Search

The potential Z-forming sequence (dT-dG)n . (dC-dA)n is an abundant, interspersed repeat element that is ubiquitous in eucaryotic nuclear genomes. We report that in contrast to eucaryotic nuclear DNA, the genomes of eubacteria, archaebacteria, and mitochondria lack this sequence, since even a single tract of greater than or equal to 14 base pairs in length is not detectable through either hybridization or sequence analysis. Interestingly, the phylogenetic distribution of the (dT-dG)n . (dC-dA)n repeat exhibits a striking parallel to that of (dT-dC)n . (dG-dA)n, but not to other homocopolymeric sequences such as (dC-dG)n . (dC-dG)n or (dT-dA)n . (dT-dA)n.

A comparison has been made between the Sp88 gene regions of the DNAs of the sea urchins Strongylocentrotus purpuratus (Sp.) and Strongylocentrotus drobachiensis (Sd.). Examination of the 3′ terminal part of the transcribed region revealed a short repetitive sequence present in Sd. but absent from Sp. A 12-nucleotide sequence present once in Sp. is almost perfectly duplicated at both ends of the repeat in Sd., suggesting that a mobile repeat was inserted in the Sd. genome. Other members of this family of repeated sequences occur in many interspersed locations in the genomes of both species. Except for the insertion duplication, the inserted sequence lacks direct or reverse repeats.

The major families of repeated DNA sequences in the genome of tomato (Lycopersicon esculentum) were isolated from a sheared DNA library. One thousand clones, representing one million base pairs, or 0.15% of the genome, were surveyed for repeated DNA sequences by hybridization to total nuclear DNA. Four major repeat classes were identified and characterized with respect to copy number, chromosomal localization by in situ hybridization, and evolution in the family Solanaceae. The most highly repeated sequence, with approximately 77000 copies, consists of a 162 bp tandemly repeated satellite DNA. This repeat is clustered at or near the telomeres of most chromosomes and also at the centromeres and interstitial sites of a few chromosomes. Another family of tandemly repeated sequences consists of the genes coding for the 45 S ribosomal RNA. The 9.1 kb repeating unit in L. esculentum was estimated to be present in approximately 2300 copies. The single locus, previously mapped using restriction fragment length polymorphisms, was shown by in situ hybridization as a very intense signal at the end of chromosome 2. The third family of repeated sequences was interspersed throughout nearly all chromosomes with an average of 133 kb between elements. The total copy number in the genome is approximately 4200. The fourth class consists of another interspersed repeat showing clustering at or near the centromeres in several chromosomes. This repeat had a copy number of approximately 2100. Sequences homologous to the 45 S ribosomal DNA showed cross-hybridization to DNA from all solanaceous species examined including potato, Datura, Petunia, tobacco and pepper. In contrast, with the exception of one class of interspersed repeats which is present in potato, all other repetitive sequences appear to be limited to the crossing-range of tomato. These results, along with those from a companion paper (Zamir and Tanksley 1988), indicate that tomato possesses few highly repetitive DNA sequences and those that do exist are evolving at a rate higher than most other genomic sequences.

The molecular structure of the lampbrush loopforming fertility gene nooses from the short arm of the Y chromosome of Drosophila hydei is described on the basis of cloned DNA sequences which are characteristic for the sequence organization in the lampbrush loop. Y chromosomal lampbrush loops are organized into tandem repeat clusters of loop-specific repetitive DNA sequences and in interspersed repetitive DNA sequences with homologies elsewhere in the genome. In this paper, the basic properties of a repeat unit of the tandemly repeated sequence family ay1 are described. Moreover, it is shown that a loop contains several different domains carrying repeat clusters of the same repeated DNA family but with divergent sequence character. One of these clusters is characterized by an internal duplication of the basic repeat unit. We propose that the tandem repeat DNA family ay1 forms a “frame” of the lampbrush loop which is required for structural and functional reasons.

A clone of 7.1kb corresponding to the mouse L1 interspersed repeat family was selected for homology to a human interspersed repeat. This clone fairly represents mouse genomic members. Mapping of the clone revealed one common element at both the 5' and 3' ends in a head to tail arrangement, suggesting that at least some long L1 family members are tandemly arranged; genomic studies confirmed the unexpected tandem arrangement of a minor proportion of L1 members. A short SmaI tandem repeat appears to define the 5' end of most L1 family members. SmaI repeats may maintain, via a recursive regulatory function, the transcriptional viability of L1 members after retroposition events. A 2.5kb portion of the mouse L1 repeat that has not been previously sequenced is presented. It is 55-70% homologous to a corresponding portion of the human KpnI repeat family. Comparative sequence analysis revealed that one common open reading frame may conserve potential coding function across species. A second open reading frame bears an asymmetric distribution of codon replacements unlike both genes and pseudogenes. This latter feature could be consistent with a proposed chromosome organization function that is unrelated to peptide expression.

