Search

About 7% of the human genome encodes cis-regulatory elements (CREs) that function as regulatory switches to modulate the expression of genes. These short genetic sequences control the complex transcriptional changes necessary for organismal development. A topical challenge in the field is to understand how transcription factors (TFs) read and translate this information into gene expression patterns. Here, I review how the development of single-molecule footprinting (SMF) that resolves the genome occupancy of TFs on individual DNA molecules resolution contributes to our ability to establish how the regulatory genetic information is interpreted at the mechanistic level. I further discuss how future developments in the nascent field of single-molecule genomics (SMG) could impact our understanding of gene regulation mechanisms., Competing Interests: Declaration of interests No interests are declared., (Copyright © 2021 Elsevier Ltd. All rights reserved.)

Nucleosomes are the fundamental building blocks of chromatin that regulate DNA access and are composed of histone octamers. ATP-dependent chromatin remodelers like ISW2 regulate chromatin access by translationally moving nucleosomes to different DNA regions. We find that histone octamers are more pliable than previously assumed and distorted by ISW2 early in remodeling before DNA enters nucleosomes and the ATPase motor moves processively on nucleosomal DNA. Uncoupling the ATPase activity of ISW2 from nucleosome movement with deletion of the SANT domain from the C terminus of the Isw2 catalytic subunit traps remodeling intermediates in which the histone octamer structure is changed. We find restricting histone movement by chemical crosslinking also traps remodeling intermediates resembling those seen early in ISW2 remodeling with loss of the SANT domain. Other evidence shows histone octamers are intrinsically prone to changing their conformation and can be distorted merely by H3-H4 tetramer disulfide crosslinking., (Copyright © 2019 The Authors. Published by Elsevier Inc. All rights reserved.)

Analysis of the Agrobacterium tumefaciens C58 genome revealed a potential Zur (zinc uptake regulator) binding site (5'-GATATGTTATTACATTAC-3', the underlined letters are the center of symmetry of the inverted palindrome) located in the upstream region of atu3184, whose gene product is a member of the COG0523 subfamily of G3E GTPases. The specific interaction of the Zur protein with the 18-bp inverted repeat operator motif in the presence of zinc was demonstrated in vitro by a DNA band shift assay and a DNase I footprinting assay. A LacZ reporter fusion assay further confirmed that Zur negatively regulates atu3184 promoter activity in vivo. The expression of atu3184 was upregulated in response to zinc limitation in the wild-type strain, but the zur mutant strain exhibited high-level constitutive expression of atu3184 under all conditions, irrespective of the zinc levels. It is likely that A. tumefaciens Zur senses zinc and directly regulates the atu3184 promoter by a molecular mechanism similar to that of Escherichia coli Zur, where the operator DNA is surrounded by four Zur monomers forming two dimers bound on the opposite sides of the DNA duplex. Disruption of atu3184 did not affect cell growth under metal-limited conditions and had no effect on the total cellular zinc content. Furthermore, an A. tumefaciens strain lacking atu3184 caused a tumor disease in a host plant., (Copyright © 2019 Elsevier GmbH. All rights reserved.)

Background: DNase-seq and ATAC-seq are broadly used methods to assay open chromatin regions genome-wide. The single nucleotide resolution of DNase-seq has been further exploited to infer transcription factor binding sites (TFBSs) in regulatory regions through footprinting. Recent studies have demonstrated the sequence bias of DNase I and its adverse effects on footprinting efficiency. However, footprinting and the impact of sequence bias have not been extensively studied for ATAC-seq., Results: Here, we undertake a systematic comparison of the two methods and show that a modification to the ATAC-seq protocol increases its yield and its agreement with DNase-seq data from the same cell line. We demonstrate that the two methods have distinct sequence biases and correct for these protocol-specific biases when performing footprinting. Despite the differences in footprint shapes, the locations of the inferred footprints in ATAC-seq and DNase-seq are largely concordant. However, the protocol-specific sequence biases in conjunction with the sequence content of TFBSs impact the discrimination of footprint from the background, which leads to one method outperforming the other for some TFs. Finally, we address the depth required for reproducible identification of open chromatin regions and TF footprints., Conclusions: We demonstrate that the impact of bias correction on footprinting performance is greater for DNase-seq than for ATAC-seq and that DNase-seq footprinting leads to better performance. It is possible to infer concordant footprints by using replicates, highlighting the importance of reproducibility assessment. The results presented here provide an overview of the advantages and limitations of footprinting analyses using ATAC-seq and DNase-seq.

