Search

Wood is a viable alternative to traditional steel, cement, and concrete as a structural material for building applications, utilizing renewable resources and addressing the challenges of high energy consumption and environmental pollution in the construction industry. However, the vast supply of fast-growing poplar wood has bottlenecks in terms of low strength and dimensional stability, making it difficult to use as a structural material. An environmentally friendly acrylic resin system was designed and cured in this study to fill the poplar cell cavities, resulting in a new type of poplar laminated veneer lumber with improved mechanical strength and dimensional stability. The optimized acrylic resin system had a solid content of 25% and a curing agent content of 10% of the resin solid content. The cured filled poplar veneer gained 81.36% of its weight and had a density of 0.69 g/cm 3 . The static flexural strength and modulus of elasticity of the further prepared laminated veneer lumber were 123.12 MPa and 12,944.76 MPa, respectively, exceeding the highest flexural strength required for wood structural timber for construction (modulus of elasticity 12,500 MPa and static flexural strength 35 MPa). Its tensile strength, impact toughness, hardness, attrition value, water absorption, water absorption thickness expansion, and water absorption width expansion were 58.81%, 19.50%, 419.18%, 76.83%, 44.38%, 13.90%, and 37.60% higher than untreated laminated veneer lumber, demonstrating improved mechanical strength and dimensional stability, significantly. This method provides a novel approach to encouraging the use of low-value-added poplar wood in high-value-added structural building material applications.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Patients with malignant pleural mesothelioma (MPM) usually present with poor prognosis and short survival period, and there has been a lack of effective treatment options for a long time. Chemotherapy has limited improvement in the clinical outcome of advanced patients (the median survival is less than one year), and it is difficult to find suitable targets for targeted therapy. Recent in-depth research on immunotherapy has changed the treatment pattern of MPM. Especially, the dual immunotherapy regimen significantly improved the survival outcome of patients across subgroups and prolonged the survival time of MPM patients. Therefore, it has been approved for unresectable MPM as first-line treatment for patients. The exploration of other mono or combo immunotherapy regimens in the first and second-line settings of MPM is also underway. How to identify the best beneficial population of each regimen through predictive biomarkers is also a hot spot for researchers. This article will focus on the most up-to-date progress of MPM epidemiology, histological characteristics, pathogenesis, treatment patterns and the advances of immunotherapy in the disease.
.

As an organic sulfur pollutant generated in blast furnace gas, carbonyl sulfide (COS) has attracted more attention due to its negative effects on the environment and economy. The TiO 2 -Al 2 O 3 composite metal oxide (Ti 0.5 Al) with uniformly dispersed particles was prepared by the co-precipitation method. And on this basis, a series of Na/K-doped catalysts were prepared separately. The activity evaluation results showed that the introduction of Na/K significantly improved the low-temperature COS hydrolysis activity, which exhibited a COS conversion of 98% and H 2 S yield of 95% at 75 °C with 24,000 h -1 . And K showed a better promoting effect than Na. Brunauer-Emmett-Teller (BET) results revealed the increased mesopore proportion of Na/K-modified catalysts. X-ray diffraction (XRD) and scanning electron microscopy (SEM) showed that Na and K formed prismatic and nanorod-like structures, respectively. More weakly basic sites with enhanced intensity and decreased O ads /O lat content contributed to the excellent catalytic activity, as certified by the results of CO 2 temperature-programmed desorption (CO 2 -TPD) and X-ray photoelectron spectroscopy (XPS). It was also proposed that the decrease of weakly basic sites ultimately deactivated catalyst activity. In situ diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) showed that the introduction of Na/K enhanced the dissociation of H 2 O, and the generated abundant hydroxyl groups promoted the adsorption of COS and formed surface transition species, such as HSCO 2 - and HCO 3 - ., Competing Interests: The authors declare no competing financial interest., (© 2022 The Authors. Published by American Chemical Society.)

Al 17 clusters exhibit apparent changes in curvature, which resemble macroscopic metal tips. Here, we show, using the density functional theory method, how surface charges of Al 17 q (q = -2  to +3) ions affect the adsorption and dissociation behavior of HCl molecules. Geometries, adsorption energies, vibrational frequencies, Mulliken population analysis and transition states of (Al 17 HCl) q (q = -2  to +3) adsorption complexes were studied. The results revealed that HCl molecules tend to locate on tip sites of the Al 17 q (q = -2  to  +3) ions. Anionic adsorption complexes are prone to H affinity adsorption, whereas cationic adsorption complexes favor Cl-affinity adsorptions. These adsorption behaviors look quite like macroscopic tip effects. H-Cl bonds of the adsorption complexes weaken with an increase in either positive or negative charge. Dissociation barriers of the H-Cl bonds exhibit binding energies that are 2 orders of magnitude smaller than those of an isolated HCl molecule. Considering adsorption energies and dissociation barriers comprehensively, HCl molecules should dissociate spontaneously for all the models considered. Generally, the more negative charges the clusters carry, the more energy the reaction will release. Graphical abstract Dissociation barriers of the H-Cl bonds in Al 17 q (q = -2 - +3) cluster ions exhibit energy barriers ~2 orders of magnitude smaller than isolated HCI molecules.