The frequency classes and organization of the main component (mc) DNA of a crustacean, the land crab, Gecarcinus lateralis, have been characterized. The reassociation kinetics of 380 nucleotide long mcDNA fragments show that approximately 50% contain sequences repeated more than 800 times. Present in few, if any, copies are sequences repeated from 2 to 800 times. The remainder of the DNA reassociates as single copy sequences with a rate constant consistent with the organism's genome size. The reassociation kinetics of highly sheared DNA fragments of every true crab studied (Vaughn, 1975; Christie et al., 1976) are similar to each other and different from those of other invertebrate DNAs (Goldberg et al., 1975). Each of these genomes has a paucity of sequences repeated from 10 to 800 times and an abundance of highly repeated sequences. To determine if sequences repeated more than 800 times are interspersed with single copy sequences, we examined the arrangement of repetitive and non-repetitive sequences in mcDNA. The reassociation and melting properties of partially duplex mcDNA fragments of increasing lengths show that at least 75% of the DNA is organized in an interspersed pattern. In this pattern, single copy sequences with an average length of 800–900 nucleotides are interspersed with repetitive sequences. S1 nuclease digestion of reassociated 3100 nucleotide fragments indicates that ∼44% of the mcDNA is repetitive and that one-third of the repetitive sequences (average length=285 nucleotides) are interspersed with single copy sequences. We conclude that repetitive sequencies are interspersed with most of the single copy sequences in an interspersion pattern similar to that of Xenopus rahter than to that of another arthropod, Drosophila.

Short interspersed repetitive sequences have been found in the DNA of all eukaryotes studied. This paper examines, using computer simulation, the possibility that such sequences are parasitic and that their interspersion is a means of maximizing recombination between gene copies and with it the ability of such genes to invade a population by a process of replicative transposition. The results indicate that the observed spacing of the sequences is less than that which would maximize recombination, and that no stable equilibrium number of copies of such a gene can be expected according to the simplest assumptions. The evidence that eukaryotic genes can be transposed and that interspersed repetitive sequences are functional is reviewed.

The mouse genome is complex with regard to DNA sequence organization and transcriptional activity. To more fully understand the role of interspersed repetitive DNA sequences we have isolated and characterized five different mouse non-Alu DNA sequence families. We have found that: (1) the distribution of repetitive sequences is non-random in the genome; (2) two of the five families (Bam5 and R) were previously described by Fanning (1982) and Gebhard et al. (1982), respectively. We found that these two families are linked to each other and are found adjacent to seven of seven studied structural genes but in randomly selected DNA fragments showed much less significant linkage. (3) The position of the Bam5 and R family repeat units relative to β-globin and relative to a housekeeping gene has been evolutionarily conserved in mice and humans. (4) Three previously undescribed families representing from 200 to 40,000 copies per genome have been characterized and shown to have equivalent human sequences. (5) All five families studied are represented in RNA polymerase II transcripts. Little RNA polymerase III transcription homologous to these three families could be detected. The structural and functional features of these five families defined in this paper provide a basis for studies on the functional role of interspersed repetitive DNA in the mouse.

We investigated the genomic distribution of mouse and human repeated sequences by assessing their relative amounts in the four major components into which these genomes can be resolved by density gradient centrifugation techniques. These components are families of fragments that account for most or all of main-band DNAs, range in dG + dC content from 37% to 49%, and are derived by preparative breakage from long DNA segments (greater than 300 kb) of fairly homogeneous composition, the isochores. The results indicate that the short repeats of the B1 family of mouse and of the Alu I family of man are most frequent in the heavy components, whereas the long repeats of the BamHI family of mouse and of the Kpn I family of man are mainly present in the two light components. These results show that the genomic distribution of repeated sequences is nonuniform and conserved in two mammalian species. In addition, we observed that the base composition of two classes of repeats (60% dG + dC for short repeats; 39% dG + dC for long repeats) is correlated with the composition of the major components in which they are embedded. Finally, we obtained evidence that not only the short repeats but also the long repeats are transcribed, these transcripts having been found in mouse poly(A)+ mRNA.

Psoralen crosslinking of RNA–RNA intermolecular duplexes in sea urchin egg extracts reveals that some maternal poly(A)+ RNA molecules are complexed with U1 RNA, a cofactor in somatic nuclear pre-mRNA splicing. Reaction of egg extracts with a monoclonal antibody specific for U1 snRNP selects, in addition to Ul, RNAs that contain repeated sequences interspersed with single-copy elements. Antibodyselection experiments with nucleate and anucleate egg halves demonstrate that most of the Ul RNA–inter-spersed RNA complexes are cytoplasmic, as is the egg’s store of total Ul snRNP. These results raise the possibility that maternal interspersed RNAs include unprocessed pre-messenger RNA molecules in arrested complexes with splicing cofactors.

Several human DNAs digested with Kpn I restriction endonuclease released a 0.6-kilobase (kb) segment that varied in its intensity among human samples. A recombinant DNA clone (N6.4) of these 0.6-kb Kpn I segments was isolated and used to probe the genomic content and restriction cleavage pattern of homologous sequences. The hybridization patterns revealed a previously undescribed, moderately repetitive long interspersed (LINE) sequence family, which we have termed L2Hs (second LINE family in Homo sapiens). This LINE family exhibits both quantitative and qualitative polymorphisms in the human population. The content of L2Hs sequences in human genomes varies over a 5-fold range. Relative to the value for a human placental DNA, sequences homologous to the L2Hs family occur in lower amounts in gorilla DNA (approximately 20%) and even less in DNA from chimpanzees and other primates (less than 1%). Thus, the L2Hs sequences appear to have emerged only recently as a moderately repetitive sequence family in primate evolution. The observed restriction fragment length polymorphism of the L2Hs family members may reflect patterns of sequence rearrangements, amplifications, and/or deletions in human genomes.

DNA sequence analysis of a region contained within a large, interspersed repetitive family of mice reveals a long open reading frame. This sequence extends 978 base pairs between two stop codons, creating a reading frame that is open for 326 amino acids. The DNA sequence in this region is conserved between three distantly related Mus species, as well as between mouse and monkey, in a manner that is characteristic of regions undergoing selection for protein function.

