Search

Objective:To compare the effect of right- or left-sided cochlear implantation on listening skills in a paediatric population.Methods:A retrospective analysis was conducted on the listening skills performance data of children who were operated on and followed up at the Çukurova University Department of Otorhinolaryngology between 2007 and 2011. Sixty-three patients were included in the study. Patients were evaluated using the Listening Progress Profile, the Meaningful Auditory Integration Scale and the littlEARS test.Results:The mean age of the children was two years (range of one to five years). Twenty-nine patients were male and 34 were female. Twenty-eight patients were implanted in the right ear and 35 in the left ear. There were no statistically significant differences between right and left ear implantees in terms of listening skills performance.Conclusion:This study indicates that the choice of cochlear implant side is not crucial for the development of listening skills. [ABSTRACT FROM PUBLISHER]

Objective:Mutations in the genes for connexin 26 (GJB2) and connexin 30 (GJB6) play an important role in autosomal recessive, non-syndromic hearing loss. This study aimed to detect the 35delG and 167delT mutations of the GJB2 gene and the del(GJB6-D13S1830) mutation of the GJB6 gene in paediatric patients diagnosed with congenital, non-syndromic hearing loss and treated with cochlear implantation in Mediterranean Turkey.Materials and method:We included 94 children diagnosed with congenital, non-syndromic hearing loss and treated with cochlear implantation. Blood samples were collected, DNA extracted and an enzyme-linked immunosorbent assay performed to enable molecular diagnosis of mutations.Results:Of the 94 children analysed, the 35delG mutation was detected in 12 (12.7 per cent): 10 (83.3 per cent) were homozygous and 2 (16.7 per cent) heterozygous mutant. The 167delT and del(GJB6-D13S1830) mutations were not detected.Conclusion:The GJB2-35delG mutation is a major cause of congenital, non-syndromic hearing loss in this study population. [ABSTRACT FROM PUBLISHER]

Background: Although many studies have compared open and laparoscopic procedures, showing many advantages in favor of the laparoscopic technique during the early postoperative period, only a limited number of reports in the literature compare the two techniques during the later follow-up period with regard to quality of life. This study aimed to compare the effects of these two cholecystectomy techniques on the quality of life and clinical outcome of the patients during long-term follow-up evaluation.Methods: This study evaluated 200 patients who underwent cholecystectomy operations with either technique between 1993 and 1999 in our department. There were 100 patients in each group. Both groups were similar with respect to age, gender, body mass indexes, American Society of Anesthesiology (ASA) scores, and indications for surgery. The Medical Outcome Study Short Form 36 Health survey (SF-36), which includes 36 items, was used for evaluating the quality-of-life index. In addition to this, a system-specific instrument for gastrointestinal diseases was used to investigate clinical outcome.Results: The mean administration time for the questionnaire was 46.8 +/- 18.7 months in the laparoscopic cholecystectomy (LC) group and 41.5 +/- 16 months in the open cholecystectomy (OC) group. Statistically significant differences were noted in the scores for all eight SF = 36 health status domains in favor of laparospopic surgery. No statistically significant difference was found for abdominal pain, location of the pain, referral to a doctor for the pain, accompanying symptoms, relieving factors for the pain, distention, and dyspeptic complaints, usage of antacid therapy, weight changes, changes in bowel habit, need for a special diet, or sexual functions between the two groups.Conclusions: The gastrointestinal clinical symptoms were similar in the two groups during the long-term follow-up evaluation, but laparoscopic cholecystectomy was found to be significantly superior to the open technique with respect to the quality of life over the long term. [ABSTRACT FROM AUTHOR]

