Search

BACKGROUND: Currently, organic farming has become a feasible approach for the production of high‐quality fruits. To evaluate the response of fruit quality and mineral nutrition contents of Hayward Kiwifruit affected by different organic and inorganic fertilizers, the present study was conducted in Citrus and Subtropical Fruits Research Center, Iran, in 2017–2021, as a randomized block design with three replications. The studied treatments were organic fertilizers (cow, vermicompost and Azolla) and chemical fertilizers. After 4 years of fertilization, the fruit's nutritional elements content and some fruit bioactive compounds were evaluated after 3 months of cold storage and then analyzed by the principal component analysis (PCA) method. RESULTS: The use of organic amendments boosted the calcium, phosphorus, potassium and iron content of the kiwifruits compared to chemical fertilizers. The highest fruit potassium and phosphorus content were recorded in the cow manure treatment. The lowest amount of nitrate and the highest calcium, zinc, copper and manganese accumulation were recorded in the fruits treated with vermicompost. In addition to mineral nutrients, the dry matter, total soluble solids, total phenolic and antioxidant capacity of kiwifruit were improved by the application of vermicompost amendment compared to the other fertilizer sources. However, the highest fruit vitamin C and total soluble carbohydrates were measured in the cow manure treatment. The PCA results of the fruit quality indices indicated that fertilization treatments were ranked as vermicompost (1.88) > cow manure (1.63) = chemical (1.60) > Azolla (1.54). CONCLUSION: It is concluded that the application of 40 kg of vermicompost or 40 kg of cow manure in the next rank in Hayward kiwifruit orchards in March (growth stage beginning of bud swelling) may be a more suitable approach for improving the nutritional quality of the fruit. © 2024 Society of Chemical Industry. [ABSTRACT FROM AUTHOR]

Entomopathogenic fungi play a significant role in regulating insect populations in nature and have potential applications in pest management strategies in different regions. Citrus spp. are among the important horticultural products in northern Iran, and the orchards are affected by different insect pests, especially mealybugs. This study aimed to isolate and identify entomopathogenic fungi associated with citrus orchard pests in northern Iran, focusing on Akanthomyces and Lecanicillium species on mealybugs. Through the samples collected from different regions within Guilan province, 12 fungal isolates were collected and identified based on the combination of morphological characteristics and molecular data. Akanthomyces lecanii, A. muscarius, Engyodontium rectidentatum, Lecanicillium aphanocladii and Lecanicillium rasoulzarei sp. nov. were identified. Of these, A. muscarius on Lepidosaphes sp., E. rectidentatum on Coccidae, and L. aphanocladii on Tetranychus urticae are reported as new fungal-host records from Iran. Moreover, a new species, Lecanicillium rasoulzarei, is illustrated, described, and compared with closely related species. [ABSTRACT FROM AUTHOR]

Citrus is one of the most important fruits whose growth performance and production is significantly affected by environmental stresses. Abiotic stresses, such as salinity and alkaline pH, strikingly limit citrus growth and development. The aim of the present study was to investigate the effect of four NaCl concentrations (0, 30, 60, 90 mM) and two pH levels (6.5 and 8.2) on some of morphological, physiological, and biochemical parameters of two citrus rootstocks (Sour orange and Bakraei rootstocks). The experiment was conducted as factorial based on a completely randomized design with four replications, at the Faculty of Agriculture, Shahid Chamran University of Ahvaz, Iran. The results showed that the value of shoot dry weight, fresh and dry weight of roots, and transpiration were significantly decreased in both Bakraei and Sour orange rootstocks when receiving irrigation with 90 mM supplement of salinity at pH= 8.2. Proline and carbohydrates of citrus rootstocks were considerably increased by increasing the levels of salinity (90 mM NaCl) and alkaline stress (pH= 8.2) in each rootstock, at which condition the photosynthesis rate of Sour orange and Bakraei also declined by 34.77 and 50.80%, respectively. The activity of antioxidant enzymes such as peroxidase, catalase, and superoxide dismutase were increased by 57.42, 42.10, and 45.86% in Sour orange rootstock and 42.04, 26.78, and 37.92% in Bakraei rootstock, respectively. Overall, it can be concluded that the growth performance of Sour orange rootstock is more suitable than Bakraei to tolerate salt-alkali conditions. [ABSTRACT FROM AUTHOR]

The chronic dietary risk assessment for 34 pesticides suspected of acting as endocrine disrupters in Iran was assessed by comparing TMDI with the Acceptable Daily Intakes (ADI). Of 34 investigated endocrine-disrupting pesticides (EDPs), 6 had TMDI > ADI. In addition, potential non-carcinogenic and carcinogenic health risk assessments were evaluated using Monte Carlo simulation. HQ in wheat was 17.40 and 20.29 in adults and children, respectively. Due to dimethoate residue in wheat, HQ was 2.78, and for fenitrothion residue, 3.22. HI was 21.22 for adults and 24.76 for children in wheat, more than 1. Total Carcinogenic risk (TCR) due to EDPs residues was 6.40 × 10−5 in apples, in citrus fruits 5.97 × 10−5, 3.33 × 10−5 in cucumber, 5.30 × 10−5 in lettuce, in potato was 2.36 × 10−5, in rice was 1.61 × 10−5, 1.78 × 10−5 in tomato, and due to epoxiconazole residues in wheat was 3.18 × 10−5, more than acceptable limit 1.0 × 10−6. Therefore, consumers were at significant risk of carcinogenesis. Abbreviations: PCBs: polychlorinated biphenyls; BPA: Bisphenol A; ED: Endocrine Disrupting; EDCs: Endocrine Disrupting Chemicals; EDPs: Endocrine Disrupting Pesticides; ADI: Acceptable Daily Intake; TMDI: Theoretical Maximum Daily Intake; FAO: Food and Agriculture Organization; WHO: World Health Organization; MRL: Maximum Residue Limit; HQ: Hazard Quotient; HI: Hazard Index; CR: Cancer Risk; TCR: Total Cancer Risk; PPP: plant protection products [ABSTRACT FROM AUTHOR]

Introduction Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied. Materials and Methods In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5'AAAGAAGGCGACGATGTTGT3') and CPR (5'AGCTCCGGTCCAAGAAATCTG3') designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5. Results and Discussion CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IRNorth1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively. Conclusion An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position. [ABSTRACT FROM AUTHOR]

Cold and Freezing stresses cause harmful and devastating damage to many agricultural and horticultural crops. In early December of this year (2016), the occurrence of frost stress led to damage to citrus orchards in the north of the country, especially in the east of Mazandaran province. Investigating and calculating the damage to the orchards after the occurrence of cold and/or frost stress is one of the first actions of the Ministry of Jihad Agricultural and its subordinate organizations. However, the exact estimation of the orchards is one of the problems in this area. that considering the harvest season of the main citrus crops of the province hadn't yet started (Thomson orange) and the fruits were still on the tree (half ripe), the amount of frost damage increased. Due to the sustainability of the tangerines, especially Unshiu, the amount of damage to the fruits was little or few. In addition, the result of evaluating frost damage to citrus trees showed that the amount of leaves and fruit damage in the young trees was much more than in the older trees. The amount of fracture of trunks and main branches caused by snowfall was much higher in the hillsides and foothills compared to the plains. According to the calculated observations, it was found that the amount of damage to Thompson oranges in the cities of Babol, Ghaemshahr and Sari was higher than in the other regions due to a decrease in the air temperature to -4 degrees C and a longer glacial period. The fracture of the trunk and main branches of the citrus tree in the cities of Ghaemshahr and Babol was more than in the other regions. Also, the dryness of Thomson orange leaves in the cities of Babol, Ghaemshahr and Sari was more than in the other regions. The leaves and fruits of Page tangerines were damaged to different degrees, but Unshiu tangerines weren't severely damaged in this event. [ABSTRACT FROM AUTHOR]

This study investigates the potential of epiphytic bacteria isolated from citrus fruits to control green mold post-harvest disease caused by Penicillium digitatum in Thompson Navel sweet oranges in the north of Iran. Twenty-three epiphytic bacteria were isolated and screened in vitro against P. digitatum, and 13 isolates with antagonistic activity were selected for further studies. Isolates B15 (Bacillus sp.), P17 (Pseudomonas sp.), and S13 (Streptomyces sp.) exhibited the most effective inhibitory effects on P. digitatum in vitro and in vivo. Among these, B15 showed the highest percentage of mycelium growth reduction and was further identified as B. cereus by 16S rRNA sequence analysis. Metabolic analysis of Bacillus sp. isolate B15 extract revealed the presence of the inhibiting antifungal substance Iturin A. The result showed that the application of epiphytic B. cereus decreased the percentage of green mold post-harvest diseases in orange fruit. This indicates their potential as an environmentally friendly alternative to chemical post-harvest control of orange diseases caused by P. digitatum. [ABSTRACT FROM AUTHOR]

