Search

We aimed to screen for Pompe disease in patients with unclassified limb-girdle muscular dystrophy (LGMD) or asymptomatic hyperCKemia using dried blood spot (DBS) assays. Subsequently, we aimed to calculate the diagnostic delay between initial symptom presentation and the diagnosis. A prospective, multicenter, observational study was conducted in 348 patients: 146 with unclassified LGMD and 202 with asymptomatic or paucisymptomatic hyperCKemia. We quantified levels of acid alpha-glucosidase (GAA) from dried blood spots analyzed fluorometrically. The test was positive in 20 patients, and Pompe disease was confirmed by genetic testing in 16. Undiagnosed Pompe disease was detected in 7.5% of patients with LGMD and in 2.5% of patients with persistent, idiopathic elevation of serum creatine kinase. The c.-32-13 T > G mutation was found most commonly. The diagnostic delay was 15 years on average. In conclusion, DBS tests are useful and reliable screening tools for Pompe disease. We recommend the dried blood spot test to be included in the diagnostic work-up of patients with unclassified myopathies with proximal weakness and/or hyperCKemia of unknown cause and, when positive, to define the diagnosis, it will have to be confirmed by biochemical and/or molecular genetic analysis. [ABSTRACT FROM AUTHOR]

Pregnancy requires a high demand of energy, which leads to an increase of oxidative stress. The aim of this study was to assess the oxidative status in 200 couples of pregnant women-newborns at the time of delivery, for the first time, who gave birth in two University Hospitals from the province of Seville. Recruited women filled an epidemiological questionnaire with their demographic characteristics and dietary habits during pregnancy. At the time of delivery, both maternal and cord blood samples were collected. Protein oxidation, superoxide dismutase, and catalase levels were measured to assess the oxidative status of these women, together with the levels of vitamins D, B12, Zn, Se, and Cu. Our results showed a tendency for all biomarkers measured to be higher in cord blood than in maternal blood. For the correlations established between the OS markers and sociodemographic characteristics, only significant differences for carbonyl groups values were found on both maternal and cord blood, relating these higher values to the use of insecticides in the women's homes. For newborns, only a significant correlation was detected between antioxidant enzymes and the newborn's weight, specifically for superoxide dismutase activity. Additionally, the higher values obtained in cord blood might suggest metabolization, while a higher production of ROS and antioxidant enzymes might be required to maintain the balance. Measured levels for Se were similar in both maternal and cord blood, unlike Cu and Zn, where higher levels were found for maternal blood than cord blood, indicating a correlation between maternal Se values and SOD as OS biomarker. Furthermore, vitamin D levels were around the optimum values established, finding a relationship between vitamin D and new-born's height, unlike for vitamin B12 values, where a correlation with maternal food consumption characteristics was established. Overall values were inside normal ranges and consistent for our population., Competing Interests: Declaration of competing interest The authors declare no conflict of interest., (Copyright © 2023 The Authors. Published by Elsevier Inc. All rights reserved.)

Nowadays there is an increasing concern about exposition during prenatal stage to environmental pollutants such as metals, that make pregnant women a vulnerable group of population. Numerous studies have shown associations between the prenatal exposition to some metals and an impact on cognitive, motor and intellectual development of the child. Metals and metalloid are ubiquitous in the environment and pregnant women are exposed to them though their diet, lifestyle factors or occupational and environmental sources. One hundred of maternal and one hundred of cord blood samples were obtained at delivery from pregnant women after signing of the informed consent to determine simultaneously levels of Al, As, Cd, Cr, Cu, Hg, Mn, Ni, Pb, Se and Zn by ICP-MS. Among these metals, essential ones (Cu, Mn, Se and Zn) can have health beneficial effects at low levels, however, in high concentration are potentially toxic. On the other hand, elements such as Al, As, Cd, Hg, Pb are classified as toxic metals, no matter what its concentration was. The aim of this study was to find the potential relationships between these metals and metalloid levels, newborn's parameters, pregnancy details and the epidemiologic information obtained using a questionnaire data from the participant pregnant women from Seville (Spain). A n = 100 of participants have been enrolled, 15.6 % of the women from Virgen del Rocio Hospital were smokers during pregnancy but only 11.1 % from Virgen de Valme had the habit. Dietary habits of all participants from both hospital were quite similar in average rice, fish and canned food consumption. The characteristics of newborns were also quite similar for both hospitals. A positive correlation between maternal and cord blood was found between all metals except for Cr and Cu. The strongest correlation was found for Hg (r = 0.779, p < 0.005). Positive but weaker correlations between maternal blood and lifestyle habits were also established., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 The Authors. Published by Elsevier B.V. All rights reserved.)