The KpnI sequences constitute the dominant, long, interspersed repetitive DNA families in primate genomes. These families contain related, but nonidentical sequence subsets, some of which border functional gene domains and are transcribed into RNA. To test whether these sequences perform an organizational function in the nucleus, their association with the nuclear matrix has been examined in African green monkey cells. DNase I treatment depleted the residual matrix of most of the KpnI 1.2- and 1.5-kilobase pair family sequences although significant amounts of each family remained in the loop attachment DNA fragments. Hybridization analysis of the KpnI and RsaI cleavage patterns of matrix loop attachment DNA indicate that some sequence subsets of these KpnI families are relatively less depleted than others. The nuclear matrix association of subpopulations of KpnI 1.2- and 1.5-kilobase pair families was also shown by metrizamide gradient centrifugation of nuclear matrix complexes cleaved by KpnI endonuclease. The gradients demonstrate that some KpnI segments are differentially associated with nuclear matrix proteins. Moreover, the procedures permit the preparative isolation and purification of the DNA-protein complexes containing these KpnI 1.2- and 1.5-kilobase pair sequence families. Speculations on the relationship between the matrix association of these KpnI family sequences and their possible roles in gene organization and expression are presented and discussed.

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.

We have examined the genomic organization and developmental expression pattern of a short, transcribed, interspersed repeat element and its associated single-copy sequences. We have previously shown that 1% of the polyadenylated [poly(A)+] RNA from vegetative cells contains sequences that hybridize to this repeat. The complementary RNA is heterogeneous in size, and 90% of its mass hybridizes to single-copy DNA. In this study, we examined a series of genomic DNAs and cDNAs derived from poly(A)+ RNAs which are complementary to the repeat. Comparisons of sequence data from various genomic and cDNA clones indicated that (AAC)n X (GTT)n is the common sequence element. The tandem repeat occurred in approximately 100 short segments (approximately 35 to 150 base pairs) per haploid genome interspersed with single-copy DNA. Probes from regions adjacent to this element hybridized to unique restriction fragments on DNA blots and unique poly(A)+ RNA species on RNA blots. The (AAC)n X (GTT)n sequence was asymmetrically transcribed with only (AAC)n sequences represented in RNA. The repeat was localized within the transcribed regions of several genes and 70 base pairs 5' to the transcription initiation site of another gene. Individual (AAC)n-containing RNAs exhibited a developmental pattern of expression suggestive of the coordinate expression of many AAC gene family members.

Approximately 52% of the nuclear genome of great millet(Sorghum vulgare) consists of repetitive DNA which can be grouped into very fast, fast and slow components. The reiteration frequencies of the fast and slow reassociating components are {dy7000} and 92 respectively. Approximately 90% of the genome consists of repeated sequences interspersed amongst themselves and with single copy sequences. The interspersed repeat sequences are of three sizesviz. > 1·5 kilobase pairs, 0·5–1·0 kilobase pairs and 0·15–0·30 kilobase pairs while the size of the single copy sequences is 3·0 kilobase pairs. Hence the genome organization of great millet is essentially of a mixed type

The structure of three members of a repetitive DNA family from the genome of the nematode Caenorhabditis elegans has been studied. The three repetitive elements have a similar unitary structure consisting of two 451-bp sequences in inverted orientation separated by 491 bp, 1.5 kb, and 2.5 kb, respectively. The 491-bp sequence separating the inverted 451-bp sequences of the shortest element is found adjacent to one of the repeats in the other two elements as well. The combination of the three sequences we define as the basic repetitive unit. Comparison of the nucleotide sequences of the three elements has allowed the identification of the one most closely resembling the primordial repetitive element. Additionally, a process of co-evolution is evident that results in the introduction of identical sequence changes into both copies of the inverted sequence within a single unit. Possible mechanisms are discussed for the homogenization of these sequences. A direct test of one possible homogenization mechanism, namely homologous recombination between the inverted sequences accompanied by gene conversion, shows that recombination between the inverted repeats does not occur at high frequency.

4.5S RNAH (4.5S RNA associated with poly A containing RNA) has extensive homology to major interspersed repeat B1 in rodent genomes. We developed a new cloning technique for screening genomic library that eliminates the signal produced by repeated sequences or pseudogenes and applied it to cloning of 4.5S RNAH genes. Six phage clones (2, 3, 6, 9, 10 and 15) which hybridize with 4.5S RNAH were isolated from a rat gene library by this method. The restriction fragments containing the 4.5S RNAH locus were subcloned into plasmids and sequenced. Clones 2, 3, 9 and 15 contained one to five base substitutions in the coding region for 4.5S RNAH and were probably pseudogenes. In clone 2, the 4.5S RNAH locus was linked directly with the identifier sequence. Clone 6 contained three copies of the 4.5S RNAH gene (6a, b and c) which were clustered in the same direction within 455 base pairs. 6b was linked directly with 6c and ubiquitous repetitive DNA sequences B2 were inserted immediately after 6a and 6c. These three sequences as well as the sequence in clone 10 were colinear with rat 4.5S RNAH. In an in vitro transcription system, only clone 10 gave intact 4.5S RNAH.