In August 2011, unusual virus-like symptoms consisting of distinct bright yellow spots, mottling (calico), mosaic, narrow leaves and stunting were observed on greenhouse-grown pepino (Solanum muricatum) plants in Usak (western Turkey). Leaf tissue from 10 symptomatic plants was sampled and analyzed by DAS-ELISA using commercial kits to Pepino mosaic virus (PepMV), Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tomato ringspot virus (ToRSV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus M (PVM) and Potato virus S (PVS) (Bioreba, Switzerland). DAS-ELISA results revealed that four samples were infected by CMV, five by AMV and one by both CMV and AMV. There were no reactions with the antisera to PepMV, TMV, TSWV, ToRSV, PVX, PVY, PVM and PVS. The presence of AMV and CMV was confirmed by RT-PCR using total RNA extracted from infected pepino leaves (Foissac et al., 2001) and specific primers designed to amplify a fragment of the coat protein gene of AMV (Martinez et al., 2004) (AMVcoat-F: GTGGTGGGAAAGCTGGTAAA; AMVcoat-R: CACCCAGT GGAGGTCAGCATT) and CMV (Faggioli et al., 2001) (CMV-coat-F: AACATAGCAGAGATGGCGG, CMVcoat-R: ACTCTTAACCACCCAACCTT). PCR products of the expected size (700 bp for AMV and 280 bp for CMV) were obtained from plants that were DAS-ELISA positive for AMV and CMV, respectively. To our knowledge, this is the first report of natural co-occurrence of AMV and CMV in pepino in Turkey. [ABSTRACT FROM AUTHOR]

Background: Two earthquakes of magnitude 7.7 and 7.6 occurred in the Turkish province of Kahramanmaraş in 2023. The earthquakes resulted in serious losses of life and property in 11 provinces, and the injured were transferred to other provinces for treatment and care. To date, no studies on the experiences of intensive care nurses providing care to earthquake victims after the Kahramanmaraş earthquake sequence have been identified., Aim: The aim of the present study is to explore the experiences of intensive care nurses providing care to earthquake victims who were transferred to other provinces., Study Design: A qualitative descriptive research design with conventional content analysis was used. Snowball sampling was used in the selection of intensive care nurses. Data saturation was achieved with 20 nurses. In-depth interviews were conducted with the participants through phone between March 8 and March 15, 2023. MAXQDA 20 software was used for data analysis. The COREQ checklist was used to guide the reporting of the study., Results: Twenty nurses were recruited. Four themes emerged from the data: challenges in caregiving processes; psychological challenges; ethical situations; urgent need for training and support., Conclusions: After the Kahramanmaraş earthquake sequence, described by some as the disaster of the century, nurses encountered patients with unique needs that they had never encountered before and tried to cope with the constantly changing health conditions. For this reason, they were affected psychologically and experienced challenges in caregiving processes., Relevance to Clinical Practice: Conducting comprehensive training for diseases common among earthquake victims, developing new protocols for providing care to earthquake victims, developing more action plans for nurses, and psychologically supporting intensive care nurses would facilitate the caregiving processes., (© 2023 The Authors. Nursing in Critical Care published by John Wiley & Sons Ltd on behalf of British Association of Critical Care Nurses.)

Purpose: To translate the 51-item Pediatric Ward Nurses' Caring Self-Efficacy Scale into Turkish and to test the validity and reliability of the Turkish version of the scale in the Turkish population., Design and Methods: The study was conducted with 308 nurses working in the pediatric/pediatric wards of two hospitals in Turkey between September 2021 and January 2022. A Personal Information Form, the Pediatric Ward Nurses' Caring Self-Efficacy Scale, and the Nursing Profession Self-Efficacy Scale (NPSES) were used to determine the care self-efficacy levels of the research sample., Results: The Cronbach alpha value of the scale, which was adapted to Turkish culture, was 0.982, and the test-retest reliability coefficient was 0.994. Factor loads varied between 0.40 and 0.89. The Kaiser-Meyer-Olkin sample fit coefficient of the scale was 0.963 and the Barlett sphericity test χ2 value was 15,259.02 (p < 0.001). It was determined to have a six-factor structure in Turkish culture and showed good fit indices for the Turkish scale (GFI = 0.93, CFI = 0.97, TLI = 0.96 and RMSEA = 0.09)., Conclusions: The Pediatric Ward Nurses' Caring Self-Efficacy Scale was found to be valid and reliable for sensitively detecting changes in the care self-efficacy levels of nurses working in pediatric wards., Practice Implications: The scale can be used by professionals interested in scientific knowledge about pediatric population., Competing Interests: Declaration of Competing Interest Conflict of interest statement declared by the corresponding author on behalf of all authors: The authors whose names are listed certify that they have no conflicts of interest regarding personal or professional relationships, nor any financial interests in this manuscript. The authors confirm their specific contributions to the work presented. The authors are in agreement on the conclusions, implications, or opinions stated in the manuscript reported. All authors give consent to the submission and publication of the work. Furthermore, each author certifies that this material or similar material has not been and will not be submitted to or published in any other publication., (Copyright © 2023. Published by Elsevier Inc.)