Oxidative status has been proposed as an important ecological and evolutionary force given that pro-oxidant metabolites damage molecules, cells and tissues, with fitness consequences for organisms. Consequently, organisms usually face a trade-off between regulating their oxidative status and other physiological traits. However, environmental stressors and the availability of dietary-derived antioxidants vary according to local conditions and, thus, organisms inhabiting different habitats face different oxidative pressures. Still, there is little information on how different environmental conditions influence the oxidative status of animals inhabiting terrestrial environments. In this work, we examined the variation in oxidative status in the blue tit (Cyanistes caeruleus), a bird species with hatching asynchrony. Specifically, we examined the oxidative status of the largest and the smallest nestlings in the brood, inhabiting four forests differing in food availability and ectoparasite prevalence. We measured lipid peroxidation (malondialdehyde; MDA) as a marker of oxidative damage, total antioxidant capacity (Trolox-equivalent antioxidant capacity; TEAC) and antioxidant enzymatic activity (catalase, glutathione S-transferase, glutathione peroxidase) in blood samples. The glutathione peroxidase (GPX) activity differed among the forests, being the highest in the pine forest and the lowest in a mixed oak (Quercus) forest in the most humid area. Lipid peroxidation was higher in larger nestlings, suggesting higher oxidative damage with an increasing growth rate. Neither brood size, laying date, nor ectoparasites were related to the oxidative status of nestlings. These results suggest that nest rearing conditions might shape the oxidative status of birds, having consequences for habitat-dependent variation in regulation of oxidative status., (Copyright © 2021 Elsevier Inc. All rights reserved.)

Background: Worldwide, type 2 diabetes mellitus (T2DM) is one of the most prevalent chronic diseases and one of those producing greatest impact on patients' day-to-day quality of life. Our study aim is to validate the "Living with Chronic Illness Scale" for a Spanish-speaking T2DM population., Methods: In this observational, international, cross-sectional study, 582 persons with T2DM were recruited in primary care and outpatient hospital consultations, in Spain and Colombia, during the period from May 2018 to June 2019. The properties analysed were feasibility/acceptability, internal consistency, reliability, precision and (structural) content-construct validity including confirmatory factor analysis. The COSMIN checklist was used to assess the methodological/psychometric quality of the instrument., Results: The scale had an adequate internal consistency and test retest reliability (Cronbach's alpha = 0.90; intraclass correlation coefficient = 0.96, respectively). In addition, the instrument is precise (standard error of measurement = 3.34, with values < ½SD = 8.52) and correlates positively with social support (DUFSS) (r s  = 0.56), quality of life (WHOQOL-BREF) (r s  = 0.51-0.30) and ssatisfaction with life (SLS-6) (r s  = 0.50-0.38). The original 26-items version of the scale did not support totally the confirmatory factor analysis. The COSMIN checklist is favourable for all the properties analysed, although weaknesses are detected for structural validity., Conclusions: The LW-CI-T2DM is a valid, reliable and accurate instrument for use in clinical practice to determine how a person's life is affected by the presence of diabetes. This instrument correlates well with the associated constructs of social support, quality of life and satisfaction. Additional research is needed to determine how well the questionnaire structure performs when robust factor analysis methods are applied.