A family of short, interspersed repeats in the human genome, designated the Mst II family, is described. The canonical structure of the repeat consists of a 220-base-pair (bp) left arm joined to a 160-bp right arm by a 39-bp junction sequence. The right arm is absent in some isolates. Some homology with the "O" and "THE" (transposon-like element) families of repeats was observed, suggesting that the Mst II elements could be a subgroup of a SINE superfamily. The 39-bp junction sequence is tandemly repeated in one of our clones. The association of tandemly repetitive sequences with Mst II elements or the putative superfamily is probably nonrandom; a search of DNA sequence data bases revealed that approximately 80 bp of the Mst II left arm occurs immediately adjacent to the tandem repeat that comprises the human homologue to the BK virus enhancer. The fortuitous occurrence of a gene duplication event involving an Mst II repeat has allowed us to estimate a mutation rate for human DNA.

The C repeat family was first observed in the rabbit β-like globin gene family. We have estimated the repetition frequency of the C repeats, determined the nucleotide sequence of three intact members and one truncated member, and have investigated the size, tissue specificity, and intracellular localization of C repeat transcripts. Members of the C repeat family are short (average size of 316 basepairs) and are repeated about 170,000 times per haploid genome in a widely dispersed pattern. They end in a 3′ poly(dA) tract and are flanked by direct repeats that range in size from 8 to 16 base-pairs. The consensus internal control regions for polymerase III transcription are located near the 5′ end. Different amounts of C repeat RNA accumulate in a variety of tissues, and most of the transcripts are confined to the nucleus. A heterogeneous distribution of C repeat RNA sizes was found, ranging from about 330 to 8200 nucleotides. These structural and transcriptional properties are similar to those of primate and rodent Alu and Alu -like repeats. However, the C repeats are not similar in sequence to the Alu repeats. Thus two different types of short, interspersed repeats capable of being transcribed and proposed to be transposable elements have now been identified in mammals. The positions of these short repeats in mammalian β-like globin gene families are not tightly conserved.

The nucleotide sequences of eight randomly selected, cloned, repetitive sequence elements were determined. No homologies exist among the eight sequences that are sufficient to promote cross-reaction between them under standard conditions of measurement. Thus, each sequence is representative of a different repeat sequence family. Statistically significant but short (8 to 41 nucleotides) internal direct and inverse repetitions occupy a minor fraction of the sequence length in five of the eight repeat sequences. None contains internal reverse repeats sufficiently long to permit inclusion in the “foldback” DNA fraction. The general lack of internal sequence homology means that the sequence complexity of the eight clones is approximately equal to the length of the cloned inserts. Nucleotide sequences of three different members of one particular short interspersed repeat sequence family are also reported. Comparison of these sequences reveals that both the number and order of internal sequence subelements differ among family members. The results show that both fine-scale rearrangement and sequence divergence have occurred during the evolution of this repeat family.

We have determined the complete nucleotide sequence for five members of the L1Md repetitive family from the beta-globin gene region of the BALB/c mouse. The five repeats are different lengths, each terminating at the 5′ end at different points with respect to one another. We have analyzed the nucleotides around the endpoints of the five repeats for clues as to the mechanisms involved with the dispersal and 5′ truncation of this repeat family. Each L1 member is flanked by a pair of short direct repeats. Since these direct repeats differ in length and sequence in each of the five cases, the dispersal mechanism does not involve a sequence targeted process. The sequence at the 3′ end is conserved and its organization resembles the 3′ end of a polyadenylated RNA, suggesting that transcripts of the repeat are involved in the dispersal process either directly or as intermediates in the generation of complementary DNA copies of the sequence. One of the L1 repeats is a recent insertion, since it is found in the Hbb d chromosome, but not in the Hbb s chromosome. This suggests a dispersal process that has been active as recently as 4 million years ago.

The poly(A) RNA of Xenopus laevis oocytes was extracted, renatured and spread for electron microscopy. As reported for the poly(A) RNA of sea urchin eggs (Costantini et al., 1980), the Xenopus oocyte RNA renatures extensively, revealing the presence of complementary, interspersed repetitive sequences on different RNA molecules. About 68% of the mass of the poly(A) RNA in late ovarian oocytes is included in multimolecular structures after renaturation, and a similar fraction of the poly(A) RNA of mid-lampbrush stage oocytes also contains interspersed repeat sequences. In contrast, less than 15% of the poly(A) RNA molecules of stage 41 tadpoles retains the capacity for RNA duplex formation under the same conditions. Poly(A) RNAs displaying interspersed sequence organization are located in the oocyte cytoplasm. This was shown using manually enucleated oocytes. Lampbrush stage oocytes were injected with [3H]GTP, allowed to incorporate for 48 hours, enucleated, and the poly(A) [3H]RNA extracted. The fraction of the labelled poly(A) RNA that could be attributed to mitochondrial transcription was ≤ 16%, according to measurements made with cloned mitochondrial DNA. By use of a cellulose column that separates RNA-containing duplex regions, the labelled RNA was shown to anneal almost completely with the poly(A) RNA already accumulated in the cytoplasm of the oocytes. The newly synthesized poly(A) RNA exported from lampbrush chromosome stage oocyte nuclei also displays an interspersed sequence organization. RNA synthesized in vitro in isolated germinal vesicles was reacted with six cloned complementary DNAs that contain maternal poly(A) RNA sequences, and all of these probes were represented in the transcription products. Thus the amphibian lampbrush chromosome stage oocyte nucleus synthesizes and transports to the cytoplasm poly(A) RNAs that, are similar in structure and sequence content to the maternal poly(A) RNA stored in the oocyte at the termination of oogenesis. We conclude that this poly(A) RXA turns over slowly, thereby maintaining an approximately constant steady state throughout oogenesis. However, the maternal poly(A) RNA pool is so large that the rate of synthesis required for this process demands the intense and widespread level of transcription observed in lampbrush chromosomes.