Vibrio parahaemolyticus is a marine bacterium that is globally recognized as the leading cause of seafood-borne gastroenteritis. V. parahaemolyticus uses various toxins and two type 3 secretion systems (T3SS-1 and T3SS-2) to subvert host cells during infection. We previously determined that V. parahaemolyticus T3SS-1 activity is upregulated by increasing the expression level of the master regulator ExsA under specific growth conditions. In this study, we set out to identify V. parahaemolyticus genes responsible for linking environmental and growth signals to exsA gene expression. Using transposon mutagenesis in combination with a sensitive and quantitative luminescence screen, we identify HlyU and H-NS as two antagonistic regulatory proteins controlling the expression of exsA and, hence, T3SS-1 in V. parahaemolyticus Disruption of hns leads to constitutive unregulated exsA gene expression, consistent with its known role in repressing exsA transcription. In contrast, genetic disruption of hlyU completely abrogated exsA expression and T3SS-1 activity. A V. parahaemolyticus hlyU infection. DNA footprinting studies with purified HlyU revealed a 56-bp protected DNA region within the in vitro infection. DNA footprinting studies with purified HlyU revealed a 56-bp protected DNA region within the exsA promoter that contains an inverted repeat sequence. Genetic evidence suggests that HlyU acts as a derepressor, likely by displacing H-NS from the exsA promoter, leading to exsA gene expression and appropriately regulated T3SS-1 activity. Overall, the data implicate HlyU as a critical positive regulator of V. parahaemolyticus T3SS-1-mediated pathogenesis. IMPORTANCE Many Vibrio species are zoonotic pathogens, infecting both animals and humans, resulting in significant morbidity and, in extreme cases, mortality. While many Vibrio species virulence genes are known, their associated regulation is often modestly understood. We set out to identify genetic factors of V. parahaemolyticus that are involved in activating exsA gene expression, a process linked to a type III secretion system involved in host cytotoxicity. We discover that V. parahaemolyticus employs a genetic regulatory switch involving H-NS and HlyU to control exsA promoter activity. While HlyU is a well-known positive regulator of Vibrio species virulence genes, this is the first report linking it to a transcriptional master regulator and type III secretion system paradigm., (Copyright © 2018 American Society for Microbiology.)

The mitochondrial transcription initiation machinery in humans consists of three proteins: the RNA polymerase (POLRMT) and two accessory factors, transcription factors A and B2 (TFAM and TFB2M, respectively). This machinery is required for the expression of mitochondrial DNA and the biogenesis of the oxidative phosphorylation system. Previous experiments suggested that TFB2M is required for promoter melting, but conclusive experimental proof for this effect has not been presented. Moreover, the role of TFB2M in promoter unwinding has not been discriminated from that of TFAM. Here we used potassium permanganate footprinting, DNase I footprinting, and in vitro transcription from the mitochondrial light-strand promoter to study the role of TFB2M in transcription initiation. We demonstrate that a complex composed of TFAM and POLRMT was readily formed at the promoter but alone was insufficient for promoter melting, which only occurred when TFB2M joined the complex. We also show that mismatch bubble templates could circumvent the requirement of TFB2M, but TFAM was still required for efficient initiation. Our findings support a model in which TFAM first recruits POLRMT to the promoter, followed by TFB2M binding and induction of promoter melting., (© 2017 by The American Society for Biochemistry and Molecular Biology, Inc.)