Purpose: biosimilar infliximab (CTP-13) has been recently approved for the treatment of several immune-mediated inflammatory disorders, including inflammatory bowel disease (IBD). Comparative studies between this biosimilar and original infliximab in the real clinical practice are scarce. The objective of this study was to compare short and long-term safety and efficacy of original (O) and biosimilar infliximab (B-IFX) in biologic-naïve, IBD patients in the real life clinical practice., Methods: a retrospective, multicentric study was performed in five Spanish hospitals. Consecutive IBD, biologic-naïve patients from an historic cohort who initiated O-IFX from January 2013 were compared with biologic-naïve patients, who started treatment with B-IFX since its approval in January 2015. The evaluation of efficacy was assessed after the induction phase, at week 14 and week 54 of treatment. Time to dose escalation or treatment persistence of both O-IFX and B-IFX was also considered. The appearance of serious adverse events was recorded., Results: two hundred and thirty-nine IBD biologic-naïve patients who started with O-IFX or B-IFX were included: 153 patients were diagnosed with Crohn's disease (95 treated with O- and 58 treated with B-IFX) and 86 with ulcerative colitis (40 received O- and 46 received B-IFX). At weeks 14 and 54, both O-IFX and B-IFX groups reached a similar clinical response and remission rates. Time to dose escalation, treatment persistence and safety profile were comparable between both groups., Conclusions: this long-term real-life experience provides additional evidence of the similarity of O- and B-IFX CTP-13 in terms of efficacy and safety in IBD patients.

Aim: To measure the Effectiveness of a Diabetes Education Program for people with T2DM, based on Tailored interventions and the Theory of Planned Behaviour., Design: Cluster randomized controlled clinical trial., Methods: This multicentre study will be carried out at 30 primary healthcare centres, where 436 persons with Type 2 Diabetes Mellitus (T2DM), aged between 18-75 years, will be recruited. The experimental educational program to be applied is modelled using components obtained from a systematic review and prior qualitative analysis. In addition, a taxonomy of nursing practice is used to standardize the program, based on the Theory of Planned Behaviour as a conceptual model. The intervention will be carried out by community nurses, using ADAPP-Ti ® , an application developed with FileMaker Pro v.18. The control group will receive usual care and data will be collected at 6, 12, and 18 months, for both groups. The primary outcome considered will be glycosylated haemoglobin and cardiovascular factors, while the secondary ones will be tobacco consumption, body mass index, barriers to self-care, health-related quality of life, and lifestyle modification. The protocol was approved by the Ethics Committee of the Province of Malaga (Spain) in November 2014., Discussion: The degree of metabolic control in T2DM is not always associated with healthy lifestyles and significant levels of medication are often prescribed to achieve clinical objectives. An intervention focused on needs, based on the best available evidence and a solid conceptual framework, might successfully consolidate appropriate self-care behaviour in this population., Impact: The study will result in the publication of an educational program featuring well-defined interventions and activities that will enable clinicians to tailor health care to the individual's needs and to combat treatment inertia in attending this population., (© 2020 John Wiley & Sons Ltd.)

Parasitoid wasps may act as hyperparasites and sometimes regulate the populations of their hosts by a top-down dynamic. Nasonia vitripennis (Walker, 1836) is a generalist gregarious parasitoid that parasitizes several host flies, including the blowfly Protocalliphora Hough, 1899 (Diptera, Calliphoridae), which in turn parasitizes bird nestlings. Nonetheless, the ecological factors underlying N. vitripennis prevalence and parasitoidism intensity on its hosts in natural populations are poorly understood. We have studied the prevalence of N. vitripennis in Protocalliphora azurea (Fallén, 1817) puparia parasitizing wild populations of pied flycatcher (Ficedula hypoleuca) and blue tit (Cyanistes caeruleus) birds in two Mediterranean areas in central and southern Spain. We found some evidence that the prevalence of N. vitripennis was higher in moist habitats in southern Spain. A host-dependent effect was found, since the greater the number of P. azurea puparia, the greater the probability and rate of parasitoidism by the wasp. Our results also suggest that N. vitripennis parasitizes more P. azurea puparia in blue tit nests than in pied flycatcher nests as a consequence of a higher load of these flies in the former. Based on the high prevalence of N. vitripennis in P. azurea puparia in nature, we propose that this wasp may regulate blowfly populations, with possible positive effects on the reproduction of both bird species.

