Search

Full-thickness high-grade squamous intraepithelial lesions (HSIL) are precursors of invasive cervical squamous cell carcinoma (SCC). The World Health Organization and Lower Anogenital Squamous Terminology Standardization Project for human papilloma virus (HPV)-associated lesions divide full-thickness HSIL of the cervix into thin HSIL with thickness of 1 to 9 cell layers and the typical full-thickness HSIL of >10 cell layers. Although HPV oncogene transcripts and p16ink4a overexpression, as markers of transforming HPV infection, are detectable in thin HSIL, the biological significance of thin HSIL in cervical carcinogenesis remains poorly understood. To further characterize thin HSIL, we performed a comparative study of chromosomal copy number variations (CNV), an analysis of dysregulated genes present in the segments with CNV, and a generalized genetic complexity calculation for 31 thin HSIL, 31 thick HSIL, 24 microinvasive SCC (pT1a SCC), and 22 highly invasive SCC samples. Thin HSIL share various CNV and specific dysregulated gene pathways with thick HSIL and invasive SCC. Thin HSIL exhibited an average CNV of 11.6% compared with 14.1% for thick HSIL, 15.5% for pT1a SCC, and 26.6% for highly invasive SCC. The CNV included gains at 1q and 3q (40% and 43%, respectively), partial loss of 3p, and loss of chromosomes 11 (18%), 16 (50%), 20 (35%), and 22 (40%). Pathways affected solely in thin HSIL were those enhancing immune evasion and primarily involved the (interleukin) IL6, IL21, and IL23 genes. ILs are transiently upregulated in response to infection and play a crucial role in mounting antitumor T-cell activity. Deregulation reflects an attempt by the HPV to evade the initial immune response of the host. The primary pathways shared by thick HSIL and invasive SCC were interactions between lymphoid and nonlymphoid cells, NOTCH2 signaling, tight junction interactions (primarily of the claudin family), and FGR2 alternative splicing. Our results show that thin HSIL carry similar genetic changes as thick HSIL and SCC, indicating that thin HSIL are true precursor lesions that can progress to thick HSIL and SCC., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

Context.—: Acquisition of genetic aberrations during cervical carcinogenesis in individual patients is poorly documented., Objective.—: To provide a comparative analysis of high-grade squamous intraepithelial lesions (n = 7) and pT1a squamous cancers (n = 1) and their recurrences, subsequent widely invasive cancers, and metastases developed during 1-24 years., Design.—: Archival tissues of 8 patients were analyzed immunohistochemically for reserve-cell origin, human papillomavirus genotypes, mutations in 50 cancer genes, and chromosomal copy number variations., Results.—: Intraepithelial lesions arose either from cytokeratin 17- or 7-expressing reserve cells. All preinvasive and invasive tumors carried human papillomavirus high-risk genotypes and lacked somatic mutations. Chromosomal copy number variations were identified in all intraepithelial lesions and invasive cancers. Four of 8 high-grade intraepithelial lesions progressed to invasive cancer after incomplete treatment, and 4 of 8 invasive cancers arose de novo after in sano resection. Four of 8 cancers carried mutations with high mutational frequency (PIK3CA E545K [n = 2]; PIK3CA and SMAD1 [n = 1]; HRAS, RB1, and EGFR [n = 1]), as did their corresponding regional metastases. One nonmetastasized cancer had a subclonal PIK3CA mutation, and an initially nonmutated, low-stage cancer developed ovarian metastases with PIK3CA amplification. One patient had neither mutations nor metastases. The patient with treated PIK3CA E545K-mutated pT1a cancer developed a subsequent nonmutated intraepithelial lesion that progressed to invasive cancer with a subclonal PIK3CA-H1047R mutation. Cancer-related deaths in 4 of 8 (50%) patients occurred independent of mutational status or metastatic disease., Conclusions.—: Recurrences arose after persistent or de novo human papillomavirus infection of residual reserve cells or squamous metaplasia. Activating driver mutations were identified in invasive cancers only. High mutational load correlated with metastases, which in turn represented clonal disease., (© 2023 College of American Pathologists.)

Compared with vulva, precursor lesions of human papillomavirus (HPV)-independent invasive squamous cell carcinoma (SCC) of the penis are insufficiently characterized. We analyzed the histologic and immunohistochemical characteristics of 70 peritumoral precursor lesions and correlated them with the histology and mutational profile of the adjacent HPV-negative invasive penile SCC. Atypical basal keratinocyte proliferation with variously elongated epithelial rete with premature squamatiziation, but regular superficial cornification, termed differentiated penile intraepithelial neoplasia (d-PeIN), were identified adjacent to 42/70 (60%) SCC (36/42 keratinizing ( P <0.001); 3 papillary, and 1 each verrucous, clear cell, sarcomatoid SCC). d-PeIN were associated with chronic inflammatory dermatoses (32/42; P <0.001), p53 overexpression (26/42; P <0.001), and hotspot mutations in TP53 (32/42; P <0.001), CDKN2A (26/42; P <0.001) or both (21/42; P =0.003) in the adjacent SCC. Cytoplasmic p16 ink4a overexpression in 5/42 d-PeIN correlated with CDKN2A missense mutations in the adjacent SCC. In all, 21/70 (30%) cornified verrucous or glycogenated verruciform precursors with minimal atypia and wild-type p53 (18/21; P <0.001) occurred adjacent to verrucous or papillary SCC (17/21; P <0.001) and keratinizing (4/21) SCC, which harbored mutations in HRAS and/or PIK3CA (12/21; P <0.004). Undifferentiated p16 ink4a -negative full-thickness precursors were identified in 7/70 (10%) SCC. Four histologically different HPV-independent penile precursor lesions can be assigned to 2 major genetic/biological pathways with characteristic highly differentiated precursors requiring different clinical management decisions. These include d-PeIN in chronic inflammatory dermatoses, with p53 overexpression and TP53/CDKN2A mutations, and the p53 wild-type verrucous and verruciform precursors unassociated with dermatoses, but with mutations in oncogenes PIK3CA and HRAS ., Competing Interests: Conflicts of Interest and Source of Funding: The authors have disclosed that they have no significant relationships with, or financial interest in, any commercial companies pertaining to this article., (Copyright © 2023 The Author(s). Published by Wolters Kluwer Health, Inc.)