The aim of the study was to examine the effects of some pre-slaughter factors on the total carcass bruise severity score and the presence of carcass bruises. Bruises on 1027 cattle carcasses were evaluated with the "The Australian Carcass Bruise Scoring System," and at least one bruise score was determined in 92.7% of the carcasses. The total carcass bruise severity score increased as the animal's age, transport time, and AWACT (the Welfare Impact Score of Stockperson Actions) score increased (P < 0.001). The probability of the presence of carcass bruising increased 2.751 times in the autumn (P = 0.031) and 2.200 times in the summer (P = 0.072) compared to the winter. Carcass bruises tended to be 1.747 times more common in females than males (P = 0.065), and 65.9% less in the Simmental than Brown Swiss breed (P = 0.060). Human contact (OR = 1.685; P = 0.079) and electric goad using (OR = 1.762; P = 0.069) on the slaughter corridor tended to increase the probability of the presence of carcass bruises. In conclusion, to reduce the presence and severity of carcass bruises, it may be beneficial to focus on the improvement of handling and coercion practices applied by the stock person, to slaughter the cattle in the nearest slaughterhouse, and to pay more care to the handling of culled cattle., Competing Interests: Declaration of Competing Interest None., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Background: The recurrent arteriovenous fistula (AVF) intervention in the treatment of hemodialysis induces pain in patients. Lavender oil has analgesic, antimicrobial, and calming effects. This oil is widely used in patients to reduce anxiety and stress associated with pain caused by analgesics., Method: The present study is a randomized controlled and experimental clinical trial in which patients ( n  = 90) who underwent hemodialysis with AVFs were randomly divided into three groups. The intensity of pain was measured in all patients at three different stages during the insertion of arterial needles for hemodialysis: (1) The topical application of 100% lavender essential oil, (2) the inhaler application of 100% lavender essential oil, and (3) no intervention. The placebo (water) was applied to groups 1 and 2., Results: Our findings revealed that the mean pre-application pain scores in hemodialysis patients were 57.58 ± 20.28 in the working group, 48.53 ± 20.23 in the control group, 19.49 ± 15.66 in the post-application group, and 45.33 ± 25.52 in the control group ( p  < 0.005). The average pain scores after the application of lavender oil were 22.66 ± 15.35 in the inhaler lavender group, 16.33 ± 15.97 in the topical lavender group, and 45.33 ± 25.52 in the control group., Conclusions: After inhaler and topical application of lavender oil, a significant decrease in the severity of pain was recorded for patients at the time of arterial insertion of needles.

Background: A donor milk bank provides an alternative source of human milk for mothers who cannot breastfeed or provide their own milk. Although wet-nursing is a common practice, there is currently no donor milk bank in Turkey., Research Aims: The aims of our study were (1) to determine the knowledge and opinions of Turkish women in regard to donor milk banking; and (2) to raise awareness of donor milk banking., Methods: This was a prospective cross-sectional descriptive study, in which the data were collected with an online survey consisting of 22 questions. The link to the online survey was distributed through the social media accounts of the researchers, with a statement inviting women aged 18-64, who were literate and actively using social media, to participate in the survey. There were 648 female participants., Results: Of those who responded to the questionnaire, 54.1% had not previously given birth, and 54.2% had heard about donor milk banks before. The implementation of donor milk banks in Turkey was desired by 56.4% of the participants, and 50.8% of the participants considered donating their milk. It was determined that the reasons why the women did not want to benefit from donor milk banks were the risk of disease transmission to the baby and the possibility of their child marrying his or her milk sibling in the future., Conclusion: It appears that Turkish women lack information about donor milk banking. We recommend public awareness activities to be organized concerning donor milk banking.

The aim of this research is to investigate death anxiety of the people who live in Turkey and Denmark and have the same cultural background. Cross-cultural studies about death anxiety have been conducted within two different cultures. The goal is to fill the gap in the literature. In this context, participants' self-esteem and personality traits were also investigated. Death Anxiety Scale, Rosenberg Self-Esteem Scale, and The Big Five Inventory were used in this study. Seventy-four people from Turkey and 67 from Denmark participated in this research. According to the results, people who live in Turkey have more death anxiety. There is negative correlation between self-esteem and death anxiety. Neuroticism of the personality traits has positive correlation with death anxiety.

