Search

Background: Sheep is one of the small ruminant types widely distributed and popular in Indonesia, especially on Java Island. This study aimed to characterize male Indonesian local sheep breeds on Java Island based on their qualitative morphological traits. Methods: This study identified twenty-nine qualitative morphological characteristics in 627 head sheep consisting of Priangan, Garut, Batur, Wonosobo, Javanese Thin Tailed (JTT), Javanese Fat-Tailed (JFT) and Sapudi sheep. Data were analyzed using descriptive analysis, Chi-square analysis (X2), multiple correspondence analysis (MCA) and hierarchical clustering analysis (HCA). Data analysis was performed using SPSS version 25 and NTSYS-pc version 2.11. Result: All the qualitative morphological traits variables were significantly different (P<0.01) between the seven sheep breeds. Seven sheep breeds could be categorized into three groups: 1) JFT and Sapudi sheep; 2) JTT, Priangan and Garut sheep; and 3) Batur and Wonosobo sheep. The Garut and Batur sheep have the most distant relationship (26.781). The JFT and Sapudi sheep have the closest relationship (1.345), as well as between Batur and Wonosobo sheep (10.064) and between Priangan and JTT sheep (2.453). Garut sheep have the most distant relationship with other sheep breeds, except with Priangan (4.259) and JTT (8.157) sheep. It was concluded that male Indonesian local sheep breeds on Java Island could be characterized using qualitative morphological traits. [ABSTRACT FROM AUTHOR]

Background: Catfish is a freshwater and saltwater fish type with a wide distribution throughout the Indonesian archipelago. This study was conducted to analyze Indonesian catfish's genetic diversity and evolutionary relationships based on the mitochondrial ND6 gene. Methods: Twenty-eight catfish samples were collected from nine rivers and one ocean in seven provinces of Indonesia. The MT-ND6 gene was amplified by using a set of primers (BaungND6F and BaungND6R). The MEGA X software was used to examine the MTND6 sequences for genetic variation and phylogenetic relation between Indonesian catfish populations. Result: There were 167 nucleotide site variations and thirty-two amino acid variations in the MT-ND6 gene. The genetic difference among populations ranges from 0.9 to 25% and the average evolutionary divergence in the overall populations was 14%, with catfish BB and PM having the closest genetic distance, while the farthest is BF to MP and BF to MS. In conclusion, the phylogenetic tree indicated that there were four distinct catfish clades in this study: MP, MS, KR, PM, BB and KS had been grouped with Hemibagrus nemurus (Bagridae family), EM had been grouped with Mystus vittatus (Bagridae family), BSBJ had been grouped with Pangasius pangasius (Pangasiidae family) and PD and BF had been grouped with Netuma thalassina (Ariidae family). [ABSTRACT FROM AUTHOR]

Background: The cytochrome b (Cyt b) gene is one of the most studied mitochondrial DNA (mtDNA) genes to determine sheep's genetic profile. This study aimed to determine the genetic diversity and relationships of several Indonesian local sheep populations on Java Island, Indonesia, based on the mtDNA Cyt b gene sequences. Blood samples were collected from forty-one individual sheep in seven populations of Indonesia local sheep breeds on Java Island (Priangan = 6, Garut = 6, Batur = 7, Wonosobo = 5, Javanese Thin-Tailed/JTT = 7, Javanese Fat-Tailed/JFT = 5, and Sapudi = 5). DNA extraction was performed on blood samples, and the mtDNA Cyt b gene was amplified using specific primers (Alek-CBF: 5'-CAACCCCACCACTTACAA-3' and Alek-CBR: 5'-CCTTGAGTCTTAGGGAGGTT-3'). The polymerase chain reaction (PCR) products were then sequenced, and data were analyzed using the MEGA version 7.0, DNA SP version 6.0, and NTSYS-pc version 2.11 software. Results: A total of 1140 bp complete mtDNA Cyt b gene sequences in this study obtained 1134 monomorphic sites (I), six polymorphic sites (V), one segregation site (S), and five parsimony informative sites (P) with a nucleotide diversity (Pi), the average number of nucleotide differences (K), and sequence conservation (SC) were 0.00119, 1.35610, and 0.9947, respectively. There were six haplotypes consisting of two unique haplotypes and four shared haplotypes with a haplotype diversity (Hd) of 0.5415. The genetic distance within and between populations ranged from 0.0000 to 0.0016 and 0.0000 to 0.0020, respectively. Wonosobo, JFT, and Sapudi sheep have the closest relationship, and then these three breeds were close to JTT sheep, followed by Batur, Priangan, and Garut sheep. Two haplogroups have been found based on the Ovine haplogroup clustering. All Wonosobo, JTT, JFT, Sapudi sheep, and most Batur sheep were clustered into haplogroup B. In contrast, Garut sheep were mostly clustered into haplogroup A, while Priangan sheep were clustered into both haplogroups with the same percentage. Conclusion: Seven Indonesian local sheep breeds on Java Island have a close relationship clustered into two haplogroups, namely haplogroups A and B. Most Indonesian local sheep breeds on Java Island in this study were clustered into haplogroup B, except for Garut and Priangan sheep. [ABSTRACT FROM AUTHOR]