The development of the male germline within pollen relies upon the activation of numerous target genes by the transcription factor DUO POLLEN1 (DUO1). The expression of DUO1 is restricted to the male germline and is first detected shortly after the asymmetric division that segregates the germ cell lineage. Transcriptional regulation is critical in controlling DUO1 expression, since transcriptional and translational fusions show similar expression patterns. Here, we identify key promoter sequences required for the germline-specific regulation of DUO1 transcription. Combining promoter deletion analyses with phylogenetic footprinting in eudicots and in Arabidopsis accessions, we identify a cis-regulatory module, Regulatory region of DUO1 (ROD1), which replicates the expression pattern of DUO1 in Arabidopsis (Arabidopsis thaliana). We show that ROD1 from the legume Medicago truncatula directs male germline-specific expression in Arabidopsis, demonstrating conservation of DUO1 regulation among eudicots. ROD1 contains several short conserved cis-regulatory elements, including three copies of the motif DNGTGGV, required for germline expression and tandem repeats of the motif YAACYGY, which enhance DUO1 transcription in a positive feedback loop. We conclude that a cis-regulatory module conserved in eudicots directs the spatial and temporal expression of the transcription factor DUO1 to specify male germline fate and sperm cell differentiation., (© 2017 The author(s). All Rights Reserved.)

Clostridium perfringens is a Gram-positive, anaerobic, spore-forming bacterium that causes human gas gangrene (clostridial myonecrosis) and food poisoning. Early studies showed that virulence was regulated by the VirSR two-component signal transduction system. However, our identification of the RevR orphan response regulator indicated that more than one system was involved in controlling virulence. To further characterize this virulence-associated regulator, gel mobility shift experiments, coupled with DNase I footprinting, were used to identify the RevR DNA binding sequence. Bioinformatics analysis suggested that an orphan sensor histidine kinase, CPE1757 (renamed RevS), was the cognate sensor of RevR. Interaction between RevS and RevR was demonstrated by use of a bacterial two-hybrid system and validated by protein-protein interaction studies using biolayer interferometry. To assess the involvement of RevS in virulence regulation, the revS gene was inactivated by Targetron insertion. When isogenic wild-type, revS and complemented revS strains were tested in a mouse myonecrosis model, the revS mutant was found to be attenuated in virulence, which was similar to the attenuation observed previously with the revR mutant. However, transcriptional analysis of selected RevR-regulated genes in the revS mutant revealed a different pattern of expression to a revR mutant, suggesting that the RevSR system is more complex than originally thought. Taken together, the results have led to the identification and characterization of the two essential parts of a new regulatory network that is involved in the regulation of virulence in C. perfringens., (Copyright © 2016 Elsevier GmbH. All rights reserved.)

Transcriptional regulation of capsule expression is critical for pneumococcal transition from carriage to infection, yet the underlying mechanism remains incompletely understood. Here, we describe the regulation of capsular polysaccharide, one of the most important pneumococcal virulence factor by a GntR family regulator, CpsR. Electrophoretic mobility-shift assays have shown the direct interaction between CpsR and the cps promoter (cpsp), and their interaction could be competitively interfered by glucose. DNase I footprinting assays localized the binding site to a region -146 to -114 base pairs relative to the transcriptional start site of the cps locus in S. pneumoniae D39. We found that CpsR negatively controlled the transcription of the cps locus and hence CPS production, which was confirmed by fine-tuning expression of CpsR in a ΔcpsR complemented strain. Increased expression of CpsR in complemented strain led to a decreased resistance to the whole-blood-mediated killing, suggesting a protective role for CpsR-cpsp interaction in the establishment of invasive infection. Finally, animal experiments showed that CpsR-cpsp interaction was necessary for both pneumococcal colonization and invasive infection. Taken together, our results provide a thorough insight into the regulation of capsule production mediated by CpsR and its important roles in pneumococcal pathogenesis.