Penile squamous cell carcinomas (SCC) are rare cancers that arise after transforming human papillomavirus (HPV) infections or independent of HPV in the background of chronic dermatoses. Limited knowledge about genetic alterations driving penile carcinogenesis comes from studies of mainly small cohorts of typically mixed etiology. In this comparative genetic study of HPV-induced and HPV-independent invasive penile SCC of 156 patients from a single institution in a low-incidence country, hotspots of 50 cancer-relevant genes were analyzed with targeted next-generation sequencing. Seventy-nine of 156 SCC were classified as HPV induced, and 77 of 156 SCC arose independent of HPV. Only 28 (35%) of 79 HPV-induced penile SCC, but 69 (90%) of 77 HPV-independent SCC carried somatic gene mutations. PIK3CA, FGFR3, and FBXW7 mutations occurred in both groups in similar numbers as seen in other human cancers. In contrast, mutations in TP53 (44/77; 57%), CDKN2A (35/77; 45%), and HRAS (13/77; 17%) genes occurred with one exception of a HIV positive patient exclusively in HPV-independent SCC with a frequent co-occurrence of TP53 and CDKN2A mutations (28/77; 42%). Mutations in multiple genes occurred in 9 (11%) of 79 HPV-induced SCC versus 47 (62%) of 77 HPV-independent SCC (χ 2 ; P < .001). More than one mutation per gene (multi hits) was characteristic for HPV-independent SCC in 14 (18%) of 77 compared with only 3 (4%) of 79 HPV-induced SCC (χ 2 ; P < .001). The total number of mutations in HPV-induced penile SCC (47 mutations) was significantly lower than that in HPV-independent SCC (143 mutations; Welsh test; P < .001). The presence of somatic driver gene mutations did not correlate with the age of patients, histology, or tumor stage of the primary SCC in either etiologic group, suggesting that acquisition of driver gene mutations is an early event after invasion. This large cohort analysis identified characteristic differences in mutational landscapes for the 2 etiologies. While genetic mutations in tumor suppressor genes drive HPV-independent penile carcinogenesis, oncogenic action of E6 and E7 substitute for mutations in HPV-induced SCC. A subgroup of patients with advanced SCC may be candidates for targeted therapy and clinical trials, although the majority of advanced penile SCC remain a therapeutic challenge., (Copyright © 2023 The Authors. Published by Elsevier Inc. All rights reserved.)

Calreticulin (CALR) mutations present the main oncogenic drivers in JAK2 wildtype (WT) myeloproliferative neoplasms (MPN), including essential thrombocythemia and myelofibrosis, where mutant (MUT) CALR is increasingly recognized as a suitable mutation-specific drug target. However, our current understanding of its mechanism-of-action is derived from mouse models or immortalized cell lines, where cross-species differences, ectopic over-expression and lack of disease penetrance are hampering translational research. Here, we describe the first human gene-engineered model of CALR MUT MPN using a CRISPR/Cas9 and adeno-associated viral vector-mediated knock-in strategy in primary human hematopoietic stem and progenitor cells (HSPCs) to establish a reproducible and trackable phenotype in vitro and in xenografted mice. Our humanized model recapitulates many disease hallmarks: thrombopoietin-independent megakaryopoiesis, myeloid-lineage skewing, splenomegaly, bone marrow fibrosis, and expansion of megakaryocyte-primed CD41 + progenitors. Strikingly, introduction of CALR mutations enforced early reprogramming of human HSPCs and the induction of an endoplasmic reticulum stress response. The observed compensatory upregulation of chaperones revealed novel mutation-specific vulnerabilities with preferential sensitivity of CALR mutant cells to inhibition of the BiP chaperone and the proteasome. Overall, our humanized model improves purely murine models and provides a readily usable basis for testing of novel therapeutic strategies in a human setting., (© 2023. The Author(s).)

Background: Cancer-associated cachexia (CAC) is a wasting syndrome drastically reducing efficacy of chemotherapy and life expectancy of patients. CAC affects up to 80% of cancer patients, yet the mechanisms underlying the disease are not well understood and no approved disease-specific medication exists. As a multiorgan disorder, CAC can only be studied on an organismal level. To cover the diverse aetiologies of CAC, researchers rely on the availability of a multifaceted pool of cancer models with varying degrees of cachexia symptoms. So far, no tumour model syngeneic to C57BL/6 mice exists that allows direct comparison between cachexigenic- and non-cachexigenic tumours., Methods: MCA207 and CHX207 fibrosarcoma cells were intramuscularly implanted into male or female, 10-11-week-old C57BL/6J mice. Tumour tissues were subjected to magnetic resonance imaging, immunohistochemical-, and transcriptomic analysis. Mice were analysed for tumour growth, body weight and -composition, food- and water intake, locomotor activity, O 2 consumption, CO 2 production, circulating blood cells, metabolites, and tumourkines. Mice were sacrificed with same tumour weights in all groups. Adipose tissues were examined using high-resolution respirometry, lipolysis measurements in vitro and ex vivo, and radioactive tracer studies in vivo. Gene expression was determined in adipose- and muscle tissues by quantitative PCR and Western blotting analyses. Muscles and cultured myotubes were analysed histologically and by immunofluorescence microscopy for myofibre cross sectional area and myofibre diameter, respectively. Interleukin-6 (Il-6) was deleted from cancer cells using CRISPR/Cas9 mediated gene editing., Results: CHX207, but not MCA207-tumour-bearing mice exhibited major clinical features of CAC, including systemic inflammation, increased plasma IL-6 concentrations (190 pg/mL, P ≤ 0.0001), increased energy expenditure (+28%, P ≤ 0.01), adipose tissue loss (-47%, P ≤ 0.0001), skeletal muscle wasting (-18%, P ≤ 0.001), and body weight reduction (-13%, P ≤ 0.01) 13 days after cancer cell inoculation. Adipose tissue loss resulted from reduced lipid uptake and -synthesis combined with increased lipolysis but was not associated with elevated beta-adrenergic signalling or adipose tissue browning. Muscle atrophy was evident by reduced myofibre cross sectional area (-21.8%, P ≤ 0.001), increased catabolic- and reduced anabolic signalling. Deletion of IL-6 from CHX207 cancer cells completely protected CHX207 IL6KO -tumour-bearing mice from CAC., Conclusions: In this study, we present CHX207 fibrosarcoma cells as a novel tool to investigate the mediators and metabolic consequences of CAC in C57BL/6 mice in comparison to non-cachectic MCA207-tumour-bearing mice. IL-6 represents an essential trigger for CAC development in CHX207-tumour-bearing mice., (© 2022 The Authors. Journal of Cachexia, Sarcopenia and Muscle published by John Wiley & Sons Ltd on behalf of Society on Sarcopenia, Cachexia and Wasting Disorders.)

Fibromyalgia-syndrome (FMS) is a complex disease characterized by chronic widespread pain and additional symptoms including depression, cognitive dysfunction ("fibro-fog") and maldigestion. Our research team examined whether FMS-related pain parameters assessed by quantitative sensory testing (QST) and psychological disturbances are accompanied by alterations of the fecal microbiome. We recruited 25 patients with FMS and 26 age- and sex-matched healthy controls. Medical background, food habits, psychopathology and quality of life were assessed through questionnaires. Stool samples were analyzed by 16S rRNA gene amplification and sequencing. QST was performed according to the protocol of the German Network for Neuropathic Pain. QST showed that both lemniscal and spinothalamic afferent pathways are altered in FMS patients relative to healthy controls and that peripheral as well as central pain sensitization processes are manifest. Psychometric assessment revealed enhanced scores of depression, anxiety and stress. In contrast, neither the composition nor the alpha- and beta-diversity of the fecal microbiome was changed in FMS patients. FMS patients segregate from healthy controls in various parameters of QST and psychopathology, but not in terms of composition and diversity of the fecal microbiome. Despite consideration of several confounding factors, we conclude that the contribution of the gut microbiome to the pathophysiology of FMS is limited., Competing Interests: The authors have declared that no competing interests exist.