Copyright of Journal of Agricultural Sciences, Belgrade is the property of University of Belgrade, Faculty of Agriculture and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Revista Chapingo Serie Horticultura is the property of Universidad Autonoma Chapingo and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The citrus decline is a major threat to citrus production in the southern region of Iran. This study aimed to determine the relationship between the leaf nutrient indices and the citrus decline severity index in Valencia orange (Citrus sinensis L. Osbeck) orchards. The multivariate compositional nutrient diagnosis (CND) was considered to evaluate the relation between nutrient indices and susceptibility of 235 commercial Valencia orange to citrus decline severity index. The CND reference norms for d = 11 leaf nutrients in a low-citrus decline severity subpopulation of 'Valencia' orange was determined as V*N = 2.967 ± 0.127, V*P = 0.288 ± 0.156, V*K = 2.795 ± 0.125, V*Ca = 2.600 ± 0.269, V*Mg = 1.331 ± 0.095, V*S = 0.930 ± 0.226, V*Fe = −1.459 ± 0.292, V*Mn = −3.695 ± 0.285, V*Zn = −4.035 ± 0.249, V*Cu = −5.111 ± 0.220, V*B = −3.219 ± 0.177, and V*Rd = 6.609 ± 0.116. These norms were used to determine the nutrient indices in the high-citrus decline severity subpopulation of 'Valencia' orange orchards. According to the principal component analysis and nutrient indices, the deficiency of leaf Ca, B, S, and Mg concentration and excess of P, N, Mn, K, and Cu had a significant correlation with the increment of citrus decline severity index. The balanced nutrition management based on these CND norms could reduce the severity of the citrus decline in Valencia orange orchards. [ABSTRACT FROM AUTHOR]

Foreign trade is one of the important components in economic development and a source of foreign exchange earnings. In Iran, the government desires to develop foreign trade with a focus on non-oil exports. One of the substantial non-oil products is agricultural products. Iran is one of the top ten countries in the world in terms of producing agricultural products, especially citrus, but it does not have suitable conditions in terms of exports. Mazandaran province is a considerable source of citrus production in Iran, and the main produced citrus in the province is exported to Russia. Worth bearing in mind that although the production rate of citrus in the province is very well, the amount of export is not very appropriate. Therefore, the government struggles to adopt an appropriate approach to improve the conditions and taking the right approach is not possible without identifying the variables affecting exports. In this regard, in this study, first, the variables affecting citrus exports regarding the case are determined using literature review and the most related those to the case study are selected using the Delphi method. Then, the identified variables are ranked using the fuzzy DEMATEL method. Focusing on the results, it can be observed that "exchange rate fluctuation" and "marketing" have the most and the least impact on the development of citrus exports from the province to Russia, respectively. Moreover, to better analyze the gained results, the determined variables are divided into two main categories based on stages of trade, and each category's variables are discussed in detail. [ABSTRACT FROM AUTHOR]

In a 2017 survey, witches' broom disease (WBD) of Mexican lime (WBDL), Bakraee (WBDB), grapefruit (WBDGF), Kinnow (WBDK), Orlando tangelo (WBDOT), Minneola tangelo (WBDMT), sweet oranges varieties Valencia (WBDVSO) and a local (WBDLoSO) were observed in the Hormozgan province of Iran. The agents of citrus WBD were graft transmitted to lime seedlings and from lime seedlings to periwinkle plants via dodder. The work revealed that disease symptoms in lime seedlings and periwinkle plants are biological features for differentiating 16SrII-B and 16SrII-C strains. Phylogenetic and Tsp509I enzyme virtual RFLP analyses and presence of the 'Candidatus Phytoplasma aurantifolia' (16SrII-B) signature revealed that phytoplasmas detected in the present study and those from WBDVSO, WBDOT and WBD of citron (Kerman province, Iran) previously reported as 16SrII-C phytoplasma strains, are members of 16SrII-B subgroup. WBDK, WBDOT, WBDMT, WBDVSO and WBDLo association with 16SrII-B phytoplasmas is reported for the first time in the world. Specific witches' broom symptomatology in lime associated with 'Candidatus Phytoplasma aurantifolia' strain 16SrII-B in citrus and periwinkle and differential identification from strain 16SrII-C by Tsp509I RFLP analyses. [ABSTRACT FROM AUTHOR]

Background: Citrus species are among the most important and widely consumed fruit trees in the world and are subjected to increasing global cultivation. Sweet orange (Citrus sinensis L. Osbeck) is one of 30 species of citrus which is cultivated in different regions of Iran. In this study, 80 trees of 13 sweet orange cultivars of Mazandaran province were studied for genetic diversity and fingerprinting by five short simple repeat (SSR) marker. Results: The studied cultivars showed a high degree of genetic variability with an average genetic polymorphism of 98.46%. Behshahr and Jadeh Ghadim2 genotypes had the highest and lowest values in Nei genetic diversity, number of effective alleles, and Shannon index, respectively. Based on k-means clustering, the studied genotypes were divided into two main different groups. The high magnitude of genetic similarity between replicates of different cultivars indicated a potential case of homonymy or synonymy. DAPC analysis showed genetic admixture among some of the cultivars. The heatmap plot illustrated the alleles involved in cultivar differentiation. The CAPs analysis of monomorphic alleles of SSR loci indicated that these alleles differ in their sequences which add up to the genetic variability of citrus germplasm. Conclusion: In general, SSR markers, due to their codominant nature and abundance in genome, are a good indicator for cultivar fingerprinting and hybrid prediction in orange cultivars. The present results showed the high diversity of sweet orange trees in different cultivars in the north of the country. [ABSTRACT FROM AUTHOR]

The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae), is one of the most important and destructive pests of citrus in the world, because of its ability to vector bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the presumed causal pathogen of Huanglongbing (HLB) or greening disease. The biology and reproduction parameters of D. citri were studied at 27.5°C on four host plants corresponding to the four major varieties cultivated in Iran, namely, Marsh grapefruit (Citrus paradisi), local sour orange (C. aurantium), Mexican lime (C. aurantifolia), and Campbell Valencia orange (C. sinensis). The average developmental period of total nymphal stages and total cycle (egg to adult) were significantly longer on Campbell Valencia orange (21.2 and 24.1 days, respectively) than on other host plants. The mean of pre-oviposition period on four host plants varied (2.4-4.0 days) and was significantly longer on Campbell Valencia orange (4 days) than on other host plants. Oviposition rate and total eggs laid were not significantly different between the different hosts. Survival rate of D. citri was significantly lower on Campbell Valencia orange (42.1%) than on the three other varieties. The finite rate of increase (λ) and the rm value of D. citri were higher on Mexican lime (1.20 and 0.17, respectively) than on the three other hosts. Also, mean doubling time was higher on Marsh grapefruit (11.84 Days) than on other host plants. These new data give more insight about susceptibility of the different varieties of citrus to D. citri. [ABSTRACT FROM AUTHOR]

The blossoms of Citrus aurantium are considered for the treatment of Alzheimer's disease because of their fragrant essential oils. The aim of this study was to investigate the antioxidant and inhibitory effects of Citrus aurantium extract on the acetylcholinesterase and production of amyloid nanobiofibrils from bovine serum albumin (BSA). The Citrus aurantium petals were harvested from Rasht city in northern IRAN. Chemical composition was investigated by GC–MS. The anti–Alzheimer's effects were evaluated by determining the antioxidant percentage by DPPH method and determining acetylcholinesterase activity. Congored spectroscopy was used for investigation of the inhibitory properties of the extract on the production of amyloid nanobiofibrils, and amyloid fibers was confirmed by electron microscopy. The most abundant ingredients were D–Glucuronic acid (9.53%), D–Limonene (5.54%), Linalool (2.06%), Daphnetin (3.73%), Phthalic acid (0.72%), Octadecenoic acid (3.98%), Hexadecanoic acid (2.13%), Pyrrolidinone (1.17%) and the highest antioxidant capacity was at 8 mg/ml (EC 50 : 2.36 mg/ml). The extract reduced the Acetylcholinesterase activity less than 47.04% (IC 50 : 42.8 mg/ml) and amyloid production less than 22% (EC 50 : 3.135). Citrus aurantium petals with inhibitory properties for the production of amyloid nanobiofibrils, can be used as a beneficial drugs for reducing side effects of Alzheimer's disease. [ABSTRACT FROM AUTHOR]