SCO6256 belongs to the GntR family and shows 74% identity with SCO6974, which is the repressor of myo-inositol catabolism in Streptomyces coelicolor A3(2). Disruption of SCO6256 significantly enhanced the transcription of myo-inositol catabolic genes in R2YE medium. The purified recombinant SCO6256 directly bound to the upstream regions of SCO2727, SCO6978 and SCO6985, as well as its encoding gene. Footprinting assays demonstrated that SCO6256 bound to the same sites in the myo-inositol catabolic gene cluster as SCO6974. The expression of SCO6256 was repressed by SCO6974 in minimal medium with myo-inositol as the carbon source, but not in R2YE medium. Glutathione-S-transferase pull-down assays demonstrated that SCO6974 and SCO6256 interacted with each other; and both of the proteins controlled the transcription of myo-inositol catabolic genes in R2YE medium. These results indicated SCO6256 regulates the transcription of myo-inositol catabolic genes in coordination with SCO6974 in R2YE medium. In addition, SCO6256 negatively regulated the production of actinorhodin and calcium-dependent antibiotic via control of the transcription of actII-ORF4 and cdaR. SCO6256 bound to the upstream region of cdaR and the binding sequence was proved to be TTTCGGCACGCAGACAT, which was further confirmed through base substitution. Four putative targets (SCO2652, SCO4034, SCO4237 and SCO6377) of SCO6256 were found by screening the genome sequence of Strep. coelicolor A3(2) based on the conserved binding motif, and confirmed by transcriptional analysis and electrophoretic mobility shift assays. These results revealed that SCO6256 is involved in the regulation of myo-inositol catabolic gene transcription and antibiotic production in Strep. coelicolor A3(2).

Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

Daptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producer Streptomyces roseosporus SW0702 using a biotinylated dptE promoter (dptEp) as a probe. The direct interaction between DepR1 and dptEp then was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion of depR1 led to a reduction in dptEp activity and the cessation of daptomycin production. The ΔdepR1 mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression of depR1 raised daptomycin production and shortened the fermentation period both in flask and in fermentor., (Copyright © 2016, American Society for Microbiology. All Rights Reserved.)

Bacteria sense and respond to the stress of phosphate limitation, anticipating Pi deletion/starvation via the two-component PhoR-PhoP system. The role of the response regulator PhoP in primary metabolism and avermectin biosynthesis in Streptomyces avermitilis was investigated. In response to phosphate starvation, S. avermitilis PhoP, like Streptomyces coelicolor and Streptomyces lividans PhoP, activates the expression of phoRP, phoU, and pstS by binding to the PHO boxes in their promoter regions. Avermectin biosynthesis was significantly increased in ΔphoP deletion mutants. Electrophoretic mobility gel shift assay (EMSA) and DNase I footprinting assays showed that PhoP can bind to a PHO box formed by two direct repeat units of 11 nucleotides located downstream of the transcriptional start site of aveR. By negatively regulating the transcription of aveR, PhoP directly affects avermectin biosynthesis in S. avermitilis. PhoP indirectly affects melanogenesis on Casaminoacids Minimal Medium (MMC) lacking supplemental phosphate. Nitrogen metabolism and some key genes involved in morphological differentiation and antibiotic production in S. avermitilis are also under the control of PhoP.

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus., (Copyright © 2015, American Society for Microbiology. All Rights Reserved.)

The genome-scale delineation of in vivo protein-DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein-DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein-DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences., (© The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Enterococcus faecalis BM4518 is resistant to vancomycin by synthesis of peptidoglycan precursors ending in D-alanyl-D-serine. In the chromosomal vanG locus, transcription of the resistance genes from the PYG resistance promoter is inducible and, upstream from these genes, there is an unusual three-component regulatory system encoded by the vanURS(G) operon from the P(UG) regulatory promoter. In contrast to the other van operons in enterococci, the vanG operon possesses the additional vanU(G) gene which encodes a transcriptional regulator whose role remains unknown. We show by DNase I footprinting, RT-qPCR, and reporter proteins activities that VanU(G), but not VanR(G), binds to P(UG) and negatively autoregulates the vanURS(G) operon and that it also represses PYG where it overlaps with VanR(G) for binding. In clinical isolate BM4518, the transcription level of the resistance genes was dependent on vancomycin concentration whereas, in a ΔvanUG mutant, resistance was expressed at a maximum level even at low concentrations of the inducer. The binding competition between VanU(G) and VanR(G) on the P(YG) resistance promoter allowed rheostatic activation of the resistance operon depending likely on the level of VanR(G) phosphorylation by the VanS(G) sensor. In addition, there was cross-talk between VanS(G) and VanR'(G), a VanR(G) homolog, encoded elsewhere in the chromosome indicating a sophisticated and subtle regulation of vancomycin resistance expression by a complex two-component system.

