the earthquake are very clear. In both cases the feature of the geochemical variations is consistent with an afflux of new water in the aquifer connected with the well and with an escape of the Carbon dioxide gas from the ground in different directions. A schematic model able to justify such a phenomenology and the connections of the geochemical variations with the previous tectonic activities is proposed.

International audience

Il tema dell'intervento pone le proprie basi sui concetti legati alla "modernità" ed all'aggiornamento - anche concettuale - dei rapporti tra architettura e realtà nel corso della storia. Gli argomenti trattati spaziano da Vitruvio agli utopisti francesi del '900 passando attraverso la tradizone rinescimentale delle città ideali , Bruno Taut ed il Costruttivismo Russo.