Background: Several instruments are available to evaluate barriers to self-care in people with type 2 diabetes, but with significant psychometric weaknesses and poor theoretical background., Objectives: To develop and psychometrically validate a questionnaire to identify barriers to self-care in this population on the basis of the theory of planned behavior., Methods: The study was carried out in 15 primary healthcare centers belonging to the Public Health Care System in Andalusia (Spain). After content validity was confirmed, an initial pilot study was undertaken (n = 54) and the model was evaluated in 2 samples of 205 subjects each to test its configural and metric invariance by confirmatory factor analysis. Internal consistency, test-retest reliability, criterion validity, and interpretability were carried out following COSMIN standards., Results: A 4-factor instrument (intention, subjective norms, perceived control, and attitudes) with 15 items was obtained with a good fit: goodness-of-fit index = 0.92, comparative fit index = 0.93, and root mean square error of approximation = 0.043 (90% confidence interval 0.034-0.052). Cronbach α was 0.78, and test-retest reliability was adequate (intraclass correlation coefficient 0.73; P < .0001). The instrument revealed an adequate criterion validity depending on the treatment complexity and level of metabolic control. Thus, participants with poor self-care scores were more likely to suffer from diabetes-related complications (odds ratio 1.91; 95% confidence interval 1.15-3.1)., Conclusions: A theory-driven instrument is suitable for its use with Spanish people with type 2 diabetes to assess their self-care needs and make tailored recommendations for lifestyle modifications on the basis of their behavioral determinants., (Copyright © 2019 ISPOR–The Professional Society for Health Economics and Outcomes Research. Published by Elsevier Inc. All rights reserved.)

Purpose: To quantify the impact of training-intensity distribution on 10K performance in recreational athletes., Methods: 30 endurance runners were randomly assigned to a training program emphasizing low-intensity, sub-ventilatory-threshold (VT), polarized endurance-training distribution (PET) or a moderately high-intensity (between-thresholds) endurance-training program (BThET). Before the study, the subjects performed a maximal exercise test to determine VT and respiratory-compensation threshold (RCT), which allowed training to be controlled based on heart rate during each training session over the 10-wk intervention period. Subjects performed a 10-km race on the same course before and after the intervention period. Training was quantified based on the cumulative time spent in 3 intensity zones: zone 1 (low intensity, RCT). The contribution of total training time in each zone was controlled to have more low-intensity training in PET (±77/3/20), whereas for BThET the distribution was higher in zone 2 and lower in zone 1 (±46/35/19)., Results: Both groups significantly improved their 10K time (39min18s ± 4min54s vs 37min19s ± 4min42s, P < .0001 for PET; 39min24s ± 3min54s vs 38min0s ± 4min24s, P < .001 for BThET). Improvements were 5.0% vs 3.6%, ~41 s difference at post-training-intervention. This difference was not significant. However, a subset analysis comparing the 12 runners who actually performed the most PET (n = 6) and BThET (n = 16) distributions showed greater improvement in PET by 1.29 standardized Cohen effect-size units (90% CI 0.31-2.27, P = .038)., Conclusions: Polarized training can stimulate greater training effects than between-thresholds training in recreational runners.

1. A long-standing question in ecology is how natural populations respond to a changing environment. Emergent optimal foraging theory-based models for individual variation go beyond the population level and predict how its individuals would respond to disturbances that produce changes in resource availability. 2. Evaluating variations in resource use patterns at the intrapopulation level in wild populations under changing environmental conditions would allow to further advance in the research on foraging ecology and evolution by gaining a better idea of the underlying mechanisms explaining trophic diversity. 3. In this study, we use a large spatio-temporal scale data set (western continental Europe, 1968-2006) on the diet of Bonelli's Eagle Aquila fasciata breeding pairs to analyse the predator trophic responses at the intrapopulation level to a prey population crash. In particular, we borrow metrics from studies on network structure and intrapopulation variation to understand how an emerging infectious disease [the rabbit haemorrhagic disease (RHD)] that caused the density of the eagle's primary prey (rabbit Oryctolagus cuniculus) to dramatically drop across Europe impacted on resource use patterns of this endangered raptor. 4. Following the major RHD outbreak, substantial changes in Bonelli's Eagle's diet diversity and organisation patterns at the intrapopulation level took place. Dietary variation among breeding pairs was larger after than before the outbreak. Before RHD, there were no clusters of pairs with similar diets, but significant clustering emerged after RHD. Moreover, diets at the pair level presented a nested pattern before RHD, but not after. 5. Here, we reveal how intrapopulation patterns of resource use can quantitatively and qualitatively vary, given drastic changes in resource availability. 6. For the first time, we show that a pathogen of a prey species can indirectly impact the intrapopulation patterns of resource use of an endangered predator., (© 2012 The Authors. Journal of Animal Ecology © 2012 British Ecological Society.)