Background and Aim: The Samosir goat has a high cultural value and is a source of germplasm in Indonesia. This study aimed to reveal the history and selection signatures of the Samosir goat. Materials and Methods: A total of 25 goats were divided into seven subpopulations of Indonesian goat breeds. Deoxyribonucleic acid (DNA) from blood samples was isolated with the use of the gSYNC™ DNA Mini Kit (Geneaid, Taipei, Taiwan). Cytb gene amplification was performed by the polymerase chain reaction (PCR) method, and the PCR products were sequenced. A phylogenetic tree was constructed by the neighbor-joining method using MEGA 11 software. A questionnaire was used to collect information related to the history and breeding practices of the Samosir goat on Samosir Island. Results: Samosir goats are divided into four groups based on their coat color: Completely white, white with brown spots, white with black spots, and white with brown and black spots. The body form of the Samosir goat is similar to that of the Kacang goat. The space below a traditional Toba Batak house is used as a goat pen. The genetic difference between the Samosir goat and the Kacang goat based on the Cytb gene was approximately 0.1%. Conclusion: Phylogenetic analysis between Samosir goats and other indigenous Indonesian goats revealed that Samosir goats form a single clade, with a very close genetic distance from other local goats, such as the Kacang goat. The Toba Batak culture on Samosir Island has significantly influenced the selection and formation of the Samosir goat breed. [ABSTRACT FROM AUTHOR]

Background and Aim: Baung fish is an essential commodity in Indonesia; however, few studies have explored the genetic diversity of Indonesian catfish. Thus, this study aimed to analyze the genetic variation and phylogenetic relationships among Indonesian catfish based on the mitochondrial 12S ribosomal RNA (rRNA) gene. Materials and Methods: In total, 28 catfish were collected from nine rivers in seven provinces and from the Indian Ocean. Catfish genomes were obtained from epaxial and hepaxial muscle samples. The mitochondrial 12S rRNA gene was amplified by polymerase chain reaction using a pair of primers (Baung12SF and Baung12SR). The 12S rRNA sequences were analyzed using MEGA X to determine genetic variation and phylogenetic relationships. Results: In total, 178 variation sites in the 12S rRNA gene were substituted among Indonesian catfish. The genetic distance between all Indonesian catfish samples was 0.1-16.0%. The closest genetic distance was between MP and PM catfish, whereas the farthest genetic distances were between BF and EM and PD and EM. For the entire population, based on mean diversity calculations, the number of base substitutions per site was 0.08. Conclusion: Indonesian catfish were divided into four clades based on the 12S rRNA gene. The catfish MP, KR, PM, MS, BB, and KS were grouped with Hemibagrus nemurus, the catfish EM was grouped with Mystus vittatus, the catfish BSBJ was grouped with Pangasius pangasius, and the catfish PD and BF were grouped with Netuma thalassina. [ABSTRACT FROM AUTHOR]