Citrus Bacterial Canker disease, caused by Xanthomonas citri subsp. citri (Xcc), is one of the most devastating diseases that attacks citrus, especially in the southern areas of Iran. The objective of this investigation was to analyze several characteristics involved in Xcc virulence in relation to strain aggressiveness. To achieve this, swarming motility, biofilm formation, resistance to H2O2, and production of xanthan were evaluated considering 44 local strains causing citrus bacterial canker disease in Iran. All strains showed differential swarming motilities, biofilm formation abilities, and xanthan production. The most virulent strain, Xcc-KVXCC1, exhibited the greatest capability to form biofilm on solid surfaces, xanthan production, and pathogenicity on detached leaves of Citrus aurantifolia as well as positive chemotaxis toward C. aurantifolia extract. In this study, a total of 14 common and commercial citrus genotypes were evaluated for resistance to Xcc-KVXCC1. Genotypes were categorized into susceptible and resistant groups based on lesion number per inoculation site. Based on our results, C. aurantifolia was the most susceptible citrus cultivar to Xcc-KVXCC1. In contrast, C. aurantium, C. jumbhori, and C. reticulata cv. ponkan demonstrated high and moderately high resistance against Xcc-KVXCC1. [ABSTRACT FROM AUTHOR]

O3 assisted by solar UV as an integrated treatment of groundwater under visible UV to reach sustainable development were traced. The experimental parameters were set up throughout standard methods and analysis protocols. The best performance of citrus coal was observed at a reaction time of 90 min, pH: 6.5, adsorption bed height = 40 cm, initial OCPs concentration, respectively, as 100 μg/L for alachlor (ALC), α (±)-BHC, atrazine (ATZ), and α-chlordane, 150 μg/L for methoxychlor, 50 μg/L for heptachlor, and 90 μg/L for dieldrin. The best performance of citrus coal was observed at a reaction time of 90 min, pH: 6.5, adsorption bed height 40 cm, initial OCPs concentration of 100 μg/L for ALC, α (±)-BHC, ATZ, and α-chlordane, 150 μg/L for methoxychlor, 50 μg/L for heptachlor, and 90 μg/L for dieldrin. Under the above-mentioned operating conditions, the removal rates were estimated at more than 75% for all these compounds. The adsorption outputs were fitted to the Freundlich model with the average R2 > 0.97, while for the Langmuir model this value was >0.86. Thereby, it is concluded that OCPs adsorption occurs on a heterogeneous surface by multilayer sorption. With regard to Kf(1/n) parameter, for the Freundlich adsorption model, the order of OCPs adsorption was appeared to be methoxychlor > dieldrin > heptachlor > α-chlordane > ALC > α (±)-BHC > ATZ. The optimum variables for UV/O3 were obtained as 0.4 mg/L ozone, pH = 9, and 35 min reaction time, so that, more than 98% of these substances were degraded from the solution under this condition. The reaction kinetics were fitted with R2 value of more than 0.9 for most OCPs. The kinetic reaction constants (k) in pH values of 7 and 9.5 were higher than other ranges for all OCPs. The progress of pH at the alkaline area improved the pseudo-first-order constants. The kinetic model indicated that the reaction rates will be restricted by the initial pH value and the concentration of OH•. This evidence was well-established by monitoring dissolved O2 at the various pH ranges during the experiment runs. Eight intermediates were detected by gas chromatography-tandem mass spectrometry detection with chemical formula as C14H20ClNO3, C13H16ClNO3, C14H18ClNO4, -NHCH(CH3)2, -NHCOCH3, -NH2, C13H9ClO, and C7H5ClO from the samples taken in the non-optimized UV/O3 effluent. However, all of them disappeared in the final effluent at the optimized condition. Altogether, this integrated strategy helped to remove OCPs more than 86% on average, with residues less than 1 μg/L and even 0.05 μg/L in some cases. Due to the generation of a large amount of citrus wastes (46,000 ton/y) in the north of Iran and the abundance of solar energy especially solar UV in the middle east, this hybrid approach to treat groundwater contaminated with agricultural OCPs as a type of EDCs can be an effective alternative for conventional and current removal strategies to provide safety and treat groundwater by this agricultural compound. [ABSTRACT FROM AUTHOR]

Fruit splitting is one of main problems extensively observed in citrus-growing area located in the northern parts of Iran. In order to investigate the effect of 2,4-D and GA3 on incidence of fruit splitting in Thompson navel orange, an experiment, as a factorial arrangement in a randomized complete block design (RCBD) with three replications, was carried out in two consecutive years of 2016 and 2017. The main factors of this experiment included timing of spray at different growth stages (full bloom, petal fall, and June drop), 2, 4-D (0, 10, 20 mg L-1), and GA3 (0, 50, and 100 mg L-1). In the end of experiment, the characteristics including fruit length, fruit diameter, rind thickness, cellulase and polygalacturonase activities, total soluble solid, percentage of split fruit, and fruit yield were measured. Results showed that using 2, 4-D and GA3 not only decreased the rate of fruit splitting but also increased fruit yield as compared to controls. The highest fruit length, fruit diameter, rind thickness, total soluble solid and the lowest activities of cellulase and polygalacturonase were obtained using 100 mg L-1 GA3 and 20 mg L-1 2, 4 D during the full bloom. In general, the results revealed that using 2, 4-D and GA3 during the full bloom increased fruit yield while reduced fruit splitting and maintained the qualitative characteristics of Thompson navel orange. [ABSTRACT FROM AUTHOR]

Copyright of Contributii Botanice is the property of Contributii Botanice and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Witches' broom disease of lime (WBDL), caused by 'Candidatus Phytoplasma aurantifolia', is a major limiting factor for Mexican lime (Citrus aurantifolia Swingle) production in southern Iran. Here, nutritional status and biochemical composition of healthy and infected Mexican lime in a greenhouse were compared between uninoculated (healthy) plants and plants 52 weeks after inoculation with the phytoplasma. Leaves from healthy and infected plants were sampled to measure total phenolics, antioxidant capacity, peroxidase and superoxide dismutase enzymatic activities, soluble carbohydrate, and starch. Macro- and microelements were also measured in leaves, stems, and roots of the plants. The results showed that phytoplasma infection led to a marked increase in soluble carbohydrates and starch in the leaves, but to a reduction in the roots. In leaves and roots, antioxidant capacity, phenolics, and peroxidase activity were enhanced after infection; nitrogen, calcium, boron, and manganese were significantly lower and phosphorus, magnesium, potassium, iron, zinc, and copper significantly higher in the infected leaves. This study provides new insights on metabolic and nutritional changes associated with WBDL in the greenhouse. [ABSTRACT FROM AUTHOR]

A new species, Olopachys masani sp. nov. (Mesostigmata: Pachylaelapidae), is described based on adult female and male specimens collected from soil in Guilan province, northern Iran. Two identification keys are provided, one for all known species of Olopachys, and the other for species recorded from Iran. Collection details for pachylaelapid mites associated with citrus orchards in Guilan province Iran are also provided. [ABSTRACT FROM AUTHOR]

Citrus decline has become a devastating problem in citrus‐growing regions of southern Iran. The affected trees show progressive yellowing of leaves, thinning of the canopy, dieback and total collapse. Despite a number of attempts, the aetiology of the decline has remained uncertain. In the present study, we evaluated the potential association of various biotic and abiotic factors with the decline in the Fars Province of Iran. Biotic agents surveyed included Candidatus Liberibacter asiaticus, Spiroplasma citri, phytoplasmas, Tylenchulus semipenetrans and root infecting fungi and oomycetes. Abiotic factors studied were soil and water salinity, changes in prevailing temperature and other environmental conditions. In our surveys, Ca. L. asiaticus, either alone or in combination with other factors, had the highest frequency of association (92%) with the decline, followed by S. citri (75%). Ca. L. asiaticus was not detected in any of the non‐decline trees examined. Pythium or Phytophthora species and a fungus of theFusarium solani species complex were also isolated from roots of many declining trees. Phytoplasmas were found only in few cases, and populations of citrus nematode were often below the threshold of economic loss. Soil/water salinity were in the suitable range for citrus cultivation in most cases. It is suggested that the decline is initiated by Ca. L. asiaticus infection, which is known to weaken the root system and make it vulnerable to infection by opportunistic soil fungi and oomycetes. S. citri, summer temperatures, low air humidity and overbearing of the trees seem to be other potential factors contributing to the intensity of the disease. [ABSTRACT FROM AUTHOR]