Objective: We investigated the effectiveness of the Rapid Emergency Medicine Score and the Rapid Acute Physiology Score in identifying critical patients among those presenting to the emergency department with COVID-19 symptoms., Material and Methods: This prospective, observational, cohort study included patients with COVID-19 symptoms presenting to the emergency department over a two-month period. Demographics, clinical characteristics, and the data of all-cause mortality within 30 days after admission were noted, and the Rapid Emergency Medicine Score and the Rapid Acute Physiology Score were calculated by the researchers. The receiver operating characteristic curve analysis was performed to determine the discriminative ability of the scores., Results: A total of 555 patients with a mean of age of 49.4 ± 16.8 years were included in the study. The rate of 30-day mortality was 3.9% for the whole study cohort, 7.2% for the patients with a positive rt-PCR test result for SARS-CoV-2, and 1.2% for those with a negative rt-PCR test result for SARS-CoV-2. In the group of patients with COVID-19 symptoms, according to the best Youden's index, the cut-off value for the Rapid Emergency Medicine Score was determined as 3.5 (sensitivity: 81.82%, specificity: 73.08%), and the area under curve (AUC) value was 0.840 (95% confidence interval 0.768-0.913). In the same group, according to the best Youden's index, the cut-off value for the Rapid Acute Physiology Score was 2.5 (sensitivity: 90.9%, specificity: 97.38%), and the AUC value was 0.519 (95% confidence interval 0.393-0.646)., Conclusion: REMS is able to predict patients with COVID-19-like symptoms without positive rt-PCR for SARS-CoV-2 that are at a high-risk of 30-day mortality. Prospective multicenter cohort studies are needed to provide best scoring system for triage in pandemic clinics., Competing Interests: Declaration of Competing Interest We declare no conflict of interest., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Objectives: Our goal was to evaluate the prevalence of and risk factors for pneumothorax in patients with invasive mechanical ventilation in the intensive care unit (ICU) diagnosed with coronavirus disease 2019 pneumonia., Methods: The prevalence of pneumothorax was retrospectively reviewed in 107 patients diagnosed with coronavirus disease 2019 pneumonia and treated in an ICU in Turkey between 11 March 2020 and 30 April 2020., Results: The patients were aged 19-92 years; 37 (34.6%) were women. Pneumothorax developed in 8 (7.5%) of the intubated patients. Four (50%) of the patients with pneumothorax and 68 (68.7%) of those without it died. In the univariable logistic regression analysis of the presence of comorbid diseases (P = 0.91), positive end-expiratory pressure (P = 0.18), compliance (P = 0.93), peak pressure (P = 0.41) and the Horowitz index (P = 0.13) did not show statistically significant effects in increasing the risk of pneumothorax., Conclusions: There was no significant increase or decrease in the risk of pneumothorax in patients treated with invasive mechanical ventilation after the diagnosis of coronavirus disease 2019-related pneumonia/acute respiratory distress syndrome. However, consideration of the risk of pneumothorax in these individuals may have the potential to improve the prognoses in such settings., (© The Author(s) 2020. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.)

Aim: The aim of this study was to evaluate survival rates in elderly individuals who have undergone thoracic trauma and to investigate the risk of mortality for 6 months., Method: In this study, the mortality rate was evaluated in 400 thorax trauma cases referred to thoracic surgery, between 65 and 101 years of age. Six-month survival rates in discharged cases of thoracic trauma were examined by using Turkey's Health Ministry Death Notification System., Results: It was found that thoracic traumas evaluated in the study were due to 314 (78.5%) falls and 51 (12.8%) exterior vehicle traffic accident. It was found that the presence of hemopneumothorax (OR 5.82; 95% CI 1.31-25.98; p = 0.021), and the presence of multiple trauma (OR 16.49; 95% CI 3.13-86.91; p = 0.001) had statistically significant effects on the mortality risk from the moment of the event to the emergency treatment period. In addition, it was found that age (OR 1.06; 95% CI 1.01-1.11; p = 0.011), male gender (OR 2.55; 95% CI 1.15-5.68; p = 0.022), and the presence of comorbidities (OR 3.07; 95% CI 1.29-7.31; p = 0.011) statistically significantly increased mortality during the six months after trauma., Conclusion: It should be kept in mind that the presence of multiple trauma and the presence of hemopneumothorax increase the risk of death in elderly thoracic trauma cases consulted for thoracic surgery.