Secondary infections contribute significantly to covid-19 mortality but driving factors remain poorly understood. Autopsies of 20 covid-19 cases and 14 controls from the first pandemic wave complemented with microbial cultivation and RNA-seq from lung tissues enabled description of major organ pathologies and specification of secondary infections. Lethal covid-19 segregated into two main death causes with either dominant diffuse alveolar damage (DAD) or secondary pneumonias. The lung microbiome in covid-19 showed a reduced biodiversity and increased prototypical bacterial and fungal pathogens in cases of secondary pneumonias. RNA-seq distinctly mirrored death causes and stratified DAD cases into subgroups with differing cellular compositions identifying myeloid cells, macrophages and complement C1q as strong separating factors suggesting a pathophysiological link. Together with a prominent induction of inhibitory immune-checkpoints our study highlights profound alterations of the lung immunity in covid-19 wherein a reduced antimicrobial defense likely drives development of secondary infections on top of SARS-CoV-2 infection., Competing Interests: H.L. is founder of Alacris Theranostics GmbH and M.S. and L.O. are employees of Alacris Theranostics GmbH. K. Z. is CEO and founder of Zatloukal Innovations GmbH. All other authors declare no conflicts of interest., (© 2022 The Authors.)

Background: Treatment stratification and response assessment in pediatric sarcomas has relied on imaging studies and surgical/histopathological evidence of vital tumor cells. Such studies and evidence collection processes often involve radiation and/or general anesthesia in children. Cell-free circulating tumor DNA (ctDNA) detection in blood plasma is one available method of so-called liquid biopsies that has been shown to correlate qualitatively and quantitatively with the existence of vital tumor cells in the body. Our clinical observational study focused on the utility and feasibility of ctDNA detection in pediatric Ewing sarcoma (EWS) as a marker of minimal residual disease (MRD)., Patients and Methods: We performed whole genome sequencing (WGS) to identify the exact breakpoints in tumors known to carry the EWS-FLI1 fusion gene. Patient-specific fusion breakpoints were tracked in peripheral blood plasma using digital droplet PCR (ddPCR) before, during, and after therapy in six children and young adults with EWS. Presence and levels of fusion breakpoints were correlated with clinical disease courses., Results: We show that the detection of ctDNA in the peripheral blood of EWS patients (i) is feasible in the clinical routine and (ii) allows for the longitudinal real-time monitoring of MRD activity in children and young adults. Although changing ctDNA levels correlated well with clinical outcome within patients, between patients, a high variability was observed (inter-individually)., Conclusion: ctDNA detection by ddPCR is a highly sensitive, specific, feasible, and highly accurate method that can be applied in EWS for follow-up assessments as an additional surrogate parameter for clinical MRD monitoring and, potentially, also for treatment stratification in the near future., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Seidel, Kashofer, Moser, Thueringer, Liegl-Atzwanger, Leithner, Szkandera, Benesch, El-Heliebi and Heitzer.)

Objective: To evaluate the prevalence of somatic gene mutations in different stages of cervical carcinogenesis placing special emphasis on micro-invasive pT1a cervical squamous cell cancers (SCC)., Methods: Micro-dissected samples of 32 micro-invasive pT1a and 55 ≥ pT1b SCC were evaluated by next generation sequencing of 50 cancer genes (cancer hot spot panel)., Results: At primary diagnosis, 8/32 (25%) pT1a SCC, 10/28 (36%) pT1b SCC and 15/27 (56%) pT2/3 SCC carried somatic gene mutations. The most commonly affected gene was the PIK3CA gene in hot spot regions E545K and E453K in 5/8 (62%) pT1a SCC, 7/15 (70%) pT1b SCC and 10/15 (66%) pT2/3 SCC followed by FBXW7 (n = 4), KRAS and RB1 (n = 2 each). ERBB2, APC, ATM, MLP gene mutations occurred only once. Solitary activating oncogenic somatic mutations dominated over tumor suppressor mutation in 88% pT1a, 80% pT1b and 60% pT2/3 SCC. Concomitant mutations involved typically an activating oncogenic mutation and an inactivating tumor-suppressor gene mutation. All patients with pT1a SCC are alive without evidence of disease after surgical treatment, independent of mutational status or lympho-vascular space invasion., Conclusions: Activating oncogenic gene mutations, in particular in the PIK3CA gene, occur early in cervical carcinogenesis. Although driver gene mutations bestow tumor cells with a growth advantage, early detection and complete removal of all cancer cells - with or without somatic gene mutations - are essential for cure. In contrast to advanced inoperable SCC, where PIK3CA driver gene mutations carry an adverse prognosis, the mutational status in surgically treated micro-invasive SCC is prognostically irrelevant., Competing Interests: Declaration of Competing Interest All authors declare no conflict of interest., (Copyright © 2022. Published by Elsevier Inc.)

Recently, the World Health Organization (WHO) recognized human papilloma virus (HPV)-independent invasive cervical squamous cell carcinoma (SCC) without recognizing the existence of precursor lesions. This is a detailed characterization of 3 preinvasive lesions and 6 invasive SCC negative for HPV-DNA (32 genotypes), HPV-mRNA (14 genotypes) and genomic HPV sequencing. We evaluated histologic features, expression of p16ink4a, p53, CK7, and CK17, aberrations in 50 cancer genes and chromosomal copy number variations. HPV-negative preinvasive lesions were extensive basaloid or highly differentiated keratinizing intraepithelial proliferations of 3 to 20 cell layers thickness, partly with prominent cervical gland involvement. Overall, 2/3 intraepithelial lesions and the in situ component of 1/6 SCC showed p16ink4a block staining, while 1/6 in situ component revealed heterogenous p16ink4a staining. All invasive components of keratinizing SCC were p16ink4a-negative. Preinvasive and invasive SCC showed inconsistent CK7 and CK17 staining. Nuclear p53 overexpression was restricted to the TP53 gene mutated SCC. The highly vascularized peritumoral stroma showed a dense inflammatory infiltrate including plasma cells and intratumoral and peritumoral eosinophilic granulocytes. Inconsistent somatic gene mutations (PIK3CA, STK11, TP53, SMARC2B, and GNAS) occurred predominantly in nonhotspot locations at low mutational frequency in 3/6 SCC. Consistent aberrations included the pathogenic (angiogenic) germline polymorphism Q472H in the KDR gene (7/9 patients), and chromosome 3q gains (4/9 patients). In conclusion, HPV-negative intraepithelial cervical precancerous lesions exist, either as highly differentiated keratinized intraepithelial proliferations reminiscent of differentiated vulvar intraepithelial neoplasia, or undifferentiated basaloid intraepithelial lesions with occasional p16ink4a block staining resembling high-grade squamous intraepithelial lesion. Gains of chromosome 3q, angiogenic germline variants the inflammatory infiltrate may contribute to progression of HPV-negative cervical carcinogenesis., Competing Interests: Conflicts of Interest and Source of Funding: The authors have disclosed that they have no significant relationships with, or financial interest in, any commercial companies pertaining to this article., (Copyright © 2021 Wolters Kluwer Health, Inc. All rights reserved.)