Insect societies have evolved a series of disease defenses against pathogens, including social sanitary behavior and individual innate immunity. However, whether sanitary behavior can affect individual innate immunity remains unknown. Here, we exposed the termite Reticulitermes chinensis Snyder to the entomopathogenic fungus Metarhizium anisopliae (Metchnikoff) Sorokin(Ascomycota: Hypocreales), and then measured their allogrooming behavior, conidia load, infection mortality, antifungal activity and immune gene expressions . Our results showed that most of the fungal conidia were fast removed from the cuticles of the grouped termites by intensive allogrooming behavior, resulting in low mortality. The antifungal activity and immune gene expressions (termicin and transferrin) in grouped exposed termites were significantly lower than those in single exposed termite but not significantly different from those in unexposed treatments. These results suggest that allogrooming behavior can fast remove fungal conidia from termite cuticles and then decrease their physiological investment in individual innate immunity.

According to the application characteristics of the K-Rb- 21 Ne comagnetometer, a space-stable navigation mechanization is designed and the requirements of the comagnetometer prototype are presented. By analysing the error propagation rule of the space-stable Inertial Navigation System (INS), the three biases, the scale factor of the z -axis, and the misalignment of the x - and y -axis non-orthogonal with the z -axis, are confirmed to be the main error source. A numerical simulation of the mathematical model for each single error verified the theoretical analysis result of the system's error propagation rule. Thus, numerical simulation based on the semi-physical data result proves the feasibility of the navigation scheme proposed in this paper., Competing Interests: The authors declare no conflict of interest.

Synuclein gamma (SNCG), previously identified as a breast cancer-specific gene, is highly expressed in malignant cancer cells but not in normal epithelium. The molecular targets of SNCG during breast cancer progression have not been fully identified. Here we analyzed the effect of SNCG on stimulation of membrane-initiated estrogen signaling. While SNCG expression enhanced estrogen-induced activation of ERK1/2 and mammalian target of rapamycin, knockdown of endogenous SNCG decreased membrane-initiated estrogen signaling. SNCG functions as a molecular chaperone protein for estrogen receptor (ER)-alpha36, a membrane-based variant of ER-alpha. SNCG bound to ER-alpha36 in the presence and absence of functional molecular chaperone heat shock protein 90. Disruption of heat shock protein 90 with 17-AAG significantly reduced ER-alpha36 expression and membrane-initiated estrogen signaling. However, expression of SNCG prevented ER-alpha36 degradation and completely recovered 17-AAG-mediated down-regulation of estrogen signaling. The function of SNCG in ER-alpha36-mediated estrogen signaling is consistent with its ability to stimulate cell growth in response to estrogen. Expression of SNCG also renders tamoxifen resistance, which is consistent with the clinical observation on the association of ER-alpha36 expression and tamoxifen resistance. The present study indicates that ER-alpha36 is a new member of the ER-alpha family that mediates membrane-initiated estrogen signaling and that SNCG can replace the function of heat shock protein 90, chaperone ER-alpha36 activity, stimulate ligand-dependent cell growth, and render tamoxifen resistance.

Synucleins are emerging as central players in the formation of pathologically insoluble deposits characteristic of neurodegenerative diseases. gamma synuclein (SNCG), previously identified as a breast cancer-specific gene (BCSG1), is also highly associated with breast or ovarian cancer progression. However, the molecular targets of SNCG aberrant expression in breast cancer have not been identified. Here, we demonstrated a chaperone activity of SNCG in the heat-shock protein (Hsp)-based multiprotein chaperone complex for stimulation of estrogen receptor (ER)-alpha signaling. As an ER-alpha-associated chaperone, SNCG participated in Hsp-ER-alpha complex, enhanced the high-affinity ligand-binding capacity of ER-alpha, and stimulated ligand-dependent activation of ER-alpha. The SNCG-mediated stimulation of ER-alpha transcriptional activity is consistent with its stimulation of mammary tumorigenesis in response to estrogen. These data indicate that SNCG is a new chaperone protein in the Hsp-based multiprotein chaperone complex for stimulation of ligand-dependent ER-alpha signaling and thus stimulates hormone-responsive mammary tumorigenesis.

Synucleins are emerging as central player in the fundamental neural processes and in the formation of pathologically insoluble deposits characteristic of Alzheimer's disease and Parkinson's disease. However, gamma Synuclein (SNCG) is also highly associated with breast cancer and ovarian cancer progression. Whereas most studies of this group of proteins have been directed to the elucidation of their role in the formation of depositions in brain tissue, the normal cellular function of this highly conserved synuclein family remains largely unknown. A notable finding in this study is that SNCG, identified previously as a breast cancer-specific gene 1, strongly stimulated the ligand-dependent transcriptional activity of estrogen receptor-alpha (ER-alpha) in breast cancer cells. Augmentation of SNCG expression stimulated transcriptional activity of ER-alpha, whereas compromising endogenous SNCG expression suppressed ER-alpha signaling. The SNCG-stimulated ER-alpha signaling was demonstrated in three different cell systems including ER-alpha-positive and SNCG-negative MCF-7 cells, ER-alpha-positive and SNCG-positive T47D cells, and SNCG-negative and ER-alpha-negative MDA-MB-435 cells. The SNCG-mediated stimulation of ER-alpha transcriptional activity is consistent with its stimulation of the ligand-dependent cell growth. Whereas overexpression of SNCG stimulated the ligand-dependent cell proliferation, suppression of endogenous SNCG expression significantly inhibited cell growth in response to estrogen. The stimulatory effect of SNCG on ERalpha-regulated gene expression and cell growth can be effectively inhibited by antiestrogens. These data indicate that SNCG is required for efficient ER-alpha signaling and, thus, stimulated hormone-responsive mammary tumors.