Background: Mucormycosis is a fatal invasive fungal infection seen most often in patients with compromised defense mechanisms. The aim of this article was to review the data of pediatric mucor in the South of Turkey., Methods: Twenty pediatric cases with biopsy proven mucormycosis were reported, between January 2007 through January 2017. Data were extracted from the medical charts of patients retrospectively., Results: Underlying conditions were hematological malignancy (75%), in whom 93% had acute leukemia, aplastic anemia (15%), diabetes mellitus (5%) and other malignancies (5%). The main sites of infection were sinus (85%); alone (29.4%) or with cerebral (17.6%), and orbital involvement (17.6%). Pulmonary involvement was reported in 11 patients (55%), two of them had the alone form and nine cases were associated with nasal sinus involvement. Disseminated mucormycosis was documented in 45%. Fever and pain/swelling of organs were the most commonly encountered signs and symptoms. Treatment compromised of am-photericin B monotherapy in five patients. All patients except one received liposomal formu-lations (LAmB). A combination of surgery and antifungal therapy was performed in 75%. Crude survival was 55%; among 15 cases treated with a combination of surgery and antifun-gal therapy, survival rate was 8/15 (53%). The overall mortality rate was high in patients diagnosed with disseminated infection (100%)., Conclusions: Mucormycosis in pediatric cases requires a high index of suspicion and urgent evaluation of clinical samples. Surgical debridement should be considered when feasible. Initial medical therapy should include an amphotericin preparation with or step-down to posaconazole.

Aim: The main purpose of this study is to determine the current status of long-term follow-up (LTFU) for childhood cancer survivors and the challenges of LTFU for pediatric cancer survivors at pediatric oncology institutions in Turkey., Material and Methods: A questionnaire was e-mailed to the directors of 33 pediatric oncology centers (POCs) registered in the Turkish Pediatric Oncology Group (TPOG). Of these 33 active TPOG institutions, 21 participated in the study and returned their completed questionnaires., Results: Only 1 of the 21 participating centers had a separate LTFU clinic. The remaining centers provided LTFU care for childhood cancer survivors at the pediatric oncology outpatient clinic. Of these centers, 17 (80.9%) reported difficulty in transition from the pediatric clinic to the adult clinic, 14 (66.6%) reported insufficient care providers, and 12 (57.1%) reported insufficient time and transportation problems. As neglected late effects, 16 (76.1%) centers reported psychosocial and getty job problems and 11 (52.3%) reported sexual and cognitive problems. None of the centers had their own LTFU guidelines for their daily LTFU practice, Conclusion: This study was the first to gain an overview of the needs of POCs and the gaps in survivorship services in Turkey. The results from this study will help to develop a national health care system and national guidelines for pediatric cancer survivors., Competing Interests: The authors have no conflicts of interest or funding to disclose., (This work is licensed under a Creative Commons Attribution 4.0 International License.)

Objective: The purpose of this study was to determine the intestinal parasite distributions in patients who applied to the Parasitology Laboratory of Istanbul University-Cerrahpaşa, Cerrahpaşa Medical Faculty, by evaluating the parasites retrospectively., Methods: Normal saline and stool lugol were applied for direct examination of stool samples that were sent for parasite examination; cellophane band samples were evaluated microscopically. The samples suspected to have protozoa were evaluated using modified acid fast and trichrome staining methods. We evaluated the parasitological examination results of patients who applied to our laboratory between January 2012 and December 2018., Results: A total of 2.96% of the 20,948 patients who applied had parasites in their faeces. Blastocystis spp. was detected at the highest rate (63.23%), followed by Giardia intestinalis (17.26%), Enterobius vermicularis (12.58%), Taenia saginata (2.42%), Cryptosporidium spp. (1.94%) and Entamoeba histolytica/dispar (1.45%)., Conclusion: Although the prevalence of intestinal parasitic infections has decreased when compared to previous years, it still remains important. For this reason, solving infrastructure problems, providing information on personal hygiene and sanitation rules are among the most important tasks needed to reduce the prevalence of intestinal parasites.