Inflammatory myofibroblastic tumor (IMT) is a distinctive fibroblastic and myofibroblastic spindle cell neoplasm with an accompanying inflammatory cell infiltrate and frequent receptor tyrosine kinase activation at the molecular level. The tumor may recur and rarely metastasizes. IMT is rare in the head and neck region, and limited information is available about its clinicopathologic and molecular characteristics in these subsites. Therefore, we analyzed a cohort of head and neck IMTs through a multi-institutional approach. Fourteen cases were included in the provisional cohort, but 1 was excluded after molecular analysis prompted reclassification. Patients in the final cohort included 7 males and 6 females, with a mean age of 26.5 years. Tumors were located in the larynx (n=7), oral cavity (n=3), pharynx (n=2), and mastoid (n=1). Histologically, all tumors showed neoplastic spindle cells in storiform to fascicular patterns with associated chronic inflammation, but the morphologic spectrum was wide, as is characteristic of IMT in other sites. An underlying fusion gene event was identified in 92% (n=11/12) of cases and an additional case was ALK-positive by IHC but could not be evaluated molecularly. ALK represented the driver in all but 1 case. Rearrangement of ALK, fused with the TIMP3 gene (n=6) was most commonly detected, followed by 1 case each of the following fusion gene partnerships: TPM3-ALK, KIF5B-ALK, CARS-ALK, THBS1-ALK, and a novel alteration, SLC12A2-ROS1. The excluded case was reclassified as spindle cell rhabdomyosarcoma after detection of a FUS-TFCP2 rearrangement and retrospective immunohistochemical confirmation of rhabdomyoblastic differentiation, illustrating an important diagnostic pitfall. Two IMT patients received targeted therapy with crizotinib, with a demonstrated radiographic response. One tumor recurred but none metastasized. These results add to the growing body of evidence that kinase fusions can be identified in the majority of IMTs and that molecular analysis can lead to increased diagnostic accuracy and broadened therapeutic options for patients., Competing Interests: Conflicts of Interest and Source of Funding: NGS studies were supported by internal research funding from the D&R Institute of Pathology, Medical University of Graz, Austria. The authors have disclosed that they have no significant relationships with, or financial interest in, any commercial companies pertaining to this article., (Copyright © 2021 Wolters Kluwer Health, Inc. All rights reserved.)

Background: Targeted treatment modalities for non-small cell lung carcinoma (NSCLC) patients are expanding rapidly and demand a constant adaptation of molecular testing strategies. In this regard, broad reflex testing via next-generation sequencing (NGS) might have several advantages. However, real-world data regarding practical feasibility and clinical relevance are scarce, especially for RNA-based NGS., Methods: We performed a retrospective study comparing NGS use in two consecutive years (2019 and 2020). In 2019, reflex testing mainly consisted of DNA-based NGS for mutations and immunohistochemistry (IHC) for ALK , ROS1 , and NTRK fusion products. At the beginning of 2020, our approach has changed, with DNA- and RNA-based NGS panels now being simultaneously performed. This change in protocol allowed us to retrospectively evaluate if broad molecular reflex testing brings additional value to lung cancer patients., Results: Within the whole cohort (n=432), both DNA- and RNA-based NGS yielded almost always evaluable results. Only in 6 cases, the RNA content was too little for an appropriate analysis. After integrating RNA-based NGS in the reflex testing approach, the number of detected fusions increased significantly (2.6% vs . 8.2%; P=0.0021), but also more patients received targeted therapies. Furthermore, exceedingly rare alterations were more likely to be detected, including the so far undescribed EGFR - NUP160 fusion., Conclusions: Our study demonstrates that a comprehensive approach to reflex NGS testing is practically feasible and clinically relevant. Including RNA-based panels in the reflex testing approach results in more detected fusions and more patients receiving targeted therapies. Additionally, this broad molecular profiling strategy identifies patients with emerging biomarkers, underscoring its usefulness in the rapidly evolving landscape of targeted therapies., Competing Interests: Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://dx.doi.org/10.21037/tlcr-21-570). GA received payment for lectures and participated in advisory boards from Lilly, AstraZeneca, Roche, MSD, Merck, BMS, Pfizer, Novartis, Takeda, Janssen, Böhringer Ingelheim, Amgen, Sanofi; KK received grants from AstraZeneca; he also received payment for lectures and participated in advisory boards from AstraZeneca, Roche, MSD, BMS, Novartis and Thermo Fisher; RW received payment for presentations and participated in advisory boards for Takeda, Roche, Astra Zeneca, BMS, MSD, Janssen, Sanofi, Amgen and Boehringer Ingelheim; AT received grants from Sanofi, AstraZeneca, BMS, Roche and MSD; she also received payment for lectures and support for attending meetings and participated in advisory boards from Eli-Lilly, AstraZeneca, Roche, MSD, Merck, BMS, Pfizer, Novartis, Janssen and LB received grants from Takeda, AstraZeneca, BMS and Roche; he also received payment for lectures and participated in advisory boards form Invitae, Eli-Lilly, AstraZeneca, Roche, MSD, Merck, BMS, Pfizer, Novartis, Takeda, Janssen; support for attending meeting from Pfizer. He is Int. Secretary-Austrian Society of Pathology; PPS Membership and Awards Committee; Member of the Mesothelioma Committee of IASLC. The other authors have no conflicts of interest to declare., (2021 Translational Lung Cancer Research. All rights reserved.)

Background: The PX-104 is an oral non-steroidal agonist for the farnesoid X receptor (FXR), a key regulator of bile acid (BA), glucose and lipid homeostasis., Aims and Methods: This single center, proof of concept study evaluated the efficacy, safety and tolerability of PX-104 in non-diabetic NAFLD patients. 12 individuals were treated daily with 5 mg of PX-104 orally for 4 weeks. Serum liver enzymes, insulin sensitivity by clamp like index (CLIX) and hepatic fat by proton 1 H‑MRS, MRI-PDFF and CAP were assessed. Hepatic energy metabolism and Kupffer cell function were evaluated by phosphorus 31 P‑MRS and superparamagnetic iron oxide MRI (SPIO-MRI). Other readouts included serum lipids and markers of BA metabolism/signaling besides fecal microbiome and BA analysis., Results: A significant decrease in ALT (p = 0.027; 1‑tailed) and GGT (p = 0.019) was observed, without changes in serum alkaline phosphatase or serum lipids. Insulin sensitivity improved in 92% of patients (p = 0.02). However, hepatic steatosis measured by PDFF-MRI, 1 H‑MRS and CAP besides extended serum lipoprotein and BA profiles did not change. NADPH/γATP ratios at 31 P‑MRS significantly decreased (p = 0.022) possibly reflecting reduced hepatic inflammatory stress, but SPIO-MRI remained unchanged. Reduced preponderance of Coriobacteriaceae (p = 0.036) correlated with a relative reduction of total fecal BAs. There were no serious adverse events but short intervals of cardiac arrhythmia recorded in 2 patients led to termination of the study., Conclusion: The non-steroidal FXR agonist PX-104 improved insulin sensitivity and liver enzymes after 4 weeks of treatment in non-diabetic NAFLD patients. Changes in fecal BAs and gut microbiota deserve more extensive investigations.