Background: Hereditary red cell disorders are associated with a protective effect against malaria, which results in an increased prevalence in malaria-endemic areas. Migratory flows from these areas are resulting in a marked increase in such abnormalities in Southern Spain., Methods: All hemoglobin disorders diagnosed between 1997 and 2010 have been recorded. Since 2008, we have performed systematic screening for hemoglobinopathies on African patients. A high-pressure liquid chromatography system was used as screening method for structural hemoglobinopathies and for separation of hemoglobin (Hb) F and A(2)., Results: We detected 666 cases in patients of foreign origin and 308 in native Spanish patients. Thalassemias (thal) are the most frequent disorders amongst the local population: β-thal minor, 57.1% (176/308); α-thal, 18.2% (56/308), and δβ-thal, 7.8% (24/308). In ethnic minorities, there is a huge variety of hemoglobinopathies: heterozygous Hb S, 45% (300/666); heterozygous Hb C, 15% (100/666); β-thal minor, 13.7% (91/666); α-thal, 10.2% (68/666); Hb SS in 14 patients, and Hb CC in 9 patients. Of the native patients, 14 were found to have Hb AS and 9 Hb AC., Conclusion: Given the modern migratory flows, greater knowledge of these disorders is needed by all medical staff, and new practical and cost/time-effective diagnostic approaches have to be devised., (Copyright © 2011 S. Karger AG, Basel.)

Objective: The objective of the study is to evaluate the ability of standard vancomycin dosing strategies actually recommended to attain the pharmacodynamic target of an area under the curve of vancomycin serum concentration versus time from 0 to 24 hours (AUC(24h)) to minimum inhibitory concentration (MIC) ratio greater than 400:1 for patients with a suspected or documented methicillin-resistant Staphylococcus aureus (MRSA) bacteraemia by individual analysis and Monte Carlo simulation., Material and Methods: The study included all patients admitted with suspected or proven MRSA infection during the years 2007-2008, and who were initially treated with vancomycin at a dose of 30 mg/kg/ day, and underwent pharmacokinetic monitoring. The area under the curve of vancomycin serum concentration versus time from 0 to 24 hours (AUC(24h)) was calculated as daily dose/ clearance total (D(24h)/CL). Additionally, we studied 45 isolates of MRSA obtained from blood cultures in the period 2007-2008. The MIC to vancomycin was determined using Epsilon-test®. The PK-PD parameter calculated was AUC(24h)/MIC. Microsoft Excel was used to perform a 10.000 subject Monte Carlo simulation. An AUC(24h)/MIC > or =400 was assumed as the target attainment., Results: In the individual study, the percentage of patients with AUC(24h)/ MIC(50/90) > or = 400 was 50%. The probability (%) of attaining AUC(24h)/MIC ratio values > or = 400 by Monte Carlo simulation was of 66%. The vancomycin MIC value from which the scenario would have to wait a suboptimal treatment (target < 90%) was >1 mg/ L., Discussion: This study shows that in the population studied to achieve a vancomycin AUC(24h)/MIC > or =400 is not always attained with the standard dose. Therefore, one would expect a high probability of suboptimal vancomycin AUC(24h)/MIC ratios for patients infected with organisms with vancomycin MICs of >1 mg/ L treated with doses of 30 mg/ kg/ day.