Two-component systems [sensor kinase/response regulator (RR)] are major tools used by microorganisms to adapt to environmental conditions. RR phosphorylation is typically required for gene activation, but few studies have addressed how and if phosphorylation affects specific steps during transcription initiation. We characterized transcription complexes made with RNA polymerase and the Bordetella pertussis RR, BvgA, in its nonphosphorylated or phosphorylated (BvgA∼P) state at P(fim3), the promoter for the virulence gene fim3 (fimbrial subunit), using gel retardation, potassium permanganate and DNase I footprinting, cleavage reactions with protein conjugated with iron bromoacetamidobenzyl-EDTA, and in vitro transcription. Previous work has shown that the level of nonphosphorylated BvgA remains high in vivo under conditions in which BvgA is phosphorylated. Our results here indicate that surprisingly both BvgA and BvgA∼P form open and initiating complexes with RNA polymerase at P(fim3). However, phosphorylation of BvgA is needed to generate the correct conformation that can transition to competent elongation. Footprints obtained with the complexes made with nonphosphorylated BvgA are atypical; while the initiating complex with BvgA synthesizes short RNA, it does not generate full-length transcripts. Extended incubation of the BvgA/RNA polymerase initiated complex in the presence of heparin generates a stable, but defective species that depends on the initial transcribed sequence of fim3. We suggest that the presence of nonphosphorylated BvgA down-regulates P(fim3) activity when phosphorylated BvgA is present and may allow the bacterium to quickly adapt to the loss of inducing conditions by rapidly eliminating P(fim3) activation once the signal for BvgA phosphorylation is removed.

The basic body plan and major physiological axes have been highly conserved during mammalian evolution, yet only a small fraction of the human genome sequence appears to be subject to evolutionary constraint. To quantify cis- versus trans-acting contributions to mammalian regulatory evolution, we performed genomic DNase I footprinting of the mouse genome across 25 cell and tissue types, collectively defining ∼8.6 million transcription factor (TF) occupancy sites at nucleotide resolution. Here we show that mouse TF footprints conjointly encode a regulatory lexicon that is ∼95% similar with that derived from human TF footprints. However, only ∼20% of mouse TF footprints have human orthologues. Despite substantial turnover of the cis-regulatory landscape, nearly half of all pairwise regulatory interactions connecting mouse TF genes have been maintained in orthologous human cell types through evolutionary innovation of TF recognition sequences. Furthermore, the higher-level organization of mouse TF-to-TF connections into cellular network architectures is nearly identical with human. Our results indicate that evolutionary selection on mammalian gene regulation is targeted chiefly at the level of trans-regulatory circuitry, enabling and potentiating cis-regulatory plasticity.

The Bacillus subtilis ilv-leu operon functions in the biosynthesis of branched-chain amino acids. It undergoes catabolite activation involving a promoter-proximal cre which is mediated by the complex of CcpA and P-Ser-HPr. This activation of ilv-leu expression is negatively regulated through CodY binding to a high-affinity site in the promoter region under amino acid-rich growth conditions, and it is negatively regulated through TnrA binding to the TnrA box under nitrogen-limited growth conditions. The CcpA-mediated catabolite activation of ilv-leu required a helix face-dependent interaction of the complex of CcpA and P-Ser-HPr with RNA polymerase and needed a 19-nucleotide region upstream of cre for full activation. DNase I footprinting indicated that CodY binding to the high-affinity site competitively prevented the binding of the complex of CcpA and P-Ser-HPr to cre. This CodY binding not only negated catabolite activation but also likely inhibited transcription initiation from the ilv-leu promoter. The footprinting also indicated that TnrA and the complex of CcpA and P-Ser-HPr simultaneously bound to the TnrA box and the cre site, respectively, which are 112 nucleotides apart; TnrA binding to its box was likely to induce DNA bending. This implied that interaction of TnrA bound to its box with the complex of CcpA and P-Ser-HPr bound to cre might negate catabolite activation, but TnrA bound to its box did not inhibit transcription initiation from the ilv-leu promoter. Moreover, this negation of catabolite activation by TnrA required a 26-nucleotide region downstream of the TnrA box., (Copyright © 2014, American Society for Microbiology. All Rights Reserved.)