Objectives: Our study aimed to assess the variation in serum C-reactive protein/albumin ratio (CAR), a biomarker of peripheral inflammation and oxidative stress, in patients with restless legs syndrome (RLS)., Methods: The study included a total of 380 individuals including 197 with RLS diagnosis. RLS diagnosis was determined according to the "International Restless Legs Syndrome Study Group" questionnaire. Disease severity was assessed according to the "International Restless Legs Syndrome Study Group Severity Scale''., Results: The mean age of patients with restless legs syndrome was 52.5 ± 12.7 years, while the mean age in the control group was 50.8 ± 11.2, with no statistically significant difference found (p = 0.156). The hemoglobin, iron and ferritin levels in the patient group were lower than in the control group (p < 0.001; p < 0.01; p < 0.001), with total iron binding capacity levels higher than the control group (p < 0.001). The mean ferritin in the RLS group (49.8 ± 51.2) was lower than the control group (76.9 ± 44.7). In patients, the c-reactive protein, albumin and c-reactive protein/albumin ratio were found to be 0.21 ± 0.18, 4.43 ± 0.31 and 0.07 ± 0.05, respectively. When compared with the control group, the patient group had high c-reactive protein (CRP), CAR and low albumin levels (p < 0.001). Among patients with "very severe" disease severity, ferritin levels were found to be lower than those with "moderate" disease severity. Additionally, patients with "very severe" disease had albumin levels which were significantly low compared to those with "mild" disease severity (p < 0.05)., Conclusion: Our study supports the hypothesis that serum albumin level, ferritin, CRP, and CAR may be associated with restless legs syndrome., (Copyright © 2019 Elsevier B.V. All rights reserved.)

Objective: To evaluate the agreement between integrated management of childhood illness (IMCI) and final diagnosis in patients presenting with cough at the second and third level health institutions., Methods: This cross-sectional study included 373 children aged 2-60 mo who presented with cough at the pediatric emergency and outpatient clinics in the Department of Pediatrics. After clinical examination of children, body temperature, respiratory rate, saturation, presence or absence of the chest indrawing, rales, wheezing and laryngeal stridor were recorded. Cases were categorized according to IMCI algorithm regarding the severity using the color code, such as red (urgent treatment), yellow (treatment in the hospital), or green (treatment at home). Final diagnosis after physical examination, laboratory analysis and chest X-ray was compared with the IMCI algorithm., Results: Study agreement between IMCI classification and final diagnosis was 74.3% with kappa value 0.55 (moderate agreement). Similar agreement values were detected in both the second and third level health institutions. Health condition and gender did not affect agreement value. Agreement were found to be high in patients <24 mo of age (ĸ = 0.67), presence of fever and cough (ĸ = 0.54), tachypnea (ĸ = 0.93), chest indrawing (ĸ = 1.00) and oxygen saturation of <94%(ĸ = 0.90)., Conclusions: Adding saturation level to the IMCI algorithmic diagnosis may increase agreement between IMCI classification and final diagnosis.

Purpose: The first disease-specific quality-of-life questionnaire in patients with drug hypersensitivity, Drug Hypersensitivity Quality of Life Questionnaire (DrHy-Q), was developed and validated recently. The aim of this study was to assess validity, reliability and responsiveness to interventions of the Turkish version of the DrHy-Q., Methods: The Turkish version of the DrHy-Q was administered to prospectively enrolled 736 patients with drug hypersensitivity from ten allergy units. To assess validity, all patients completed the validated Turkish version of Psychological General Well-Being Index (PGWBI). For test-retest reliability, 182 patients completed the DrHy-Q 1 week after the first questionnaire administration without any intervention. Responsiveness was assessed on 97 patients who had a DrHy-Q recorded at a follow-up visit after the intervention., Results: The internal consistency and test-retest reliability of the scale were adequate (Cronbach's alpha = 0.934, intra-class correlation coefficient = 0.783). The DrHy-Q scores showed weak negative correlations with the PGWBI total and domain scores (r = - 0.378 to -0.254, p < 0.001). DrHy-Q was able to discriminate the patients with one drug hypersensitivity reaction from the patients with two and above two reactions (p = 0.012 and p < 0.001, respectively), and the patients who experienced a respiratory reaction from the patients who did not (p = 0.018). However, it did not discriminate the patients with comorbid disease including psychiatric comorbidity (p > 0.05). The baseline DrHy-Q scores were significantly higher than the post-intervention scores (p = 0.008)., Conclusion: The Turkish version of DrHy-Q is reliable and valid for evaluating quality of life in patients with drug hypersensitivity, and it appeared responsive to interventions.