In 2015, some imported tangerine (Citrus reticulata Blanco) fruits with suspected canker lesions were observed in some local markets in Shiraz county of the Fars province in Iran. Symptomatic and asymptomatic tangerine fruits obtained in a survey of local markets were collected and analyzed. Xanthomonas-like bacterial isolates were only recovered from symptomatic tangerine fruits. Eighteen isolates were identified as Xanthomonas citri subsp. citri (Xcc) based on biochemical tests and polymerase chain reaction (PCR) using Xcc specific primers. The isolates were evaluated for pathogenicity on four Citrus spp., namely tangerine, sweet orange, lemon and Mexican lime. All isolates induced disease symptoms on the four Citrus spp. and could be re-isolated and identified from inoculated symptomatic plants. The pathogenicity test and a phylogenetic analysis of sequence data showed that Xcc pathotype A is the causal agent of bacterial canker in commercially imported tangerine fruits. Our results indicated that infected citrus fruits could play a relevant role as a dispersal inoculum of citrus canker into new regions such as Iran. To our knowledge, this is the first known introduction with imported fruits of Xcc pathotype A into the Fars province of Iran. [ABSTRACT FROM AUTHOR]

Knowing the trees nutritional status is necessary for achieving balanced fertilization in orchards. One approach for determining the nutritional status of orchards is the compositional nutrient diagnosis method. In the present research this method was performed to evaluate the nutritional status of three important areas of lime cultivation in Hormozgan province, south of Iran, during 2014 and 2015. Comparison between the obtained results and standard nutrient concentrations in lime revealed that nitrogen, potassium, and manganese deficiency were the most limiting factors for lime production in Hormozgan lime orchards. Moreover, excess phosphorus, chlorine, iron, and boron showed negative effect on the fruit yield of lime. The optimum concentrations of nitrogen, phosphorus, potassium, and chlorine in the lime leaves in the studied orchards for achieving 150 kg fruit per tree were 2.88, 0.28, 1.31, 0.27% and those of iron, manganese, zinc, copper and boron were 222.26, 11.57, 4.63, 6.67, and 222.80 mg/kg DW, respectively. Therefore, it is recommended that using nutrients such as nitrogen, manganese and potassium must be given a priority in these orchards. Furthermore, some approaches like leaching fraction and supplying N-NO3 fertilizers should be utilized to mitigate the negative effects of boron and chlorine on the plant growth and yield. [ABSTRACT FROM AUTHOR]

Citrus decline is developing in the southern part of Iran. NH4–N form and factors that limit the uptake of calcium, magnesium and micronutrients by root cause increased citrus decline severity. In this study, the effect of nutritional management on the control of the complication of citrus loss in Valencia orange trees (Citrus scinensis L. Osbeck) was investigated. The experiment was conducted in a randomized complete block design with seven treatments in four replications and four trees per each plot, during 2016 and 2018. - Control (nutrition based on soil test and with ammonium sulfate nitrogen source) - Supplementary soil fertigation with micronutrients iron + zinc + copper + manganese EDDHA chelates at three times during the growth of shoots in the spring; calcium nitrate; magnesium nitrate - Foliar nutrition with micronutrients zinc sulfate + manganese sulfate + boric acid + copper sulfate; potassium nitrate and magnesium nitrate. The results showed that, leaf potassium concentration had a positive correlation with root decay and shoot dieback. Supplemental soil fertigation with micronutrients, calcium and magnesium nitrate caused a significant increase in fibrous root density and reduction of root decay percentage. Supplemental soil fertigation with calcium nitrate and foliar nutrition with magnesium nitrate resulted in significant improvement of citrus decline indices in Valencia oranges, including leaf fall, shoot diebacks, leaf special weight, leaf water content, and quantitative and qualitative of fruits. Due to the negative effect of excessive potassium concentration on aggravation of citrus decline, balanced consumption of potassium in citrus orchards is recommended. [ABSTRACT FROM AUTHOR]

Citrus decline threatens the orchards in the southern part of Iran. Roots begin to dieout before citrus decline deterioration. In this study, the effect of expanding the irrigation wetted area and decreasing the irrigation depth, and application of compost as organic mulch on root development and amelioration of citrus decline in Valencia orange trees (Citrus sinensis L. Osbeck) was investigated. Experimental factors contained the different percentage of irrigation wetted area and decreasing irrigation effective root depth by drip irrigation system at three levels W0 (control): 3040% with 60 cm effective root depth; W1: 5060% with 45 cm effective root depth; W2: 7080% with 30 cm effective root depth under tree canopy area and the factor of annual application of compost as organic mulch at two levels M0 (control): means no application of compost and M1: application of 80 kg compost under tree canopy area with 10 cm thickness as ground cover, after rotating the top soil at 10 cm depth for all treatments. The results showed that, annual application of compost as organic mulch under tree canopy area and expanding the irrigation wetted area with decreasing irrigation effective root depth, significantly improved fibrous root length and density at a lower soil depth and decreased the indices of citrus decline such as root rot percentage, leaf and fruit drop and shoot die back. Also these treatments increased the water productivity and fruit quality of in declining Valencia orange trees. [ABSTRACT FROM AUTHOR]

The citrus red mite, Panonychus citri , is a major pest on citrus all around the world. Mitochondrial Electron Transport Inhibitors of complex I (METI-I) acaricides such as fenpyroximate have been used extensively to control P. citri populations, which resulted in multiple reports of METI-I resistant populations in the field. In this study, biochemical and molecular mechanisms of fenpyroximate resistance were investigated in P. citri. Seven populations were collected from Northern provinces of Iran. Resistance ratios were determined and reached up to 75-fold in comparison to a fenpyroximate susceptible population. Cross-resistance to two additional METI-I acaricides, pyridaben and tebufenpyrad, was detected. PBO synergism experiments, in vivo enzyme assays and gene expression analysis suggest a minor involvement of cytochrome P450 monooxygenases in fenpyroximate resistance, which is in contrast with many reported cases for the closely related Tetranychus urticae. Next, we determined the frequency of a well-known mutation in the target-site of METI-Is, the PSST subunit, associated with METI-I resistance. Indeed, the H92R substitution was detected in a highly fenpyroximate resistant P. citri population. Additionally, a new amino acid substitution at a conserved site in the PSST subunit was detected, A94V, with higher allele frequencies in a moderately resistant population. Marker-assisted back-crossing in a susceptible background confirmed the potential involvement of the newly discovered A94V mutation in fenpyroximate resistance. However, introduction of the A94V mutation in the PSST homologue of D. melanogaster using CRISPR-Cas9 did not result in fenpyroximate resistant flies. In addition, differences in binding curves between METI-Is and complex I measured directly, in isolated transgenic and wildtype mitochondria preparations, could not be found. Unlabelled Image • fenpyroximate resistance was investigated in seven Panonychus citri populations from Iran • fenpyroximate resistance ratios reached up to 75-fold and cross-resistance with other METI-I acaricides was observed • synergism experiments, in vivo assays and expression analysis suggest a minor role for P450s in fenpyroximate resistance • a previously reported resistance mutation, H92R in PSST of Complex I, was detected in a highly resistant population • a new mutation, A94V in PSST, was detected in a resistant population but no clear claim regarding its role could be made [ABSTRACT FROM AUTHOR]

Hop stunt viroid as the causal agent of cachexia disease has detected from citrus trees in different areas in Iran. Although cachexia has not been reported as a decline disease for citrus trees, it can impair crop quality and reduce plant yields. This study was undertaken to molecularly detect HSVd among different commercial citrus cultivars and determine genetic diversity of this viroid in Mazandaran province of Iran. Sampling was performed from symptomatic and symptomless citrus cultivars in Mazandaran province. HSVd specific primers were used for molecular detection. SSCP and sequencing were applied to assay HSVd genetic diversity. Results showed the detection of HSVd in all symptomatic Satsuma (25 out of 25), Clementine (25 out of 25), sweet lime (20 out of 20) and sweet orange cv. Valencia (7 out of 7), as well as, 31% (14 out of 22), 100% (12 out of 12) and 33% (5 out of 15) of page mandarin, lemon and grapefruit trees, respectively. 10 different HSVd genomes were identified by sequencing the SSCP profiles among which HSVd‐IR1 had the most frequency. [ABSTRACT FROM AUTHOR]