Two regulatory genes, jadR2 and jadR3, in the jadomycin (jad) biosynthetic gene cluster of Streptomyces venezuelae encode homologues of γ-butyrolactone receptor. JadR2 was previously shown to be a pseudo γ-butyrolactone receptor. jadR3 is situated at the upstream of jadW123 encoding putative enzymes for γ-butyrolactone biosynthesis. Disruption of jadR3 resulted in markedly decreased production of jadomycin. Transcriptional analysis revealed that JadR3 represses jadW1, jadR2 and jadR3 but activates jadR1, the key activator gene for jadomycin biosynthesis. DNase I footprinting showed that JadR3 has four binding sites in the intergenic regions of jadR2-jadR1 and jadR3-jadW1. A JadR3 interactive molecule, SVB1, was purified from a large-scale fermentation and its structure found to be the same as SCB3, a γ-butyrolactone from Streptomyces coelicolor, and was absent from a jadW123 mutant lacking jadomycin production. Addition of SVB1 or extract from S. coelicolor to the mutant restored jadomycin production. Overall, our results revealed that the association of JadR3 and SVB1 plays an important role in controlling a regulatory mini-network governing jadomycin biosynthesis, providing new insights into the ways in which γ-butyrolactone/receptor systems modulate antibiotic biosynthesis in Streptomyces., (© 2014 John Wiley & Sons Ltd.)

Genomic footprinting has emerged as an unbiased discovery method for transcription factor (TF) occupancy at cognate DNA in vivo. A basic premise of footprinting is that sequence-specific TF-DNA interactions are associated with localized resistance to nucleases, leaving observable signatures of cleavage within accessible chromatin. This phenomenon is interpreted to imply protection of the critical nucleotides by the stably bound protein factor. However, this model conflicts with previous reports of many TFs exchanging with specific binding sites in living cells on a timescale of seconds. We show that TFs with short DNA residence times have no footprints at bound motif elements. Moreover, the nuclease cleavage profile within a footprint originates from the DNA sequence in the factor-binding site, rather than from the protein occupying specific nucleotides. These findings suggest a revised understanding of TF footprinting and reveal limitations in comprehensive reconstruction of the TF regulatory network using this approach.

Mammalian embryonic stem cells (ESCs) and sperm exhibit unusual chromatin packaging that plays important roles in cellular function. Here, we extend a recently developed technique, based on deep paired-end sequencing of lightly digested chromatin, to assess footprints of nucleosomes and other DNA-binding proteins genome-wide in murine ESCs and sperm. In ESCs, we recover well-characterized features of chromatin such as promoter nucleosome depletion and further identify widespread footprints of sequence-specific DNA-binding proteins such as CTCF, which we validate in knockdown studies. We document global differences in nuclease accessibility between ESCs and sperm, finding that the majority of histone retention in sperm preferentially occurs in large gene-poor genomic regions, with only a small subset of nucleosomes being retained over promoters of developmental regulators. Finally, we describe evidence that CTCF remains associated with the genome in mature sperm, where it could play a role in organizing the sperm genome., (Copyright © 2014 Elsevier Inc. All rights reserved.)

In Anabaena, the pipX gene is induced in the cells differentiating into heterocysts, being the PipX factor required for full expression of late heterocyst-specific genes. Here we show that PipX has a positive effect on in vitro binding of the transcription factor NtcA to DNA, as well as on transcript production, in different NtcA-dependent promoters. We found that the cox3 operon, encoding a heterocyst-specific terminal respiratory oxidase, is expressed from three nitrogen-regulated promoters to which NtcA binds. At the three sites, NtcA binding is potentiated by PipX. Thus, PipX has a direct effect on gene expression influencing the activity of NtcA., (Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.)