Background: No data are available on the incidence of drug hypersensitivity (DH) reactions in outpatient settings of tertiary allergy/immunology clinics. Our aims were to document the frequency of outpatient hospital admissions due to DH reactions to allergy/immunology clinics in adults and the management of these reactions in real life. We also investigated whether drug allergy affected social and medical behaviours of the patients., Methods: This multi-centre study was performed for one year with the participation of 11 out of 16 tertiary allergy/clinical immunology clinics in Turkey. The study group consisted of the patients with DH reactions. Results of a questionnaire including drug reactions and management were recorded., Results: Among 54,863 patients, 1000 patients with DH were enrolled with a median of 2.1% of all admissions. In real life conditions, the majority of approaches were performed for finding safe alternatives (65.5%; 1102 out of 1683) with 11.7% positivity. Diagnostic procedures were positive in 27% (154/581) of the patients. The majority of the patients had higher VAS scores for anxiety. A total of 250 subjects (25%) reported that they delayed some medical procedures because of DH., Conclusion: Our results documented the frequency of admissions due to DH reactions to allergy/clinical immunology clinics for the first time. Although physicians mostly preferred to perform drug tests in order to find safe alternatives, considering the fact that DH was confirmed in 27% of the patients, use of diagnostic tests should be encouraged, if no contraindication exists in order to avoid mislabelling patients as DH., (Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.)

Despite many researches that have examined life attitude profile, treatment decision evaluation, and symptoms experienced in cancer populations, the relationships between life attitude profile and symptoms experienced with treatment decision evaluation are still not well understood. A thorough understanding of these relationships is critical for health care professionals to provide appropriate management to patients. The aim of this study was to determine relationships among life attitude profile, the treatment decision evaluation, and symptoms experienced in Turkish patients with cancer. A convenience sample of 199 patients with cancer at a Turkish university hospital completed a structured questionnaire including demographic characteristics and the Life Attitude Profile-Revised Scale for patients with cancer in 2007. The researchers visited the oncology clinic 5 work days every week and conducted interviews with the patients. The life attitude profile was not correlated with the treatment decision evaluation and symptoms experienced (r = 0.082, r = -026). The treatment decision evaluation showed that the patients were uncertain about their satisfaction with the treatment decision. Significant correlations were found between the treatment decision evaluation and symptoms experienced (r = 0.206; P <.01). Holistic nursing interventions can be implemented as they promote healing of the whole person processes as facilitating self-awareness, living meaningfully, and promotion connection with others and with nature and a higher power.

Omalizumab is a biologic agent, which has been shown to be effective in clinical trials in allergic, severe asthmatics. The aim of this study was to evaluate the clinical, functional effectiveness, and side effects of omalizumab in real-life conditions respectively. A total of 18 patients (female/male: 11/7) were included to the study. The mean ± SD age, total IgE, disease duration were 41.8 ± 11.2 years, 255.1 ± 197.3 kU/L, 12.8 ± 9.4 years, respectively. Eight patients had isolated mite, seven patients had mite + other inhalant allergen, three patients had only other allergen sensitivity. Mean duration of omalizumab treatment (months ± SD) was 15.1 ± 8.6 (min-max 1-29) months. Omalizumab dose was 150 mg/month in five patients, 300 mg/month in five, 300 mg/15 days in three, 375 mg/15 days in four, 225 mg/15 days in one patient. Data at the date of last visit were compared with one year prior to omalizumab treatment. Mean systemic steroid dose reduced by 83% (14.7 ± 14.6 vs. 3.2 ± 8 mg), number of other asthma medications reduced by 28% (3.6 ± 1.3 vs. 2.5 ± 1.3) (p< 0.05). FEV1% values (53.5 ± 21.2 vs. 64.5 ± 23.5) did not significantly change. Mean numbers of exacerbations (20 ± 57.6 vs. 0.4 ± 0.7), emergency visits (16.5 ± 46.1 vs. 0.4 ± 1.2), hospitalizations (2.1 ± 2.6 vs. 0.1 ± 0.3) decreased by 93%, 95%, 86%, respectively (p< 0.05). ACT scores increased by 94% (10.4 ± 3.4 vs. 20.4 ± 5.7) (p< 0.05). Fifteen patients (88%) were stated as responsive to treatment with omalizumab. Eleven patients (64.8%) stated that their expectations are met, three patients (17.6%) stated that their expectations are close to being met, three patients (17.6%) stated that their expectations are not met. A local side effect was seen in one patient. In conclusion, our data has shown that omalizumab is effective, and safe in severe allergic asthmatics under real-life conditions.