Background: Molecular profiling (MP) represents an opportunity to match patients to a targeted therapy and when tumor tissue is unavailable, circulating tumor deoxyribonucleic acid (ctDNA) can be harnessed as a non-invasive analyte for this purpose. We evaluated the success of a targeted therapy selected by profiling of ctDNA and tissue in patients with advanced and refractory carcinoma., Patients and Methods: A blood draw as well as an optional tissue biopsy were obtained for MP. Whole-genome sequencing and a cancer hotspot panel were performed, and publicly available databases were used to match the molecular profile to targeted treatments. The primary endpoint was the progression-free survival (PFS) ratio (PFS on MP-guided therapy/PFS on the last evidence-based therapy), whereas the success of the targeted therapy was defined as a PFS ratio ⩾1.2. To test the impact of molecular profile-treatment matching strategies, we retrospectively analyzed selected cases via the CureMatch PreciGENE™ decision support algorithm., Results: Interim analysis of 24 patients yielded informative results from 20 patients (83%). A potential tumor-specific drug could be matched in 11 patients (46%) and eight (33%) received a matched treatment. Median PFS in the matched treatment group was 61.5 days [interquartile range (IQR) 49.8-71.0] compared with 81.5 days (IQR 68.5-117.8) for the last evidence-based treatment, resulting in a median PFS ratio of 0.7 (IQR 0.6-0.9). Hence, as no patient experienced a PFS ratio ⩾1.2, the study was terminated. Except for one case, the CureMatch analysis identified either a two-drug or three-drug combination option., Conclusions: Our study employed a histotype-agnostic approach to harness molecular profiling data from both ctDNA and metastatic tumor tissue. The outcome results indicate that more innovative approaches to study design and matching algorithms are necessary to achieve improved patient outcomes. EU Clinical Trials Registry (https://www.clinicaltrialsregister.eu): EudraCT: 2014-005341-44., Competing Interests: Conflict of interest statement: EH and MRS have an unrelated sponsored research agreement with Servier within CANCER-ID, a project funded by the Innovative Medicines Joint Undertaking (IMI JU), EH receives funding from Freenome, South San Francisco, CA, and PreAnalytiX, Hombrechtikon, Switzerland. EH received honoraria from Roche for advisory boards., (© The Author(s), 2021.)

Fusions involving NTRK1, NTRK2, and NTRK3 are oncogenic drivers occurring in a spectrum of mesenchymal neoplasms ranging from benign to highly malignant tumors. To gain further insights into the staining profile with the pan-TRK assay, we analyzed a large number of soft tissue sarcomas and correlated our findings with molecular testing. Additionally, we expand the spectrum of NTRK-fusion tumors by reporting a mesenchymal lesion in the lung as well as a mesenchymal skin lesion in the spectrum of benign fibrous histiocytoma with NTRK-fusion. We retrospectively reviewed soft tissue sarcomas diagnosed at the Diagnostic and Research Institute of Pathology, Medical University of Graz, between 1999 and 2019, and cases from the consultation files of one of the authors (BLA). In total, 494 cases were analyzed immunohistochemically with pan-TRK antibody (clone EPR17341, RTU, Roche/Ventana) and positive cases (defined as any cytoplasmic/nuclear staining in more than 1% of tumor cells) underwent next-generation sequencing (NGS). Immunohistochemical staining was observed in 16 (3.2%) cases. Eleven cases with focal weak and moderate cytoplasmic/membranous or focal moderate to strong nuclear staining did not harbor an NTRK-fusion (three synovial sarcomas, three leiomyosarcomas, two extraskeletal myxoid chondrosarcomas, and one each: dedifferentiated liposarcoma, pleomorphic liposarcoma, and myxofibrosarcoma). Four cases showed strong diffuse nuclear and/or cytoplasmatic staining, and one case showed diffuse, but weak cytoplasmic staining. All these cases demonstrated an NTRK-fusion (LMNA-NTRK1, IRF2BP2-NTRK1, TMB3-NTRK1, ETV6-NTRK3, RBPMS-NTRK3). Pan-TRK assay (clone EPR17341, RTU, Roche, Ventana) immunohistochemistry serves as a reliable diagnostic marker that can also be expressed in non-NTRK-rearranged mesenchymal neoplasms. It can be used as a surrogate marker for identification of NTRK fusion, nevertheless, an RNA-based NGS for detection of the specific fusion should be performed to confirm the rearrangement, if patients are undergoing targeted therapy. Additionally, we identified NTRK-fusion-positive, primary mesenchymal tumors of the lung and the skin.

RAS mutation is the most frequent oncogenic alteration in human cancers. KRAS is the most frequently mutated followed by NRAS. The emblematic KRAS mutant cancers are pancreatic, colorectal, lung adenocarcinomas and urogenital cancers. KRAS mutation frequencies are relatively stable worldwide in various cancer types with the one exception of lung adenocarcinoma. The frequencies of KRAS variant alleles appears cancer type specific, reflecting the various carcinogenic processes. In addition to point mutation KRAS, allelic imbalances are also frequent in human cancers leading to the predominance of a mutant allele. KRAS mutant cancers are characterized by typical, cancer-type-specific co-occurring mutations and distinct gene expression signatures. The heterogeneity of KRAS mutant primary cancers is significant, affecting the variant allele frequency, which could lead to unpredictable branching development in metastases. Selection of minute mutant subclones in the primary tumors or metastases during target therapies can also occur frequently in lung or colorectal cancers leading to acquired resistance. Ultrahigh sensitivity techniques are now routinely available for diagnostic purposes, but the proper determination of mutant allele frequency of KRAS in the primary or metastatic tissues may have larger clinical significance.

We addressed a significant unknown feature of circulating tumor DNA (ctDNA), i.e., how ctDNA levels change during chemotherapy, by serially monitoring ctDNA in patients with colorectal cancer during the 48-h application of FOLFOX. Surprisingly, we did not observe a spike in ctDNA as a sign of a responsive tumor, but instead ctDNA levels initially decreased and remained low in patients with stable disease or partial response. Our observations reveal further insights into cell destruction during chemotherapy with important implications for the management of patients.

Congenital pulmonary airway malformation (CPAM) occurs most commonly in infants. It is divided into 5 types. The most common types 1 and 2 are cystic, type 0 presents as bronchial buds without alveolar tissue, most likely corresponding to alveolar dysgenesis, while type 3 is composed of branching bronchioles and appears as a solid lesion. A defect in the epithelial-mesenchymal crosstalk might be the underlying mechanism for all. Type 4 is a peripheral cystic lesion with a thin cyst wall covered by pneumocytes. CPAM 4 has been mixed up with pleuropulmonary blastoma (PPB) type I and some authors question its existence. We investigated five cases of CPAM type 4 for the presence or absence of rhabdomyoblasts, and for markers associated with CPAM development. In addition, all cases were evaluated for mutations within the Dicer gene and for mutations of the RAS family of oncogenes. All five cases showed smooth muscle actin and desmin-positive cells; however, only one case showed a few cells positive for MyoD. The same case showed a mutation of Dicer 1. All cases were negative for mutations of the RAS family of genes. Fibroblast growth factor 10 was similarly expressed in all cases, and thus cannot be used to differentiate CPAM4 from PPB-I. Low expression of the proliferation marker Ki67 was seen in our CPAM 4 cases and the probable PPB-I case. YingYang-1 protein seems to play an active role in the development of PPB-I. CPAM 4 can be separated from PPB-I based on the presence of rhabdomyoblasts and mutations in Dicer 1 gene. These cells might not be numerous; therefore, all available tissue has to be evaluated. As CPAM 4 morphologically looks very similar to PPB-I, it might be speculated, that there exists a potential for progression from CPAM 4 to PPB-I, by acquiring somatic mutations in Dicer 1.