Background and Aims: Medicinal herbs are used due to fewer side effects for produce of natural drugs in the pharmaceutical industry. The aim of this study was investigation of antibacterial and antioxidant activity of Citrus medica skin extracts against 10 human pathogenic bacterial and investigation of secondary metabolites in vitro . Materials and Methods: Color and white Skin of Citrus medica under the supervision of Citrus Research Center experts were collected from Ramsar City, Mazandaran Province, Iran in 2014. Antibacterial activity by agar well diffusion method, total phenolic content by Folin- Ciocalteu method, total flavonoid by aluminum chloride and antioxidant properties by DPPH method were investigated . Phytochemical investigation of secondary metabolites was performed. Results & Conclusion: The highest inhibitory activity was observed on methanol extract of color skin on Bacillus cereus bacteria. IC50 methanol extract of color, white skin and ascorbic acid were calculated 0.1505, 0.1738 and 0.1095 mg/mL respectively. The total phenolic content of color and white skin was 109.5 and 105.6 (mgGAE/g) and the total flavonoid content was 3.53 and 3.02 (mgQ/g), respectively. The presence of alkaloid in methanol extract of color skin and the presence of saponin and tannin in methanol extract of white skin was confirmed. Due to antibacterial properties of this medicinal plant can be used in produce antibiotics controlling of human pathogenic microorganisms. [ABSTRACT FROM AUTHOR]

Objective: This study evaluated the antianxiety effect of Citrus aurantium aroma (neroli oil) inhalation on patients with acute coronary syndrome (ACS). Design: A double-blind, placebo-controlled randomized trial. Setting/Location: This study was conducted in the Coronary Care Unit of Torfeh Hospital in Tehran, Iran, from September 2017 to February 2018. Subjects: A total of 140 hospitalized ACS patients (mean age = 56.72 ± 11.38 years) Interventions: Eligible patients were randomly assigned to citrus aroma and placebo groups to receive inhalation aromatherapy 2 days after hospitalization. Citrus aroma was 30% essential oil of Citrus aurantium L. flowers in paraffin, which was administrated three times a day. The placebo group received paraffin similarly. Outcome measures: The rate of anxiety was measured at baseline and after intervention using the State–Trait Anxiety Inventory. Results: At baseline, citrus aroma and placebo groups were similar in demographic characteristics as well as anxiety scores. After intervention, mean anxiety scores in the two groups become significantly different; the scores were 34.66 ± 9.6 and 42.36 ± 6.4 for citrus aroma and placebo groups, respectively (p < 0.0001). No side effect was observed. Conclusions: According to the current findings, aromatherapy with Citrus aurantium L. aroma (neroli oil) may be a safe and efficient intervention and can be considered an easy and applicable method to reduce anxiety in patients with ACS. [ABSTRACT FROM AUTHOR]

Witches' broom disease of lime (WBDL), associated with Candidatus Phytoplasma aurantifolia, has devastated the majority of Mexican lime orchards in southern Iran. Recognition of resistant cultivars and rootstocks can play a major role in WBDL management. In this study, graft-inoculation was used to address the reaction of 12 citrus commercial species and 39 collected lime biotypes from five main lime production areas of Hormozgan province, Iran, against WBDL phytoplasma. The experimental plants were allowed to grow from seed, then five seedlings of each species and biotypes were grafted with Ca. Phytoplasma aurantifolia infected shoots. Inoculated plants were inspected for symptom expression for two years. Direct and nested-PCR using P1/P7 and R16F2n/R16R2 primer pairs, respectively, were used for confirmation of phytoplasmal infection in the suspected plants. All commercial citrus species and 39 of the lime biotypes showed the symptoms of little leaf, internode shortening and witches' broom after two to twenty months from graft-inoculation. Incubation period in plants varied from two months in Astaraei lemon and R 11 biotype of Rudan region to twenty months in S 4 and S 6 biotypes of Senderk region. With these results, we can say all commercial citrus species were sensitive to WBDL. Among the commercial citrus species, Lisbon lemon, grapefruit and Cleopatra mandarin cultivars showed symptoms of WBDL after 460, 425 and 375 days, respectively. Disease symptoms developed rapidly on Astaraei lemon and Bakraei within 85–105 days, respectively. Among the collected biotypes, one, five and one biotypes from Minab, Rudan and Hashtbandi, respectively, were resistant to WBDL phytoplasma. These biotypes were symptomless; however, the PCR assay for detection of the phytoplasma was positive in all of them. These results are promising regarding the potential of using the suitable biotypes to reduce the development of WBDL. • Graft-inoculation of some citrus rootstocks and lime biotypes in south regions of Iran. • Screening the inoculated plants using witches' broom disease of lime (WBDL) symptoms and PCR tests. • Determination of incubation period of WBDL in the inoculated plants. • Identification of some lime biotypes with any WBDL symptoms after inoculation grafting. [ABSTRACT FROM AUTHOR]

Summary: Lime witches'-broom (WBDL) is a devastating disease of Mexican lime trees in southern Iran. 'Candidatus Phytoplasma aurantifolia' is associated with the disease. Understanding the pattern of colonization and spread of 'Ca. P. aurantifolia' within lime trees is critical for its accurate detection during the latent period of the disease. In the present study, the distribution pattern of the WBDL phytoplasma in graft inoculated lime seedlings was investigated under greenhouse conditions and its seasonal variation of concentration in symptomless lime trees was evaluated in an infected orchard using qPCR assay. Repeated sampling from various tissues of graft-inoculated lime seedlings was carried out at various times post-inoculation. In the field, leaf samples were taken from symptomless trees in an infected orchard in March, August and December. Our results showed that after entrance into the lime seedlings, 'Ca. P. aurantifolia' moved downward into the roots as well as upward into the apical leaves. The concentration of phytoplasma in apical leaves showed an initial high followed by a decrease before establishment of infection and subsequent symptom appearance. The spread of the phytoplasma from root to the aerial parts was rather slow. Severe witches' broom symptoms appeared on the grafted branches 10 months after grafting. At this time, the highest phytoplasma DNA concentration was found in descending order in stems and leaves of witches' brooms, crown, various parts of the root, and stem bark and apical leaves of the symptomless branches. Results of the field experiment revealed that concentration of 'Ca. P. aurantifolia' cells in infected trees was highest in August compared to that in December and March. Our result would be useful for rapid detection of WBDL phytoplasma during the latent period of the disease. [ABSTRACT FROM AUTHOR]

Agricultural development, one of the important economic sections of the country, has always been given special considerations in the master plans of governments within that, citrus culture as an important subsection of the agricultural sector, plays a substantial role in the development of agriculture. Due to the lack of prophecy planning for citrus production, harvesting, post harvesting, and marketing process, citrus culture in the citrus pole of the country has not been developed as it was expected. Since the major livelihood of agricultural producers in Mazandaran is citrus production (due to the semi-Mediterranean climate) and this sub-sector has not been scrutinized properly to fulfill its developmental needs and requirements, this qualitative applying grounded theory research was conducted to develop citrus culture development model, based on human resource development indications and citrus culture extension education. This is true for the fundamental infrastructure of agricultural development in general. Snowball sampling method was implemented and 125 agricultural experts in charge, along with 306 citrus producers were interviewed in depth until theoretical saturation was satisfied. Grounded theory methodology consisting as open coding, axial coding and selective coding applied in this study. Results showed that major factors as structural, economic, social, environmental, technical, cultural-educational and individual features with its components play significant roles in citrus culture development in Mazandaran. [ABSTRACT FROM AUTHOR]