Goats are important livestock in Indonesia as a source of animal protein and income. Indonesia has several indigenous goat breeds with distinct characteristics. 379 unrelated goats were randomly selected from seven indigenous Indonesian goat breeds and collected from individual farmers in various Indonesian provinces. Microsatellite characterization of indigenous Indonesian goats was carried out using 12 specific microsatellite markers. The total number of alleles obtained from the 12 microsatellite loci was 97, with an average score of 8.08, and the number of effective alleles ranged from 1.413 (ILSTS005) to 4168 (INRA23), with an average value of 2.608. A total of 11 private alleles was found in some goat breeds, but the frequencies were very low, 0.71 – 8.86%. The average of polymorphic information content ranged from 0.239 (ETH10) to 0.726 (INRA23). The mean rate of inbreeding value between populations (Fis) was 0.050, and within the population (Fit) was 0.151. The mean expected heterozygosity was 0.54, and the mean observed heterozygosity was 0.52. Except for the Gembrong goat (GEM), the observed number of alleles, polymorphic information content, and expected heterozygosity were all moderate. This study will support the management of livestock genetic resources and conserving endangered Indonesian goat breeds, such as the Gembrong goat. • The Indonesian archipelago is populated by several indigenous local goat breeds. • This study was conducted using 12 microsatellite markers of goats recommended by FAO and a total sample of 379 goats. • This study is an important contribution to livestock genetic resources management and conservation of Indonesian goat breeds. • The genetic diversity of Indonesian goat breeds is moderate level. [ABSTRACT FROM AUTHOR]

Background and Aim: The availability of fertility markers is crucial for maintaining, protecting, and improving the genetics of Jawa-Brebes (Jabres) cows. Follicle-stimulating hormone receptor (FSHR) and insulin-like growth factor-1 (IGF-1) play critical roles in female reproductive physiology. The single-nucleotide polymorphisms (SNPs) FSHR G-278A and IGF-1 C-512T correlate with cows' fertility traits. This study aimed to identify these SNPs and their potential associations with fertility parameters in Jabres cows. Materials and Methods: Samples were collected from 45 heads of multiparous Jabres cows aged 3-10 years with body condition scores of 2.5-5.0 on a 5-point scale in Brebes Regency, Java, Indonesia. These cows were assigned to fertile (n = 16) and infertile groups (n = 29). Polymerase chain reaction (PCR) was carried out for DNA amplification of FSHR G-278A and IGF-1 C-512T fragments. Restriction fragment length polymorphism-PCR with the restriction enzymes FaqI for the product of FSHR G-278A and SnaBI for the product of IGF-1 C-512T was used to identify SNPs. Results: The FaqI enzyme cut the 211 bp DNA fragment of FSHR G-278A in all samples into two bands of 128 bp and 83 bp (GG genotype). Meanwhile, the genotyping of amplicon products of IGF-1 C-512T generated a single 249 bp fragment (CC genotype) in both groups. Conclusion: The results showed that the FSHR G-278A/FaqI and IGF-1 C-512T/SnaBI loci were monomorphic in Jabres cows. Thus, neither FSHR G-278A/FaqI nor IGF-1 C-512T/SnaBI is a possible genetic marker for fertility in Jabres cows. [ABSTRACT FROM AUTHOR]

Background and Aim: Eid al-Adha is one of the most important festivals celebrated by Muslims in Indonesia. Roadside livestock traders open their stalls during the Eid al-Adha period. This study aimed to investigate the characteristics and behaviors of roadside livestock traders in urban and peri-urban areas in Yogyakarta, Indonesia. Materials and Methods: In-depth interviews with 36 roadside livestock traders were conducted on August 7-23, 2018 in urban (n=20) and peri-urban (n=16) areas of Yogyakarta. The collected data were analyzed by descriptive and statistical analysis using one-way analysis of variance. Results: The results indicate that the trading activities of roadside livestock traders in urban areas last longer (p<0.05) than in peri-urban areas. No difference was found in the opening day of stalls, the number of buyers, and trends in animal prices set by roadside livestock traders in urban and peri-urban areas. Most traders sell sheep and goats, buy livestock at the animal market, and only open their stalls during Eid al-Adha. Prices are high in this period, and buyers directly visit the stalls. A significant difference exists in the selling price of livestock between Eid al-Adha and ordinary days (non-festival), and most roadside traders benefit from the Eid al-Adha momentum. Conclusion: Significant similarities exist among roadside livestock traders during the Eid al-Adha period in urban and peri-urban areas of Yogyakarta, Indonesia. Sheep are more desirable than goats and cattle in this period, and Eid al-Adha generates a high profit for roadside livestock traders. [ABSTRACT FROM AUTHOR]