Purpose: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure., Methods: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s&#95;515&#95;S3&#95;fwd: GATTGCCAGCAGCCGCGGTAA and 16s&#95;806&#95;S2&#95;rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts., Results: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery., Conclusions: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

Giant cell tumor of bone (GCT) is a benign locally aggressive neoplasm composed of mononuclear cells admixed with innumerable osteoclast-type giant cells. H3F3A gene mutations producing mutant histone protein product H3.3 have been identified in 96% of GCT; mutant H3.3 is reliably demonstrated by immunohistochemistry. GCT may contain woven bone and rarely, neoplastic cartilage nodules which causes diagnostic challenges with aggressive neoplasms such as osteosarcoma. We describe the features of GCT with cartilage matrix and report the next-generation sequencing findings in a subset of tumors. Seventeen cases of GCT with cartilage matrix form the cohort: 7 males and 10 females, 13 to 55 (mean: 25) years old. Tumors involved the fibula (6), femur (6), and patella, tibia, humerus, S1, and scapula (1 case each). Tumors were radiolucent, circumscribed, lytic, and expansile. All contained classic GCT, foci of cartilage matrix, and trabeculae of woven bone. Immunohistochemistry showed diffuse staining for H3.3 in 9/9 cases and 1 case was positive for S100 and SOX9 in the cartilage areas. Next-generation sequencing showed a mutation in the H3F3A gene in 6/6 cases. On follow-up, 2 patients who underwent resection showed no disease after 12, and 7 months, respectively. Three patients had recurrences 10, 12, and 27 months after curettage; there were no metastases. GCT with cartilage matrix is uncommon. The cartilage matrix is associated with woven bone suggesting the neoplastic cells may differentiate into chondrocyte-like and osteoblast-like cells. Recognition of this neoplasm is important to prevent misdiagnosis and overtreatment of affected patients.

Congenital pulmonary airway malformation (CPAM) is a developmental disorder. Types 1-2-3 are the more common ones. Atypical goblet cell hyperplasia (AGCH) in CPAM might be a precursor lesion for pulmonary adenocarcinomas. In nine out of 33 CPAM cases, types 1-3 showed foci of goblet cell proliferations. As these cells completely replace normal epithelium, we prefer to name these proliferations AGCH. In 5 cases, adenocarcinomas were seen (AC). All cases were analyzed for proteins possibly being associated with CPAM development: fibroblast growth factor 10 (FGF10) and receptor 2 (FGFR2), forkhead box A1 (FOXA1) and A2 (FOXA2), MUC protein 5AC (MUC5AC), human epidermal growth factor receptor 2 (erbB2, HER2/neu), hepatocyte nuclear factor 4α (HNF4α), SOX2, and Ying Yang protein 1 (YY1). By next generation sequencing, AGCH and adenocarcinomas were evaluated for driver mutations. Expression for FGF10, FGFR2, FOXA1, and FOXA2 was seen in CPAM epithelium and stroma, but not differently in AGCH and AC. SOX2 was positive in CPAM epithelium and AGCH, however weakly in AC. YY1 and MUC5AC showed more intense staining in AGCH and AC than in CPAM epithelium. HER2 was intensely expressed in AC and less intensely in AGCH, but not in CPAM epithelium. KRAS mutation in exon 2 was detected in all AGCH and AC, but was absent in CPAM epithelia. AGCH can arise in CPAM types 1-3. Oncogenic KRAS mutation seems to be the oncogenic driver already in AGCH, proving its role as a precursor lesion for adenocarcinoma. It might upregulate HER2 at the protein level. YY1 seems to be involved in carcinogenesis.

Round cell sarcomas are a heterogeneous group of mesenchymal neoplasms with overlapping morphology and immunohistochemical profile. Ewing sarcoma is the most well-known tumour in this group characterised by EWSR1/FUS rearrangements with members of the ETS family of transcription factors. Undifferentiated round cell sarcomas lacking these rearrangements, known as 'Ewing-like' sarcomas, usually show atypical clinical presentation and focal CD99 positivity. This group of tumours can be subdivided into: capicua transcriptional repressor (CIC)-rearranged sarcomas, Bcl6 corepressor (BCOR)-rearranged sarcomas, sarcomas with EWSR1 fusion to non-ETS family members and unclassified round cell sarcomas. We describe seven new cases of CIC-DUX4 rearranged sarcomas with their clinicopathological features, two of which presented in unusual locations (skin and lymph node). Patient age ranged between 23 and 54 years, three of whom were female. In five cases, aggressive behaviour was observed with rapid disease progression and lethal outcome within 15 months. One patient achieved a complete response after chemotherapy. The last patient whose tumour was located purely in the dermis demonstrated no residual tumour in the re-resection specimen, was not given any further treatment and showed no sign of disease after 24 months. Immunohistochemically, tumour cells in all cases showed focal membranous CD99 positivity, while WT1 N-/C-terminus were positive in all 5/5 cases (nuclear and/or cytoplasmic). NGS analysis revealed a CIC-DUX4 fusion in all cases. This study expands the spectrum of anatomical locations of CIC-DUX4 rearranged sarcomas, highlighting the inclusion of this rare entity in the differential diagnosis of undifferentiated tumours in various anatomical locations outside of soft tissues., (Copyright © 2019 Royal College of Pathologists of Australasia. Published by Elsevier B.V. All rights reserved.)

RAS -signaling mutations induce the myelomonocytic differentiation and proliferation of hematopoietic stem and progenitor cells. Moreover, they are important players in the development of myeloid neoplasias. RAF kinase inhibitor protein (RKIP) is a negative regulator of RAS -signaling. As RKIP loss has recently been described in RAS -mutated myelomonocytic acute myeloid leukemia, we now aimed to analyze its role in myelomonocytic differentiation and RAS -driven leukemogenesis. Therefore, we initially analyzed RKIP expression during human and murine hematopoietic differentiation and observed that it is high in hematopoietic stem and progenitor cells and lymphoid cells but decreases in cells belonging to the myeloid lineage. By employing short hairpin RNA knockdown experiments in CD34 + umbilical cord blood cells and the undifferentiated acute myeloid leukemia cell line HL-60, we show that RKIP loss is indeed functionally involved in myelomonocytic lineage commitment and drives the myelomonocytic differentiation of hematopoietic stem and progenitor cells. These results could be confirmed in vivo , where Rkip deletion induced a myelomonocytic differentiation bias in mice by amplifying the effects of granulocyte macrophage-colony-stimulating factor. We further show that RKIP is of relevance for RAS -driven myelomonocytic leukemogenesis by demonstrating that Rkip deletion aggravates the development of a myeloproliferative disease in Nras G12D -mutated mice. Mechanistically, we demonstrate that RKIP loss increases the activity of the RAS -MAPK/ERK signaling module. Finally, we prove the clinical relevance of these findings by showing that RKIP loss is a frequent event in chronic myelomonocytic leukemia, and that it co-occurs with RAS -signaling mutations. Taken together, these data establish RKIP as novel player in RAS -driven myeloid leukemogenesis., (Copyright© 2020 Ferrata Storti Foundation.)