Highlights • A green, blue, grey and white water footprints have been estimated for citrus at the provincial level. • The impacts of climatic and non-climatic factors have been evaluated on the variability of citrus water footprint components. • Water footprint increases when the crop yield decreases. • The water footprint depends on the non-climatic factors rather than the climatic factors. Abstract Citrus is one of the most important crops on the world and the southern part of Iran has a huge field for citrus. Exporting these products to farmers is very important economically. Shortage of water resources is the main challenge for citrus gardens. Therefore, water resources management of citrus is essential in these regions. The purpose of this paper is calculation of water footprint components of citrus production in Hormozgan province. Then, it evaluated the impacts of climatic and non-climatic factors on the variability of citrus water footprint during 2002-2016. The total water footprint of citrus was 6.69 m3 kg−1 with sharing of 2%, 16% and 82% for the green, blue and white + grey, respectively. Also the results showed crop yield is the most important factor on temporal variation of citrus water footprint. The trend of blue, grey and white water footprints is significantly increasing in 2002-2016. This research provides practical approaches for managers and policy-makers in the agriculture area for managing the water footprint and helps to optimize the water consumption and cultivation of citrus at regional scales. [ABSTRACT FROM AUTHOR]

A land suitability evaluation study for citrus was carried out in Pol-e-Dokhtar area, Western Iran based upon Simple Limitation method (SLM), Limitation Method regarding Number and Intensity (LMNI) and parametric (PM) such as square root and storie methods. Results showed that the accuracy of obtained results by the square root method is high and more realistic when compared with the limitation methods results. Therefore according to the results of square root method cultivation of citrus is not suitability for citrus. [ABSTRACT FROM AUTHOR]

South citrus growing belt of Iran including Hormozgan, Sistan-Baluchestan, Bushehr, Fars and Kerman provinces, has a long history of cultivation of acid lime (Mexican lime) [Citrus aurantifolia (Chritm.) Swing.]. In two recent decades due to witches' broom disease of lime (WBDL), caused by 'Candidatus Phytoplasma aurantifolia', thousands of acid lime trees have been killed in the south of Iran. Using resistant or tolerant varieties is one of the important strategies for controlling WBDL . The aim of this study was producing new acid citrus hybrids resistant to the WBDL disease. Four types of crosses were carried out. The female parent was ‘Eurekaʼ lemon [C. limon (L.) Burm. F.] and the male parents were ‘Yuzuʼ [C. junos Sieb. ex Tan.], ‘Cleopatraʼ mandarin [C. reshni Hort. ex Tan.], ‘Kusaieʼ lime (C. limonia Osb.) and ʻHamlinʼ orange [C. sinensis (L.) Osb.]. From the above parents, 79 hybrid plants were successfully inoculated with the 'Ca. P. aurantifolia' by inverted T-budding. Appearance of disease symptoms and nested-PCR assay were used to assess inoculated hybrids for resistance. Two years post-inoculation 63 hybrids remained symptomless. Among symptomless hybrids, 35 and 28 hybrids were negative and positive for presence of WBDL phytoplasma, respectively. Symptomless hybrids negative for WBDL phytoplasma are under more phenotypic evaluation and may be promising as new acid citrus resistant to WBDL. [ABSTRACT FROM AUTHOR]

Biological control (BC) through the release of BC agents is regarded as a potential strategy for achieving sustainable pest control and provides a way to substantially reduce pesticide use without sacrificing crop yield. Despite all its potential, understanding attitude and intention to use BC still remains low, especially among smallholder farmers. This study explored the extent to which knowledge of the adverse effects of pesticides and two components of the Health Belief Model (i.e., belief in the efficacy of BC and perceived barriers to BC) are related to: (i) farmers' attitude towards BC as a pest control method and (ii) farmers' intention to use BC in the future as a pest management practice. A random sample of 381 citrus farmers from Sari County in Mazandaran Province of Iran was used. The majority of the farmers (71.1%) had a positive attitude towards BC, while 60.1% agreed that they would use BC in the future as a pest management practice. Farmers were not well aware of the adverse effects of pesticides used in citrus fields, such as pyriproxyfen, buprofezin, and chlorpyrifos. Knowledge of the adverse effects of pesticides was not significantly associated with either dependent variable (i.e., belief in the efficacy of BC and perceived barriers to BC). However, farmers who believed in the efficacy of BC as a pest management method were more likely (P < 0.01) to have a positive attitude towards BC, while those who perceived more barriers to BC use were less likely (P < 0.01) to have a positive attitude towards BC. Findings support that (i) the promotion of the BC effectiveness is a worthy goal for providers of extension services for the promotion of BC adoption and (ii) if the perceived barriers to the adoption of BC are overcome, the rate of BC use among farmers would increase. Overall, extension programs aiming only at increasing awareness and knowledge of pesticide impacts may not succeed in promoting BC adoption. Efforts should target farmers' views of BC, promoting farmers’ belief in the efficacy of BC and lessening perceived barriers to BC use. [ABSTRACT FROM AUTHOR]

Citrus tristeza virus (CTV) is one of the economically destructive viruses affecting citrus trees worldwide, causing significant losses in fruit production. Comparative genomic studies have shown genetic diversity in various regions of the genome of CTV isolates, which has classified the virus into several genotypes. In recent years, some orange citrumelo-tolerant rootstocks showed yellowing, decline, and vein clearing in northern Iran (Mazandaran province, Sari). We confirmed the presence of CTV in the symptomatic trees by reverse transcription PCR (RT-PCR). The complete genome of a Sari isolate of CTV (Sari isolate) was sequenced using next-generation sequencing (NGS) technology. In addition, phylogenetic analysis, differential gene expression of the virus and identification of its variants in a population were studied. We obtained the final contigs of the virus (nt) and annotated all genomes to viral ORFs, untranslated regions (UTRs), intergenic regions, and 5' and 3' ends of the genome. Phylogenetic analysis of the Sari isolate and other genotypes of CTV showed that the Sari isolates were placed in a distinct cluster without a sister group. Based on the number of specific transcripts (TPM) in CTV RNA -Seq, P13 was the most highly expressed gene related to the host range of the virus and its systemic infection. The ORFs of the polyprotein, P33, and P18 showed variation in a single population of the sari isolate. The CTV has a potential for variation in a population in a host, and these variations may contribute to the best fit of the CTV in different situations. In Iran, whole genome sequencing of the CTV was performed for the first time, and we gained new insights into CTV variation in a population., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2023 Ghorbani et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Background: Complementary and integrative medicine may be effective for postoperative outcomes. This study aimed to determine the effect of lemon inhalation aromatherapy on pain, nausea, and vomiting and neurovascular assessment in patients for lower extremity fracture surgery., Methods: This is a randomized clinical trial study. Ninety patients who had undergone lower extremity fracture surgery were randomly assigned to the intervention (lemon aromatherapy) and control groups. Lemon aromatherapy was started in the morning of the surgery and extended at two-hour intervals until the end of the surgery, in the recovery room, and 16 h after surgery. Numerical pain and nausea and vomiting scales, the Rhodes Index of Nausea, Vomiting, and Retching, and the WACHS Neurovascular Observation Chart were used to assess the outcomes before and after the intervention (in the recovery room and 4, 8, 12, and 16 h post-surgery). The data were analyzed using the Wilcoxon test, ANCOVA, and Repeated Measure ANCOVA., Results: A significant difference was observed between the groups in terms of the intensity of pain (P < 0.001) and nausea and vomiting (P = 0.001) during the study period. Moreover, a significant difference was found between groups as to the frequency and severity of nausea, vomiting, and retching. The amount and duration of postoperative vomiting and nausea were significantly lower in the intervention group compared to the control group. In addition, lemon inhalation aromatherapy decreased the frequency of anti-emetic drug administration in the recovery room (P = 0.04) and 16 h post-surgery (P = 0.03)., Conclusions: This study indicated that aromatherapy reduced pain intensity, postoperative nausea, vomiting, and retching, as well as the incidence of anti-emetic drug administration. Therefore, using lemon inhalation aromatherapy to relieve pain and reduce nausea and vomiting is suggested for lower extremity fracture patients who have undergone surgery., Trial Registration: This study was registered in the Iranian Registry of Clinical Trail (Number = 57,331, IRCT20130616013690N10, approved 24/07/2021) ( https://www.irct.ir/trial/57331 )., (© 2023. The Author(s).)