Background: Both dominant and recessive mutations were reported in the gene encoding the mitochondrial (mt) DNA polymerase gamma (POLG) in patients with progressive external ophthalmoplegia (PEO). Phenotypes other than PEO were recently documented in patients with mutations in the POLG gene., Objective: To screen patients with mitochondrial disease and multiple mtDNA deletions in muscle for mutations in the coding regions of the POLG, PEO1, and SLC25A4 genes., Design: To identify the underlying molecular defect in a group of patients with multiple mtDNA deletions comparing their molecular genetic findings with those of healthy controls., Patients: Twenty-four patients (16 men and 8 women) diagnosed with mitochondrial disease and having multiple mtDNA deletions in muscle by Southern blot analysis. Thirteen patients had PEO; 2 had PEO alone, 4 had PEO and myopathy, and 5 had PEO and multisystem involvement. Four patients had multisystem disease without PEO. The remaining 9 patients had isolated myopathy. DNA from 100 healthy individuals was also studied., Results: No mutation was identified in the PEO1 or SLC25A4 genes. Nine POLG mutations were observed in 6 of 24 patients. Four novel mutations were detected and mapped in the linker region (M603L) and in the pol domain of the enzyme (R853W; D1184N; R1146C). Five patients with PEO had mutations: 2 were compound heterozygotes, 1 was homozygous, and another showed a mutation in a single allele. The remaining patient also showed a sole mutation and had an unusual phenotype lacking ocular involvement., Conclusions: POLG molecular defects were found in 25% of our patients with multiple mtDNA deletions and mitochondrial disease. The uncommon phenotype found in 1 of these patients stresses the clinical variability of patients harboring POLG mutations. Molecular studies in the POLG gene should be addressed in patients with mitochondrial disease, particularly in those with PEO, and multiple mtDNA deletions.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460&#95;1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

The biogeographical distribution of brown trout mitochondrial DNA haplotypes throughout the Iberian Peninsula was established by polymerase chain reaction-restriction fragment polymorphism analysis. The study of 507 specimens from 58 localities representing eight widely separated Atlantic-slope (north and west Iberian coasts) and six Mediterranean drainage systems served to identify five main groups of mitochondrial haplotypes: (i) haplotypes corresponding to non-native, hatchery-reared brown trout that were widely distributed but also found in wild populations of northern Spain (Cantabrian slope); (ii) a widespread Atlantic haplotype group; (iii) a haplotype restricted to the Duero Basin; (iv) a haplotype shown by southern Iberian populations; and (v) a Mediterranean haplotype. The Iberian distribution of these haplotypes reflects both the current fishery management policy of introducing non-native brown trout, and Messinian palaeobiogeography. Our findings complement and extend previous allozyme studies on Iberian brown trout and improve present knowledge of glacial refugia and postglacial movement of brown trout lineages.

Objective: To determine functional social support in patients included in programme of care for chronic patients confined to their homes, and to compare rural area with urban area., Design: Descriptive and crossover study., Setting: Urban and rural health centres., Patients: 103 patients were interviewed in their homes (41 of them were in a rural area and 62 in a urban area). All patients were included in programme of care for chronic patients confined to their homes. Patients with neurological o psychiatric disorders who were not able to answer coherently were excluded., Measurements and Main Results: We used the DUKE-UNC questionnaire which measured the functional social support in two sub-scales: confidential support and affective support. We didn't find any relation between the functional social support and age, sex, civil condition or health problems. Patients of the rural area perceive less confidential support than patients of the urban area. We didn't find any difference in the perception of the affective support between both areas., Conclusions: In the rural area, the patients included in the programme of care for chronic patients confined to their homes perceive less possibility to communicate problems, important events or conflictive situations that require comprehension and help.

One of the few cases of thyrotoxic periodic paralysis in our country is reported. A twenty-one year old male patient with Graves disease for more than three years had a poor compliance with the therapeutical regimen, with mainly nightly episodes of self-limited limb weakness associated with hypokalemia. The patient has no familiar antecedents of periodic paralysis and the clinical manifestations resolved with treatment of hyperthyroidism.

A method for direct detection of the porcine reproductive and respiratory syndrome (PRRS) virus was developed, based on reverse transcription of the viral RNA coupled to DNA amplification by polymerase chain reaction. A set of primers was designed from Lelystad virus sequence within ORF 7 encoding nucleocapsid protein. From seven Spanish field isolated strains the 312 bp amplified fragment was cloned and sequenced. Alignment with Lelystad virus sequence revealed a 96-97% homology. A maximum sensitivity of 6.7 TCID50 was achieved with the reported procedure in experimentally infected swine alveolar macrophages cultures. The sensitivity obtained in crude clinical samples from experimentally infected 3-weeks old pigs was approximately 10(2) TCID50. High specificity for the PRRS virus was demonstrated for the method, as none of the seven common swine virus assayed rendered DNA amplification product.