The impact of TP53 gene mutations in recurrent HPV-negative vulvar squamous cell carcinomas is unclear. TP53 gene mutations were analyzed in archival tissues of 24 primary squamous cell carcinoma and local vulvar recurrences arising in chronic inflammatory dermatoses by analyzing the full coding sequence of the TP53 gene and correlated with disease-free survival. After resection of the primary squamous cell carcinoma with clear margins 19/24 patients had one and 5/24 had multiple recurrences. The first recurrence occurred after median of 46 months (range 12-180 months). In all, 17/24 (71%) primary squamous cell carcinomas had TP53 gene mutations and recurred after median disease-free intervals of 33 months (range 12-180). 14/17 (88%) recurrent squamous cell carcinomas carried again TP53 gene mutations, five with identical and nine with different, more complex TP53 gene mutations. 7/24 (29%) patients with a p53 wild-type primary SCC had the first recurrence after median 65 months (range 14-144) featuring p53 wild-type in 3/7 (43%) and TP53 gene mutations in 4/7 (57%) recurrent squamous cell carcinomas. Disease-free intervals of > 5 years (60-180 months) were observed in 10/24 patients total (42%; equally divided among p53 wild-type (5/7; 71%) and TP53 gene mutated (5/17; 29%) squamous cell carcinomas). In summary, squamous cell carcinomas recurred in the residual vulvar dermatosis independent of TP53 gene mutational status of the primary squamous cell carcinoma. The majority of TP53 gene mutated cancers recurred with different TP53 gene mutations, some of them more complex, and patients with p53 wild type developed TP53 gene mutations in the recurrent squamous cell carcinomas, possibly indicating increased genetic instability in longstanding chronic inflammatory dermatoses. A change of TP53 gene mutational status after > 5 years suggests de novo oncogenic events/carcinogenesis. Longer disease-free intervals in patients with p53 wild-type primary squamous cell carcinoma suggest that TP53 gene mutational status may serve as a prognostic marker for disease-free intervals.

Introduction: Recent research has shown changes of the intestinal flora in anorexia nervosa (AN) patients. Alpha diversity (AD) represents the number of different bacterial species in the gut. Reduced AD and a leaky gut (zonulin) lead to inflammation and changes in nutrient absorption., Methods: AD was calculated from stool samples of 18 AN patients and 20 normal weight controls (NC) after 16S ribosomal RNA sequencing. Furthermore, Zonulin as an indicator of gut barrier function and inflammation parameters were investigated., Results: AN patients had significantly lower AD compared to NC (number of observed species p=0.042, Chao1 Diversity Index p=0.043). Zonulin was not significantly altered in AN patients compared to NC. There were no significant correlations of serum parameters and AD., Discussion: Regardless of gut permeability, AN patients showed significantly decreased AD compared to NC. Decreased AD can have an additional negative impact on calorie intake in AN. These results contribute to a better understanding of the illness and the development of new therapeutic options., Competing Interests: Die Autoren geben an, dass kein Interessenkonflikt besteht., (© Georg Thieme Verlag KG Stuttgart · New York.)

Treatment options in advanced melanoma have been subject to a major change over the last years. The discovery of the oncogenic point mutation BRAFV600E and subsequently developed BRAF inhibitors had a major impact on patient's survival. Further important mutations have been found in the NRAS gene, although not yet druggable, and others involve c-kit in acral and mucosal melanoma. Imatinib was shown to achieve high response rates in c-kit mutated melanoma. Despite good response rates in these targeted therapies and introduction of immunotherapy, there are still patients left, who develop resistance upon therapy or patients without the option of targeted therapy. Therefore it is necessary to identify further therapeutic options for this subset of patients. Several new mutations have been described so far that might be suitable for targeted therapy or useful as clinical biomarkers. Alterations in various receptor tyrosine kinases lead to constitutively activated downstream signaling and might be responsible for non-response to common therapies. In contrast, tyrosine kinase inhibitors such as sunitinib or nilotinib could be suitable for patients harboring those alterations. Additionally, chromosomal rearrangements have been described in many different cancer types, resulting in oncogenic fusion proteins that involve BRAF, ROS1, NTRK, ALK and others. These are an emerging therapeutic field, especially in spitzoid melanomas. Further mutations have been detected in the neurofibromin 1 and RAC1 gene, although the clinical relevance is still not fully revealed. Within this review we will summarize the current evidence and focus on possible further upcoming targets and therapeutic opportunities in BRAFwt/NRASwt/KITwt melanoma.

Despite achieving complete remission after intensive therapy, most patients with cytogenetically normal (CN) AML relapse due to the persistence of submicroscopic residual disease. In this pilot study, we hypothesized that detection of leukemia-specific mutations following consolidation treatment using a targeted parallel sequencing approach predicts relapse. We included 34 AML patients of whom diagnostic material and remission bone marrow slides after at least one cycle of consolidation were available. Isolated DNA was screened for mutations in 19 genes using an Ion Torrent sequencing platform. Furthermore, the variant allelic frequency of distinct mutations was validated by digital PCR and sequencing using a barcoding approach. Twenty-seven out of 34 patients could be analyzed for mutation clearance. We identified 68 somatic mutations at diagnosis (median, 3 mutations per patient; range 1-5) and 22 of these were still detected in 16 patients after consolidation therapy with a reliable sensitivity of 0.5% (median, 1 mutation; range 0-3). The most frequent noncleared mutations were found in DNMT3A. However, as persistence of these mutations has recently been shown to be without any impact on relapse risk, we performed survival and relapse risk analysis excluding DNMT3A mutations. Importantly, persistence of non-DNMT3A mutations was associated with a higher risk of AML relapse (7/8 pts versus 6/19 pts; P = .013) and with a shorter relapse-free survival (333 days vs. not reached; log-rank P = .0219). Detection of residual disease by routine targeted parallel sequencing proved feasible and effective as persistence of somatic mutations other than DNMT3A were prognostic for relapse in CN AML., (© 2017 Wiley Periodicals, Inc.)