Configuration of sustainable supply chains for agricultural products has been a well-known research field recently which is continuing to evolve and grow. It is a complex network design problem, and despite the abundant literature in the field, there are still few models offered to integrate social impacts and environmental effects to support network design decision-making to support the configuration of the citrus supply chain. In this work, the citrus supply chain design problem is investigated by integrating the production, distribution, inventory control, recycling and locational decisions in which the triple bottom lines of sustainability, as well as circularity strategy, are addressed. Accordingly, a novel multi-objective Mixed-Integer Linear Programming (MILP) model is proposed to formulate a multi-period multi-echelon problem to design the sustainable citrus Closed-Loop Supply Chain (CLSC) network. To solve the developed model, the ε-constraint approach is employed in small-sized problems. Furthermore, Strength Pareto Evolutionary Algorithm II (SPEA-II) and Pareto Envelope-based Selection Algorithm II (PESA-II) algorithms are used in medium- and large-sized problems. Taguchi design technique is then utilized to adjust the parameters of the algorithms efficiently. Three well-known assessment metrics and convergence analysis are regarded to test the efficiency of the suggested algorithms. The numerical results demonstrate that the SPEA-II algorithm has a superior efficiency over PESA-II. Moreover, to validate the applicability of the developed methodology, a real case study in Mazandaran/Iran is investigated with the help of a set of sensitivity analyses. • Developing a novel tri-objective MILP model for a citrus CLSC network design problem. • Addressing sustainable development and circular economy in the problem. • Applying four meta-heuristic methods to treat the problem complexity. • Investigating a real case study problem with a set of sensitivity analyses. [ABSTRACT FROM AUTHOR]

Nowadays crop mapping as an interdisciplinary hot topic attracted both agriculture and remote sensing researchers' interests. This study proposed an automatic method to map citrus orchards in Juybar, Iran, where planting citrus trees is booming there. In this regard, 148 Sentinel-1, Sentinel-2, and ALOS Digital Surface Model (DSM) tiles are processed in Google Earth Engine to provide a hybrid feature set including initial satellite images, Gray Level Co-occurrence Matrix (GLCM) textural features, and spectral features such as vegetation, built-up, bare-soil indices, and the proposed Vegetation Dynamic Index (VDI). A semi-automatic sample selection paradigm is also developed based on a time-series analysis of 12 monthly Normalized Difference Vegetation Indices (NDVIs), Otsu thresholding, multi-level thresholding (MLT), and using two proposed indices called Evergreenness Index (EGI) and Water-covered or No-vegetation (WCNV) index, and finally human post-revision. The output of the Support Vector Machine (SVM) classification using 60,000 samples and the post-classification operation showed that the classified map has an average overall accuracy (OA) and an average kappa coefficient (KC) equal to 99.7% and 0.992, respectively. The results show that multispectral bands lonely extracted orchards with high accuracy (OA: 99.55%, KC: 0.986), and the rest of the features only made a slight improvement to that. For the year 2019, an area of about 4351 ha is estimated as citrus orchards, which is in accordance with the agriculture department's reports (~4700 ha). The results indicate that from 2016 to 2019, despite a "citrus to non-citrus" land-use conversion of about 754 ha, the citrus orchards area was totally expanded by about 17%. Comparing the results with the Google Earth images indicates the precise extraction of orchards with a 10 m spatial resolution. To use the proposed method for extensive cases or areas with other types of evergreen trees, it is recommended to use high-resolution normalized DSMs (nDSMs) and textural features. [Display omitted] • This study aimed to map the citrus orchards in Juybar (Iran) automatically. • Ever greenness was a key feature to set up potential citrus orchards masks. • The automatic and pointwise selection method have better performance than manual and polygon based method. • Multi-modal feature set increased the accuracy of the classification. • In 2019, 4351 ha of croplands were detected as citrus orchards [ABSTRACT FROM AUTHOR]

Background: Obesity induces endothelial dysfunction even in the pediatric age group. The possible protective effects of fruits and herbal products on the endothelial dysfunction of obese children remain to be determined. This study aims to investigate the effects of lemon and sour orange peels on endothelial function of adolescents with excess weight. Materials and Methods: This triple-masked, randomized placebo-controlled trial was conducted for 1-month among 90 overweight and obese participants, aged 6-18 years. They were randomly assigned into three groups of equal number receiving daily oral capsules containing lemon or sour orange powder or placebo. Flow-mediated dilatation (FMD) was compared between three groups by using analysis of covariance. Results: Overall, 30 participants in the lemon group, 27 in the sour orange group and 29 in the control group completed the trial. After the trial, mean FMD was significantly (P < 0.001) higher in the lemon group (11.99 ± 4.05) and in the sour orange group (12.79 ± 5.47) than in the placebo group (6.45 ± 2.79). FMD percent change was 145.02 ± 24.34 in the lemon group, 142.04 ± 16.11 in the sour orange group, and 46.73 ± 5.16 in controls (P < 0.001). Conclusion: This trial showed that consumption of extracts of lemon and sour orange peels, which contain plenty amounts of antioxidants, flavonoids, pectin, and vitamin C, might have significant benefits on endothelial function in children and adolescents with excess weight. Trial registry code: IRCT201311201434N10. [ABSTRACT FROM AUTHOR]

In this research, distribution ofPhytophthoraspecies were determined in Kerman Province (Bam, Shahdad and Arzuiyeh) during 2004–2007. ThePhytophthoraspecies were isolated from infected root, crown and soil. Root and crown pieces were washed and cultured on a CMA-PARPH medium. The isolation from infected soil was performed by bating method using citrus leaves. It was identified by morphological and several physiological characteristics. Distribution of species was determined by recording the number of isolates recovered from samples from each city. In this study, from 220 soil samples collected from 52 citrus orchards, 80 isolates ofPhytophthorawere recovered. Among of all isolates ofPhytophthora, P. parasiticaandP. citrophthorawere the most important species of causal agent of gummosis onCitrussp. Distribution ofP. citrophthorawas highest in Arzuiyeh and lowest in Bam and Shahdad cities, while distribution ofP. parasiticawas highest in Bam and Shahdad cities. The majority of soil samples contained onlyP. parasitica, but a few of percentage samples containingP. citrophthoraalone and both of fungi in cites samples. [ABSTRACT FROM AUTHOR]

The citrus industry in Iran is based on graft propagation of local and imported cultivars on a limited number of rootstocks such as sour orange, Mexican lime and Bakraee, a local natural hybrid. Infection of the available cultivars with graft-transmissible agents, viroids in particular, may have deleterious effects on the productivity of citrus and, more importantly, limits the choice of rootstocks. Rootstocks other than sour orange and Mexican lime will be needed as a consequence of the introduction and spread of Citrus tristeza virus (CTV) in the country. In the present study, two cv. Sanguinello sweet orange and two cv. Duncan grapefruit trees were selected on the basis of the bark scaling symptoms observed on the trifoliate orange and Troyer citrange rootstocks. Analysis by sPAGE and Northern blot hybridization of nucleic acid preparations of Etrog citrons graft-inoculated with these sources revealed the presence of several viroids: Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd), the causal agents of exocortis and cachexia, respectively, as well as Citrus bent leaf viroid (CBLVd), Citrus dwarfing viroid (CDVd) and Citrus bark cracking viroid (CBCVd). These viroids were sequenced and compared with the corresponding reference sequences. To extend these results, samples from different citrus cultivars were collected in the two main citrus growing regions and analyzed for viroids. Of the 49 samples tested, 22 were viroid-positive, witnessing the occurrence of cultivars infected with CEVd, HSVd, CBLVd, CDVd, or CBCVd as mixed infections in the surveyed regions. One sample was also co-infected with the newly described Citrus viroid V (CVd-V). [ABSTRACT FROM AUTHOR]

Indian siris, Albizia lebbeck (L.) Benth., is a useful tree that is being widely planted for shade in the Ahwaz region of southwest Iran. The tree is, however, severely attacked by the citrus red mite Eutetranychus orientalis Klein. Seasonal population dynamics of the mite were investigated on A. lebbeck in Ahwaz during 2010–2011. Eutetranychus orientalis had two population peaks on A. lebbeck. The first and second activity periods were observed from 10 August to 28 October 2010 and 24 February to 20 June 2011, respectively. The highest density and activity of E. orientalis was observed during September to November and April to May. During these months, the average temperature and relative humidity were 20–35 °C and 21–40%, respectively. The spatial distribution of the mite was evaluated using the parameters of Taylor's power law, which revealed an aggregated spatial distribution of E. orientalis on A. lebbeck. The results of the study could be applied to develop an integrated pest management programme against the pest. [ABSTRACT FROM PUBLISHER]