The actin gene family of the sea urchin Strongylocentrotus purpuratus was analyzed by the genome blot method, using subcloned probes specific to the 3′ terminal non-translated actin gene sequence, intervening sequence and coding region probes. We define an actin gene subtype as that gene or set of genes displaying homology with a given 3′ terminal sequence probe, when hybridized at 55°C, 0·75 m-Na+. By determining the often polymorphic restriction fragment band pattern displayed in genome blots by each probe, all, or almost all of the actin genes in this species could be classified. Our evidence shows that the S. purpuratus genome probably contains seven to eight actin genes, and these can be assigned to four subtypes. Studies of the expression of the genes (Shott et al., 1983) show that the actin genes of three of these subtypes code for cytoskeletal actins (Cy), while the fourth gives rise to a muscle-specific actin (M). We denote the array of S. purpuratus actin genes indicated by our data as follows. There is a single CyI actin gene, two or possibly three CyII genes (CyIIa, CyIIb, and possibly CyIIc), three CyIII actin genes (CyIIIa, CyIIIb, CyIIIc), and a single M actin gene. Comparative studies were carried out on the actin gene families of five other sea urchin species. At least the CyIIa and CyIIb genes are also linked in the Strongylocentrotus franciscanus genome, and this species also has a CyI gene, an M actin gene and at least two CyIII actin genes. It is not clear whether it also possesses a CyIIc actin gene, or a CyIIIc actin gene. The genome of a more closely related congener, Strongylocentrotus drobachiensis, includes 3′ terminal sequences suggesting the presence of a CyIIc gene. In S. franciscanus and S. drobachiensis the first intron of the CyI gene has remained homologous with intron sequences of both the CyIIa and CyIIb genes, indicating a common origin of these three linked cytoskeletal actin genes. Of the four S. purpuratus 3′ terminal subtype probe sequences only the CyI 3′ terminal sequence has been conserved sufficiently during evolution to permit detection outside of the genus Strongylocentrotus. An unexpected observation was that a sequence found only in the 3′ untranslated region of the CyII actin gene in the DNA of S. drobachiensis and S. purpuratus is represented as a large family of interspersed repeat sequences in the genome of S. franciscanus.

A wide spectrum of repetitive DNA amounts and interspersion patterns is seen in mosquitoes and other dipterans. Using a simple and rapid technique, we show that these range from a minimal amount in five species of Anopheles through moderate amounts in Culex quinquefasciatus to large amounts in Aedes aegypti and Stomoxys calcitrans. Although Culex and Aedes are closely related and both have a considerable amount of interspersed repetitive DNA, the repetitive sequences are different between the two genera. These results and previously published information show that the amount of repetitive DNA and sequences involved have changed many times during the evolution of the Diptera.

Two types of DNA sequence polymorphisms were found among different geographic isolates of the basidiomycete fungus Coprinus einereus. These strains showed gains and losses of restriction enzyme recognition sites as well as extensive insertion/ deletion variation within DNA sequences present in a single copy per haploid genome. The same types of DNA sequence variants were also found within the tandemly repeated ribosomal RNA genes in these strains. There appears to be very little interspersed repetitive DNA in Coprinus, since all the randomly selected cloned DNA sequences studied in this survey were present only once in each haploid genome.

With high-throughput Solexa sequencing technology, we profiled Porphyra yezoensis transcriptomes from 8 different samples. More than 1200 megabases from 13333334 quality paired-end reads were generated, which were assembled into 31538 unigenes. Blast analysis showed that 56.7% unigenes were novel, which represented the specific genes of Porphyra and/or rhodophytes. Several hundreds of unigenes related to stress tolerance were discovered, including genes related to desiccation-(211) and high light-tolerance (31), flavonoid biosynthesis (10), reactive oxygen scavenging (48) and other stress-tolerance processes (208), which indicated there existed complex and diversity modes of stress tolerance in this species. A complete set of essential genes involved in the C3-(57) and C4-(44) carbon fixation pathway (except pyruvate phosphate dikinase) were discovered, which not only proved that they were actively transcribed but also clearly outlined the panoptic view of carbon fixation in Porphyra. Moreover, by statistically analyzing the types, proportions and frequencies of the interspersed repeats (TEs) and simple sequence repeats (SSRs), we discovered that the top three types of TEs were all retrotransposons and the trinucleotide was the absolute predominant type among SSRs, promoting our understanding of structural characteristics of the transcriptome. This study substantially improved the global view of the Porphyra genome and provided a valuable resource for future research.

Mobile DNAs have had a central role in shaping our genome. More than half of our DNA is comprised of interspersed repeats resulting from replicative copy and paste events of retrotransposons. Although most are fixed, incapable of templating new copies, there are important exceptions to retrotransposon quiescence. De novo insertions cause genetic diseases and cancers, though reliably detecting these occurrences has been difficult. New technologies aimed at uncovering polymorphic insertions reveal that mobile DNAs provide a substantial and dynamic source of structural variation. Key questions going forward include the how and how much new transposition events affect human health and disease.