IscR is a global transcriptional regulator that contributes to the pathogenesis of Vibrio vulnificus, a food-borne pathogen. In the present study, the regulatory mechanism for the iscR expression of V. vulnificus was evaluated. The expression of iscR was found to be upregulated by a transcriptional regulator AphA, a homologue of the low cell density regulator AphA of the Vibrio species, in the exponential phase of growth. The promoter activity of iscR appeared to be activated and repressed by AphA and IscR, respectively. EMSA and DNase I protection assay showed that both AphA and IscR bind to the iscR regulatory region and the binding site for AphA overlapped with part of the binding site for IscR. Further mutational analysis suggested that AphA upregulates the iscR expression only in the presence of functional IscR. An examination of the roles of AphA and the binding sites revealed that the binding of AphA would hinder the IscR-mediated repression of the iscR transcription. The combined results show that V. vulnificus AphA upregulates iscR expression by antagonizing its negative autoregulation.

The qsu operon of Corynebacterium glutamicum comprises four genes (qsuABCD) that underpin the microorganism's quinate/shikimate utilization pathways. The genes encode enzymes that catalyse reactions at the metabolic branch point between the biosynthesis route for synthesis of aromatic compounds and the catabolic route for degradation of quinate and shikimate for energy production. A qsuR gene located immediately upstream of qsuA encodes a protein (QsuR) which activates the operon in the presence of quinate or shikimate. Three observations support chorismate, an intermediate of the biosynthesis route, as a direct effector of QsuR: First, induction of qsuA mRNA in the presence of either quinate or shikimate disappears upon deletion of the gene encoding chorismate synthase. Second, chorismate accumulates when the operon is induced. Third, a DNase I-protected segment by QsuR is shortened in the presence of chorismate. The QsuR tetramer senses the accumulation of chorismate and activates qsu genes that promote the quinate/shikimate catabolic instead of the aromatic compounds biosynthetic route. Such chorismate-dependent control of carbon flow has not been previously described., (© 2014 John Wiley & Sons Ltd.)

LeuO is a quiescent LysR-type regulator belonging to the H-NS regulon. Activation of leuO transcription represses expression of pathogenicity island 1 (SPI-1) in Salmonella enterica serovar Typhimurium and inhibits invasion of epithelial cells. Loss of HilE suppresses LeuO-mediated downregulation of SPI-1. Activation of leuO transcription reduces the level of HilD protein, and loss of HilE restores the wild type HilD level. Hence, LeuO-mediated downregulation of SPI-1 may involve inhibition of HilD activity by HilE, a view consistent with the fact that HilE is a HilD inhibitor. In vivo analyses using β-galactosidase fusions indicate that LeuO activates hilE transcription. In vitro analyses by slot blotting, electrophoretic mobility shift analysis and DNase I footprinting show that LeuO binds the hilE promoter region. Although residual SPI-1 repression by LeuO is observed in the absence of HilE, the LeuO-HilE-HilD 'pathway' appears to be the major mechanism. Because both leuO and SPI-1 are repressed by H-NS, activation of leuO transcription may provide a backup mechanism for SPI-1 repression under conditions that impair H-NS-mediated silencing., (© 2013 John Wiley & Sons Ltd.)

The tetrapyrroles haem, bacteriochlorophyll and cobalamin (B12 ) exhibit a complex interrelationship regarding their synthesis. In this study, we demonstrate that AerR functions as an antirepressor of the tetrapyrrole regulator CrtJ. We show that purified AerR contains B12 that is bound to a conserved histidine (His145) in AerR. The interaction of AerR to CrtJ was further demonstrated in vitro by pull down experiments using AerR as bait and quantified using microscale thermophoresis. DNase I DNA footprint assays show that AerR containing B12 inhibits CrtJ binding to the bchC promoter. We further show that bchC expression is greatly repressed in a B12 auxotroph of Rhodobacter capsulatus and that B12 regulation of gene expression is mediated by AerR's ability to function as an antirepressor of CrtJ. This study thus provides a mechanism for how the essential tetrapyrrole, cobalamin controls the synthesis of bacteriochlorophyll, an essential component of the photosystem., (© 2013 John Wiley & Sons Ltd.)