Citrus is one of the most important fruit crops in Iran. Among the citriculture areas of Iran, Mazandaran province has the highest acreage (about 100,000 ha), production and number of varieties nationwide. Unauthorized importation of citrus species and cultivars and propagation by growers and nurserymen have led to perpetuation and spread of virus, viroid and other graft transmissible pathogens of citrus in Mazandaran. Nonetheless, the putative agents of several of such graft-transmissible diseases including citrus ring pattern (CRP) have remained undetermined and the use of certified disease-flee propagative stocks has not gained widespread attention. With the onset of the aphid transmission of Citrus tristeza virus (CTV) in the area, trend has shifted toward the use of CTV-tolerant rootstocks, mainly trifoliate orange (Poncirus trifoliata) and-its hybrids, citranges (P. trifoliata x Citrus sinensis) and citrumelos (P. trifoliata x C. paradisi) with concurrent use of disease free (mostly CTV-free) budwoods and budlings. Some nurserymen and growers are becoming keen about the impact of several viroid species which have, herebefore, been regarded as harmless to orange and mandarins produced on sour orange (C, aurantium) rootstock but would adversely affect vigor and yield of trees on trifoliate orange and its hybrids. Preliminary attempts to detect viruses causing citrus psorosis and CRP diseases in symptomatic orchard trees and in plants graft-inoculated with the infected sources in the greenhouse, have remained unsuccessful and no amplicon specific for Citrus psorosis virus has been obtained in PCR trials thus far. In the present study, bark patches from twigs of Satsuma mandarin (C, unshiu) trees showing psorosis young leaf symptoms and those displaying CRP symptoms on mature leaves were budded onto one-year-old seedlings of Etrog citron (C, medica, Arizona 861) and sour orange and 2-year-old Washington navel sweet orange on sour orange rootstock. The budded plants were kept in the greenhouse at 22-30°C, and observed periodically for the appearance of symptoms. Leaf flecking appeared on all citrus plants inoculated with buds from the psorosis-infected trees within one to three months. Midvein browning and leaf epinasty developed on Etrog citron seedlings budded with bark strips from several of the CRP-infected trees. Sweet orange budlings started to show some ring and line patterns in three to four years after inoculation with two CRP sources. Sour orange seedlings remained symptomless up to the termination of the experiment (year 6). Ribonucleic acid (RNA) was extracted from both symptomatic sweet orange and Etrog citron plants with TRIzol reagent (Invitrogen, Paisley, UK) and subjected to Reverse transcription-polymerase chain reaction (RT-PCR) using primers specific for CPV and citrus viroids in single PCR. The PCR products were electrophoresed on 1.5% agarose gels and stained with ethidium bromide. Bands representing those of citrus viroids including citrus bent leaf, hop stunt, citrus dwarfing, citrus bark cracking and citrus viroid VI were present in the Etrog citron and sweet orange plants inoculated with several sources of CRP and CP-like symptomatic Satsuma mandarin trees. Citrus exocortis viroid was not detectable in any sample tested. This is the first report on the simultaneous presence of multiple citrus viroids in citrus trees showing symptoms of psorosis and ring pattern diseases in Iran. [ABSTRACT FROM AUTHOR]

Background: Hesperidin, a flavanone present in citrus fruits, has been identified as a potent anticancer agent because of its proapoptotic and antiproliferative characteristics in some tumor cells. However, the precise mechanisms of action are not entirely understood. Aim: The main purpose of this study is to investigate the involvement of peroxisome proliferator-activated receptor-gamma (PPARγ) in hesperidin's anticancer actions in human pre-B NALM-6 cells, which expresses wild-type p53. Methods: The effects of hesperidin on cell-cycle distribution, proliferation, and caspase-mediated apoptosis were examined in NALM-6 cells in the presence or absence of GW9662. The expression of peroxisome proliferator-activated receptor-gamma (PPARγ), p53, phospho-IκB, Bcl-2, Bax, and XIAP proteins were focused on using the immunoblotting assay. The transcriptional activities of PPARγ and nuclear factor-kappaB (NF-κB) were analyzed by the transcription factor assay kits. The expression of PPARγ and p53 was analyzed using the RT-PCR method. Results: Hesperidin induced the expression and transcriptional activity of PPARγ and promoted p53 accumulation and downregulated constitutive NF-κB activity in a PPARγ-dependent and PPARγ-independent manner. The growth-inhibitory effect of hesperidin was partially reduced when the cells preincubated with PPARγ antagonist prior to the exposure to hesperidin. Conclusions: The findings of this study clearly demonstrate that hesperidin-mediated proapoptotic and antiproliferative actions are regulated via both PPARγ-dependent and PPARγ-independent pathways in NALM-6 cells. These data provide the first evidence that hesperidin could be developed as an agent against hematopoietic malignancies. [ABSTRACT FROM AUTHOR]

Background: "Candidatus Phytoplasma aurantifolia", is the causative agent of witches' broom disease in Mexican lime trees (Citrus aurantifolia L.), and is responsible for major losses of Mexican lime trees in Southern Iran and Oman. The pathogen is strictly biotrophic, and thus is completely dependent on living host cells for its survival. The molecular basis of compatibility and disease development in this system is poorly understood. Therefore, we have applied a cDNA- amplified fragment length polymorphism (AFLP) approach to analyze gene expression in Mexican lime trees infected by "Ca. Phytoplasma aurantifolia". Results: We carried out cDNA-AFLP analysis on grafted infected Mexican lime trees of the susceptible cultivar at the representative symptoms stage. Selective amplifications with 43 primer combinations allowed the visualisation of 55 transcript-derived fragments that were expressed differentially between infected and non-infected leaves. We sequenced 51 fragments, 36 of which were identified as lime tree transcripts after homology searching. Of the 36 genes, 70.5% were down-regulated during infection and could be classified into various functional groups. We showed that Mexican lime tree genes that were homologous to known resistance genes tended to be repressed in response to infection. These included the genes for modifier of snc1 and autophagy protein 5. Furthermore, down-regulation of genes involved in metabolism, transcription, transport and cytoskeleton was observed, which included the genes for formin, importin b 3, transducin, L-asparaginase, glycerophosphoryl diester phosphodiesterase, and RNA polymerase b. In contrast, genes that encoded a proline-rich protein, ubiquitin-protein ligase, phosphatidyl glycerol specific phospholipase C-like, and serine/threonine-protein kinase were up-regulated during the infection. Conclusion: The present study identifies a number of candidate genes that might be involved in the interaction of Mexican lime trees with "Candidatus Phytoplasma aurantifolia". These results should help to elucidate the molecular basis of the infection process and to identify genes that could be targeted to increase plant resistance and inhibit the growth and reproduction of the pathogen. [ABSTRACT FROM AUTHOR]

In the year 2000, a fungus was isolated from rotting lemon (Citrus limon) fruit in the Kahnouj region, south-eastern Iran and subsequently identified asCeratocystis radicicola(anamorph:Chalarasp.). A pathogenicity test was carried out to fulfil Koch's postulates. The pathogen could only enter the ripen lemon fruit and cause the rot disease through the wounds and cracks. The fungus was also pathogenic on fruit of other citrus species as well as date palm (Phoenix dactylifera). Symptom development was slow on fruits on the tree but accelerated after fruit harvest. [ABSTRACT FROM AUTHOR]

Twenty-four strains of Xanthomonas axonopodis pv. citri (Xac), the causal agent of bacterial canker of citrus, isolated from Mexican lime (Citrus aurantifolia) and lemon (Citrus limon) in southern Iran, were characterized phenotypically. Strains were all pathogenic on C. aurantifolia. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis analysis revealed slight differences in soluble protein profiles among the strains. Based on host range specificity and phenotypic characteristics, representative strains were differentiated into two groups of Asiatic (A) and atypical Asiatic (aA) forms. DNA fingerprinting analysis using EcoRI as the restriction endonuclease showed a negligible difference in restriction pattern between the two groups. On the basis of isozymic analysis, the two groups were distinct with respect to superoxide dismutase (SOD) and esterase (EST) banding patterns. Plasmid DNA profile analysis showed that the bacterial strains were different from each other in terms of plasmid number and molecular weight. Phage typing study revealed that most of group A strains were susceptible to Cp1 and/or Cp2 and some were resistant to both phage types including the strain in aA group. Bacteriocin production test indicated that there was a variation among Xac strains using different indicators for each bacteriocin producer. It is concluded that the Iranian strains of Xac are heterogeneous and constitute a subgroup(s) within the pathotype A. [ABSTRACT FROM AUTHOR]