Photoelectron imaging provides the possibility of a new method of mapping chromosomes. The basic concept is to cause DNA to emit electrons under the action of UV light. The criteria which must be met to map genomes by photoelectron imaging are set forth and discussed. Forming an image of the DNA by accelerating and focusing the electrons is a necessary but not sufficient condition for genome mapping. Equally important is to identify wavelengths of UV light which will cause selective emission from the base pairs, adenine-thymine and guanine-cytosine. The resulting image would then contain a modulation in the image brightness along the DNA duplex. By examining the photoelectron current from uniform films of homopolymers, a wavelength region is identified where marked differences in emission from base pairs is observed. At 160 nm, for example, the relative electron emission from a film of poly(dGdC) is approximately 5 times greater than for an equivalent film of poly(dAdT). Using the experimental data and known sequences, photoelectron gene maps are calculated for the bacteriophage lambda and for a short interspersed repetitive DNA sequence (an Alu repeat) of the human genome. The results suggest that a 5-nm physical map of chromosomes generated by photoelectron imaging would be informative and useful in mapping human and other large genomes.

Interspersed repetitive sequences are represented widely in animal cell nuclear RNAs, in the poly(A) RNA stored in eggs and in some mRNAs. Their expression is developmentally modulated. Although the genomic location of repetitive sequences may change rapidly during evolution, the patterns of their transcription suggest a variety of possible functions.

In most eukaryotic genomes, including human, 300-nucleotide repeated DNA sequences are interspersed with longer (∼1,000 nucleotide) single copy sequences1–3. We have recently found that most 300-nucleotide interspersed repeats in human share a common site for cleavage by the restriction enzyme AluI and should be regarded as a single family of sequences4. We designate this as the Alu family of sequences. Similarly, most of the 300-nucleotide inverted repeated sequences, which are also interspersed with single copy DNA, share this same restriction site and belong to the Alu family4. There are approximately 300,000 members of this family of sequences, which together make up at least 3% of the human genome4. It is conceivable that individual members of the Alu family repeats share only very limited regions of homology, one of which happens to contain the restriction site for AluI and others which share the additional restriction sites reported here. In this case, members of the Alu family could be essentially different DNA sequences. DNA renaturation studies support the alternative view that members of the Alu family share extensive homology over the entire sequence length4. According to this view, individual members of the family could exhibit some divergence from the ancestral sequence but all members would be recognised as a closely related group of sequences5. We have distinguished between these alternatives by directly determining the base sequence of a part of the Alu family. This base sequence shows that individual members of the Alu family share a common ancestral nucleotide sequence.

The distribution of MIRs (mammalian-wide interspersed repeats) was investigated in 164 human sequences (or = 100 kb), which were assigned, according to their GC level, to isochore families L, H1, H2 and H3. MIR elements, whose total number in the genome was estimated to be about 3.3 x 10(5), were found to be unevenly distributed in human isochores. The majority of MIRs (55%) were found in the L isochore family. In contrast, MIR density was highest in H2, closely followed by H1, whereas densities in L and H3 were 2- and 3-fold lower than in H2, respectively. For this reason, the assessment of MIR distribution by inter-repeat PCR led to an overestimation of MIR numbers in H2 isochore and an underestimation in L isochores.

M4 is a recombinant plasmid containing Dictyostelium nuclear DNA. The restriction map has been determined (K. Kindle and R. Firtel, manuscript submitted) and the four major fragments have been subcloned in pBR322. M4 is >90% single-copy; however, it does contain a short (300 bp) sequence repeated ∼100 times in the Dictyostelium genome. The short repeat sequence is interspersed between single-copy regions. 1–1.5% of total vegetative poly(A) + mRNA hybridizes to the repeat, but only 10 % of the hybridization is resistant to low levels of RNAase. The mRNA is heterogeneous in size and 90 % of the mass is complementary to Dictyostelium single-copy DNA. We have also shown that one of the single-copy regions adjacent to the repeat is complementary to a low abundance class mRNA (0.01% of total mRNA). Sandwich hybridization experiments show that unlabeled RNA that hybridizes to this single-copy region will also hybridize 32p repeat. Exonuclease studies indicate that the repeat and single-copy regions are part of a single transcription unit which encodes a 1.2 kb mRNA. The 5′ end of this mRNA is complementary to the short repeat sequence and the remainder of the mRNA is transcribed from single-copy DNA. Furthermore, RNA excess hybridization to 32 P-labeled separated strands of the repeat suggests that the repeat sequence is transcribed asymmetrically into poly(A) + RNA. We have proposed a model in which this repeat sequence is adjacent to ∼100 different single-copy genes and is transcribed to produce different mRNA molecules carrying the common repeat sequence at the 5′ end.

A band of 300 nucleotide long duplex DNA is released by treating renatured repeated human DNA with the single strand-specific endonuclease S 1 . Since many of the interspersed repeated sequences in human DNA are 300 nucleotides long, this band should be enriched in such repeats. We have determined the nucleotide sequences of 15 clones constructed from these 300 nucleotide S 1 -resistant repeats. Ten of these cloned sequences are members of the Alu family of interspersed repeats. These ten sequences share a recognizable consensus sequence from which individual clones have an average divergence of 12.8%. The 300 nucleotide Alu family consensus sequence has a dimeric structure and was evidently formed from a head to tail duplication of an ancestral monomeric sequence. Three of the remaining clones are variations on a simple pentanucleotide sequence previously reported for human satellite III DNA. Two of the 15 clones have distinct and complex sequences and may represent other families of interspersed repeated sequences.