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures. [ABSTRACT FROM AUTHOR]

Background and Aim: Aedes aegypti is the vector of dengue fever, dengue hemorrhagic fever, chikungunya, and, most recently, Zika. Dengue fever is one of Indonesia's endemic diseases. The principal tool for preventing dengue is controlling Ae. aegypti by chemical insecticides since vaccine against dengue is still under research. However, Ae. aegypti developed resistance to various chemical insecticides worldwide. Therefore, research on alternate compounds as mosquito insecticides is urgently needed. This study demonstrated the efficacy of Artemisia vulgaris extract as larvicidal, ovicidal, adulticidal, repellency, and oviposition deterrent activity against Ae. aegypti. Materials and Methods: A. vulgaris was obtained from Temanggung, Indonesia, while the eggs of Ae. aegypti were collected from Yogyakarta, Indonesia, and were hatched in Laboratory of Parasitology, Faculty of Veterinary Medicine, Universitas Gadjah Mada. Larvicidal activity was evaluated according to the WHO protocol; adulticidal activity was performed using the Centers for Disease Control protocol. Oviposition activity was evaluated using ovitraps added with A. vulgaris extract, complete protection time in the repellent assay was defined as the number of minutes elapsed between compound application and the landing of the first mosquito. Results: A test of the larvicidal activity of A. vulgaris extract returned an LC50 of 65.8 ppm (r2=0.9014) in 1 h and 18.6 ppm (r2=0.575) in 24 h. A. vulgaris was effective as an adulticidal, demonstrating LC50 values of 11.35 mg (r2=0.875) in 90 min, 9.63 mg (r2=0.924) in 105 min, and 6.46 mg (r2=0.925) in 120 min. A. vulgaris at a concentration of 1000 ppm was able to reach 96% of oviposition deterrent effect. The ovicidal assay, a concentration of 1000 ppm resulted in 82.67% of eggs remaining unhatched. An extract concentration of 80 mg/ml achieved 63.3±3.5% biting repellency in adults. Conclusion: This study gives a clear indication that A. vulgaris extract acts on Ae. aegypti at various developmental stages and is a potential alternative bioinsecticide for controlling this disease vector. [ABSTRACT FROM AUTHOR]

Scrapie is a naturally occurring transmissible spongiform encephalopathy in sheep and goats. Resistance or susceptibility of small ruminants to classical scrapie is influenced by polymorphisms in the prion protein gene (PRNP). PRNP variability in Indonesian indigenous goat breeds has not been investigated so far and therefore was the goal of this study. Sanger sequencing of the PRNP gene coding region in 72 goats of the seven Indonesian breeds Kacang, Gembrong, Samosir, Kejobong, Benggala, Jawarandu, and Peranakan Etawah revealed three amino acid substitutions, namely W102G, H143R, and S240P. Some silent mutations were also found at codons 42 (a/g), 138 (c/t), and 179 (g/t). The PRNP alleles K222 and D/S146 known to have significant protective effects on resistance to classical scrapie in goats were not detected. The allele R143, which may have a moderate protective effect, had a frequency of 12% among the analyzed Indonesian goat breeds. While R143 was missing in Kacang and Benggala, its frequency was highest in the breed Gembrong (32%). No scrapie cases have been reported in Indonesia until now. However, in the case that selection for protective PRNP variants would become a breeding goal, the analyzed breeds will not be very useful resources. Other goat breeds which are present in the country should be investigated regarding resistance to scrapie, too., (© 2023. The Author(s).)