Myxofibrosarcomas are morphologically heterogeneous soft tissue sarcomas lacking a specific immunohistochemical expression profile and recurrent genetic changes. The study was designed to gain further insights into the molecular landscape of myxofibrosarcomas by targeted re-sequencing of known cancer driver hotspot mutations and the analysis of genomewide somatic copy number alterations. A well-defined group of myxofibrosarcomas, including myxofibrosarcomas G1 (n=6), myxofibrosarcomas G3 (n=7), myxofibrosarcomas with morphologically heterogeneous and independently selectable G1 and G3 areas within a tumor (n=8), and myxofibrosarcomas G3 with subsequent tumor recurrence (n=1) or metastatic disease (n=3) were evaluated. Mutational analysis demonstrated mutations in TP53, PTEN, FGFR3, CDKN2A, and RB1. TP53 mutations were seen in 11 (44%) of patients and detected in myxofibrosarcomas G1, G3, with heterogeneous morphology and G3 with subsequent metastases in 1 patient (16%), 3 patients (42%), 2 patients (62.5%), and 3 patients (75%), respectively. Additional mutations were detected in 2 patients, intratumoral mutational heterogeneity in 1 patient. We observed a variety of copy number alterations typical for myxofibrosarcomas, with higher numbers in G3 compared with G1 myxofibrosarcomas. Cluster analysis revealed distinctive features especially in metastatic and recurrent disease. Focal alterations affected CDKN2A, CCND1, CCNE1, EGFR, EPHA3, EPHB1, FGFR1, JUN, NF1, RB1, RET, TP53, and additional novel amplifications in CCNE1, KIT, EGFR, RET, BRAF, NTRK2 were seen in G3 compared with the G1 tumor areas. The total number of focal events in G1 versus G3 tumors differed significantly (P=0.0014). TRIO and RICTOR co-amplification was seen in 8 (44%) G3 and 1 (10%) G1 myxofibrosarcomas and RICTOR amplification alone in 4 (40%) G1 myxofibrosarcomas. TRIO amplification was significantly (P=0.0218) higher in G3 myxofibrosarcomas indicating a late genetic event. These findings support the use of expanded molecular profiling in myxofibrosarcomas to detect drug-able targets to allow patients to participate in basket trials.

Objective: This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years., Methods: DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry., Results: 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas., Conclusion: 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers., (Copyright © 2017. Published by Elsevier Inc.)

Tumor heterogeneity is considered a major cause for therapy resistance in colorectal cancer. Sub-populations of cells with different genetic alterations may exist in spatially distinct areas. Upon therapy, resistant sub-clones may enrich and ultimately lead to disease progression. Although ample data are available on tumors which are heterogeneous on a morphological level, only little is known about morphologically homogeneous tumors. We aimed to investigate if morphologically homogeneous colorectal cancer can harbor a heterogeneous genetic landscape. We chose to microdissect six morphologically homogeneous colorectal carcinomas into several areas and performed next-generation sequencing (NGS) to identify tumors with genetic heterogeneity. We then applied an mRNA-based in situ mutation detection technology based on padlock probes to localize and visualize mutations directly in the tumor tissue. In three out of six tumors, NGS revealed a high rate of variability of mutations between different tumor areas. We selected two cases for in situ mutation detection to visualize genetic heterogeneity. In situ mutation detection confirmed differences in mutant allele frequencies between different tumor areas of morphological homogeneous tumors. We conclude that genetic heterogeneity in morphologically homogeneous colorectal cancer is an observable, but underreported event. Our results illustrate the power of in situ mutation analysis to visualize genetic heterogeneity directly in tumor tissue.

The majority of penile squamous cell carcinomas is caused by transforming human papilloma virus (HPV) infection. The etiology of HPV-negative cancers is unclear, but TP53 mutations have been implicated. Archival tissues of 108 invasive squamous cell carcinoma from a single pathology institution in a low-incidence area were analyzed for HPV-DNA and p16 ink4a overexpression and for TP53 mutations by ion torrent next-generation sequencing. Library preparation failed in 32/108 squamous cell carcinomas. Institutional review board approval was obtained. Thirty of 76 squamous cell carcinomas (43%; average 63 years) were HPV-negative with 8/33 squamous cell carcinomas being TP53 wild-type (24%; average 63 years). Twenty-five of 33 squamous cell carcinomas (76%; average 65 years) showed 32 different somatic TP53 mutations (23 missense mutations in exons 5-8, 6 nonsense, 1 frameshift and 2 splice-site mutations). Several hotspot mutations were detected multiple times (R175H, R248, R282, and R273). Eighteen of 19 squamous cell carcinomas with TP53 expression in immunohistochemistry had TP53 mutations. Fifty percent of TP53-negative squamous cell carcinomas showed mostly truncating loss-of-function TP53 mutations. Patients without mutations had longer survival (5 years: 86% vs 61%; 10 years: 60% vs 22%), but valid clinically relevant conclusions cannot be drawn due to different tumor stages and heterogeneous treatment of the cases presented in this study. Somatic TP53 mutations are a common feature in HPV-negative penile squamous cell carcinomas and offer an explanation for HPV-independent penile carcinogenesis. About half of HPV-negative penile cancers are driven by oncogenic activation of TP53, while a quarter is induced by loss of TP53 tumor suppressor function. Detection of TP53 mutations should be carried out by sequencing, as immunohistochemical TP53 staining could not identify all squamous cell carcinomas with TP53 mutations.

Desmoplastic malignant melanoma is a distinct melanoma entity histologically subtyped into mixed and pure forms due to significantly reduced lymph node metastases in the pure form. Recent reports investigating common actionable driver mutations have demonstrated a lack of BRAF, NRAS, and KIT mutation in pure desmoplastic melanoma. In search for alternative driver mutations next generation amplicon sequencing for hotspot mutations in 50 genes cardinal to tumorigenesis was performed and in addition the RET G691S polymorphism was investigated. Data from 21 desmoplastic melanomas (12 pure and 9 mixed) were retrieved. Pure desmoplastic melanomas were either devoid of mutations (50%) or displayed mutations in tumor suppressor genes (TP53, CDKN2A, and SMAD4) singularly or in combination with the exception of a PIK3CA double-mutation lacking established biological relevance. Mixed desmoplastic melanomas on the contrary were frequently mutated (89%), and 67% exhibited activating mutations similar to common-type cutaneous malignant melanomas (BRAF, NRAS, FGFR2, and ERBB2). Separate analysis of morphologically heterogeneous tumor areas in four mixed desmoplastic malignant melanomas displayed no difference in mutation status and RET G691 status. GNAQ and GNA11, two oncogenes in BRAF and NRAS wild-type uveal melanomas, were not mutated in our cohort. The RET G691S polymorphism was found in 25% of pure and 38% of mixed desmoplastic melanomas. Apart from RET G691S our findings demonstrate absence of activating driver mutations in pure desmoplastic melanoma beyond previously investigated oncogenes (BRAF, NRAS, and KIT). The findings underline the therapeutic dichotomy of mixed versus pure desmoplastic melanoma with regard to activating mutations primarily of the mitogen-activated protein kinase pathway.

Endothelial progenitor cells are critically involved in essential biologic processes, such as vascular homeostasis, regeneration, and tumor angiogenesis. Endothelial colony-forming cells (ECFCs) are endothelial progenitor cells with robust proliferative potential. Their profound vessel-forming capacity makes them a promising tool for innovative experimental, diagnostic, and therapeutic strategies. Efficient and safe methods for their isolation and expansion are presently lacking. Based on the previously established efficacy of animal serum-free large-scale clinical-grade propagation of mesenchymal stromal cells, we hypothesized that endothelial lineage cells may also be propagated efficiently following a comparable strategy. Here we demonstrate that human ECFCs can be recovered directly from unmanipulated whole blood. A novel large-scale animal protein-free humanized expansion strategy preserves the progenitor hierarchy with sustained proliferation potential of more than 30 population doublings. By applying large-scale propagated ECFCs in various test systems, we observed vascular networks in vitro and perfused vessels in vivo. After large-scale expansion and cryopreservation phenotype, function, proliferation, and genomic stability were maintained. For the first time, proliferative, functional, and storable ECFCs propagated under humanized conditions can be explored in terms of their therapeutic applicability and risk profile.