Comparative analysis of the available 3′-portions of the human L1 (LINE-1) family of repeated sequences indicates that all the sequences can be classified in two major subfamilies. The division is based on patterns of diagnostic bases shared within L1 subfamilies of sequences but differing between them. The overall ratio of replacement to synonymous positions, occupied by the diagnostic bases in the large open reading frame of the L1 sequence, is 1.15. This indicates that both subfamilies were obtained from genes coding for functional proteins. The L1 subfamilies appear to be of different ages and may represent a “fossil record” of the same active gene at different times in the history of primates. The younger subfamily can be split further into at least two closely related branches of sequences. The above facts combined with the recent data for the Alu subfamily structure show that LINE and SINE families of interspersed repeats share discontinuous patterns in their evolution. These data are consistent with the model that both Alu and L1 families, as well as other pseudogene families, contain active genes producing discrete layers of pseudogenes throughout the history of primates. Models of evolutionary processes that could generate these discontinuities are discussed together with the possible biological role of Alu and L1 genes.

Determination of the DNA sequence of a cluster of repetitive elements located 3' to the rabbit beta-1 globin gene shows that previously identified B, E, and D repeats are linked to form a long repeat. The B and E regions are homologous to the L1 long interspersed repeats of primates and rodents. Thus L1 repeats are widely dispersed in several different mammalian orders. The sequence similarity among L1 repeats from three species is limited to a long segment that contains extensive open reading frames. This conserved region is followed by a highly divergent segment that corresponds to a 3' untranslated region. The conservation of sequences in the open-reading-frame region coupled with the divergence of the untranslated region supports the hypothesis that the L1 repeats are derived from transcripts of a functional gene that encodes a protein.

A major family of short, interspersed, repeated sequences in the bovine genome has been characterized. This family makes up the majority of all non-satellite repetitive DNA or about 6% of the bovine genome. It is estimated that there are at least 600 000 copies of this family interspersed among non-repetitive DNA sequences. Sequence analysis shows that this family includes sequences reported previously by Watanabe et al. (Nucleic Acids Res. 10, 1459-1469, 1982) and is distantly related to the human Alu sequence family.

A 300-bp DNA sequence has been determined for 30 (10 from each of three species of mice) random isolates of a subset of the long interspersed repeat family L1. From these data we conclude that members of the L1 family are evolving in concert at the DNA sequence level in Mus domesticus, Mus caroli, and Mus platythrix. The mechanism responsible for this phenomenon may be either duplicative transposition, gene conversion, or a combination of the two. The amount of intraspecies divergence averages 4.4%, although between species base substitutions accumulate at the rate of approximately 0.85%/Myr to a maximum divergence of 9.1% between M. platythrix and both M. domesticus and M. caroli. Parsimony analysis reveals that the M. platythrix L1 family has evolved into a distinct clade in the 10-12 Myr since M. platythrix last shared a common ancestor with M. domesticus and M. caroli. The parsimony tree also provides a means to derive the average half-life of L1 sequences in the genome. The rates of gain and loss of individual copies of L1 were estimated to be approximately equal, such that approximately one-half of them turn over every 3.3 Myr.

Simple sequences are stretches of DNA which consist of only one, or a few tandemly repeated nucleotides, for example poly (dA) X poly (dT) or poly (dG-dT) X poly (dC-dA). These two types of simple sequence have been shown to be repetitive and interspersed in many eukaryotic genomes. Several other types have been found by sequencing eukaryotic DNA. In this report we have undertaken a systematical survey for simple sequences. We hybridized synthetical simple sequence DNA to genome blots of phylogenetically different organisms. We found that many, probably even all possible types of simple sequence are repetitive components of eukaryotic genomes. We propose therefore that they arise by common mechanisms namely slippage replication and unequal crossover and that they might have no general function with regards to gene expression. This latter inference is supported by the fact that we have detected simple sequences only in the metabolically inactive micronucleus of the protozoan Stylonychia, but not in the metabolically active macronucleus which is derived from the micronucleus by chromosome diminution.

Mouse genome contains two major families of short interspersed repeats in more than 10(5) copies scattered throughout the whole genome. They are referred to as B1 and B2 sequences since they were first isolated from the genome library by means of a dsRNA-B probe /1/. In this work, two copies of the B2 family were sequenced and compared with the previously sequenced B1 repeat /2/. A B2 ubiquitous repeat is ca. 190 bp long. The members of the family deviate in 3-5% of nucleotides from the consensus sequence. B2 contains regions of homology to the RNA polymerase III split promoter and to 4.5S snRNA I. Both B1 and B2 contain regions which resemble junctions between exons and introns. In contrast to B1, B2 does not contain apparent homologies to papova viral replication origins and a human Alu sequence. One side of the B2 repeat is represented by a very AT-rich sequence (ca. 30 bp long) followed with an oligo (dA) stretch 10-15 nucleotides long. This region of the repeat is the most variable one. The whole unit is flanked with 15-16 bp direct repeats different in sequenced copies of B2. The same is true of some copies of the B1 family. The properties of B1 and B2 repeats suggest that they may represent a novel class of transposon-like elements in eukaryotic genome. A possible role of B-type repeats in genome reorganization, DNA replication and pre-mRNA processing is discussed.

We describe here the interruption of a cloned African green monkey alpha-satellite array by an 829-base-pair-long nonsatellite DNA segment. Hybridization experiments indicate that the sequences within the interruption are homologous to segments frequently found in the 6-kilobase-pair-long members of the KpnI family of long, interspersed repeats. These data confirm and extend earlier results suggesting that sequences common to the KpnI family can occur independently of one another and in segments of variable lengths. The 829-base-pair-long segment, which is termed KpnI-RET, contains a terminal stretch of adenosine residues preceded by two typical but overlapping polyadenylation sites. KpnI-RET is flanked by direct repeats of a 14-base-pair-long segment of alpha-satellite that occurs only once in the satellite consensus sequence. These structural features suggest that KpnI-RET was inserted into the satellite array as a movable element.

Publisher Summary In plants, variegation is most easily recognized as irregularities in pigment patterns on leaves, flowers, and seeds, although other characteristics such as leaf form, flower form, or starch content (in maize kernels) may also be subject to variegation. This chapter focuses on variegation in plants due to genetic alterations implemented by transposable elements. The distinguishing feature of this kind of variegation, as opposed to other examples discussed, is that the two or more different kinds of tissue in the variegated plant differ genotypically, that is, with respect to the DNA of their nuclear genomes. In the simplest case, one kind of tissue contains a transposable element at a given locus and the other does not. The term “transposable element” rather than “controlling element” is used to avoid confusion with the terminology of other fields of genetic research. First, data from molecular research that have provided new criteria beyond those obtained by classical genetic methods are discussed. Thus, DNA sequence analyses have shown that transposable elements may share certain structural features that might be useful for classification. Furthermore, transposition can now be demonstrated by DNA hybridization techniques that were unknown 20 years ago. In general, a transposable element is characterized by its ability to integrate into the DNA at some position in the genome and thereby alter the expression of the gene(s) in and around itself.

Publisher Summary This chapter discusses a class of highly repeated DNA sequences ubiquitous to the human genome. A highly repetitive family of 300-nucleotide-long sequences has been isolated from human DNA. These sequences appear to be interspersed with single-copy DNA sequences and are characterized by a site for the restriction enzyme Alu I located 170 nucleotides from one end. The same sequence family has been found in 300-nucleotide long inverted repeated human DNA. This Alu family of sequences contains over half of the 300-nucleotide long repeated sequences and constitutes at least 3% of the human genome. This corresponds to a 300-nucleotide long sequence repeated more than 200,000 times. The Alu family appears to be interspersed throughout 30 to 60% of the human genome. The Alu family does not appear to be related to the tandemly repeated sequences which have been isolated from human DNA by restriction enzyme cleavage. These sequences may be related to repeated sequences which have been found to be interspersed throughout the hnRNA. These hnRNA sequences have a very low complexity as indicated by fingerprint analysis. The inverted repeated DNA sequences have been shown to contain the same sequences as the repeated hnRNA sequences.

We have isolated clones in which two regions of the human genome are represented, each containing an orphon: a dispersed copy of 28S rDNA. Nucleotide (nt) sequence analysis established that one of these, H28S-O1, corresponds to nt 3627-4105 of human 28S rDNA, but in a mutated form. The orphon was flanked on one side by a portion of the L1Hs long interspersed repeat family of the human genome. Although H25S-O1 is not flanked by the terminal direct repeats characteristic of transposed DNA, it is possible that it is a processed pseudogene.

We show that the large DNA genomes of human and simian cytomegaloviruses (HCMV and SCMV, respectively) each contain multiple binding sites for purified cellular nuclear factor 1 (NF1) protein. Examination of the major immediate-early (IE) gene region in the HindIII H fragment of SCMV (Colburn) by filter binding assays showed that it competed 45-fold better than the single adenovirus type 2 binding site for NF1 protein and that it contained at least two distinct binding loci. Direct DNase I footprinting analyses of the 5' upstream locus detected at least 20 adjacent NF1-binding sites located between positions -600 and -1300 relative to the IE94 mRNA start site. DNA sequence analysis of the region revealed a conserved consensus NF1 recognition element (T)TGG(C/A)N5GCCAA embedded within each of 23 highly diverged 30-base-pair tandem repeats, together with a second downstream cluster of five consensus NF1-binding sites between positions +470 and +570 in the large first intron. Two separate NF1-binding loci were also found in the equivalent IE68 gene of HCMV(Towne) DNA, but in this case the DNA sequence and competition filter binding experiments indicated a maximum of only four to five consensus binding sites encompassing the promoter-enhancer region. In transient expression assays, neither the isolated upstream IE94 tandem repeats nor a synthetic single-copy consensus NF1-binding site acted as transcriptional cis activators or enhancers when placed adjacent to the simian virus 40 minimal early region promoter. We conclude that the large and complex 5' upstream promoter-regulatory region for the SCMV IE94 gene comprises two distinct domains. The previously described four sets of 13- to 18-base-pair interspersed repeat elements between -55 and -580 provide most of the high basal transcriptional strength, whereas the arrangement of further upstream tandemly repeated NF1-binding sites may contribute significantly to the expanded biological host range for expression of SCMV IE94 compared with HCMV IE68.

A model of duplicative transposition and gene conversion for the evolution of repetitive DNA families was studied. In this model, transposition and conversion (both unbiased) are assumed to occur both within and between the genomes in a diploid cell, and any degree of linkage intensity is incorporated. The transition equations for allelic and nonallelic identity coefficients have been formulated by using the previous results. The results are widely applicable to many repetitive sequences, from dispersed families like transposons to tightly linked multigene families. It has been shown through extensive numerical studies on equilibrium properties that duplicative transposition and gene conversion have very similar effects on nonallelic identity coefficients, but that allelism and allelic identity are greatly influenced by the relative rates of occurrence of the two processes.

We present DNA sequences flanking cloned hypervariable human minisatellites. In addition to providing confirmatory evidence that minisatellites cluster with other tandem repeats, these flanking sequences contain a high frequency of interspersed repetitive elements. These elements include a retroviral LTR-like sequence, from which one of the minisatellites appears to have expanded, and a recently described short interspersed repeat. We present our own findings concerning this element, in particular that those examples studied do not show significant evolutionary conservation, despite suggestions that the element may have a cis-acting function.