Sequence-specific DNA-binding proteins including transcription factors (TFs) are key determinants of gene regulation and chromatin architecture. TF profiling is commonly carried out by formaldehyde cross-linking and sonication followed by chromatin immunoprecipitation (X-ChIP). We describe a method to profile TF binding at high resolution without cross-linking. We begin with micrococcal nuclease-digested non-cross-linked chromatin and then perform affinity purification of TFs and paired-end sequencing. The resulting occupied regions of genomes from affinity-purified naturally isolated chromatin (ORGANIC) profiles of Saccharomyces cerevisiae Abf1 and Reb1 provide high-resolution maps that are accurate, as defined by the presence of known TF consensus motifs in identified binding sites, that are not biased toward accessible chromatin and that do not require input normalization. We profiled Drosophila melanogaster GAGA factor and Pipsqueak to test ORGANIC performance on larger genomes. Our results suggest that ORGANIC profiling is a widely applicable high-resolution method for sensitive and specific profiling of direct protein-DNA interactions.

Sea urchin mtDNA is transcribed via a different mechanism compared to vertebrates. To gain information on the apparatus of sea urchin mitochondrial transcription we have characterized the DNA binding properties of the mitochondrial transcription factor A (TFAM). The protein contains two HMG box domains but, differently from vertebrates, displays a very short C-terminal tail. Phylogenetic analysis showed that the distribution of tail length is mixed in the different lineages, indicating that it is a trait that undergoes rapid changes during evolution. Homology modeling suggests that the protein adopts the same configuration of the human counterpart and possibly a similar mode of binding to DNA. DNase I footprinting showed that TFAM specifically contacts mtDNA at a fixed distance from three AT-rich consensus sequences that were supposed to act as transcriptional initiation sites. Bound sequences are homologous and contain an inverted repeat motif, which resembles that involved in the intercalation of human TFAM in LSP DNA. The here reported data indicate that sea urchin TFAM specifically binds mtDNA. The protein could intercalate residues at the DNA inverted motif and, despite its short tail, might have a role in mitochondrial transcription., (Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.)

Genomes contain both a genetic code specifying amino acids and a regulatory code specifying transcription factor (TF) recognition sequences. We used genomic deoxyribonuclease I footprinting to map nucleotide resolution TF occupancy across the human exome in 81 diverse cell types. We found that ~15% of human codons are dual-use codons ("duons") that simultaneously specify both amino acids and TF recognition sites. Duons are highly conserved and have shaped protein evolution, and TF-imposed constraint appears to be a major driver of codon usage bias. Conversely, the regulatory code has been selectively depleted of TFs that recognize stop codons. More than 17% of single-nucleotide variants within duons directly alter TF binding. Pervasive dual encoding of amino acid and regulatory information appears to be a fundamental feature of genome evolution.

GAGA is a highly conserved Drosophila transcription factor encoded by the Trithorax-like (Trl) gene. While GAGA usually activates transcription, it represses its own promoter. Here we show that GAGA-mediated repression of Trl is conserved between two distant Drosophila species. A detailed promoter study showed that GAGA repressive activity can't be attributed to any discrete element in the Trl promoter. Genome-wide analysis of the transcriptome in S2 cells indicated that repression of Trl is very likely unique, being GAGA factor a transactivator for all the other promoters. Taken together, our results suggest a new mechanism to explain GAGA-mediated repression that involves a dose-dependent change in the architecture of the Trl promoter., (© 2013.)

The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-L-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized.

Accurate identification of the DNA-binding sites of transcription factors and other DNA-binding proteins on the genome is crucial to understanding their molecular interactions with DNA. Here, we describe a new method: Genome Footprinting by high-throughput sequencing (GeF-seq), which combines in vivo DNase I digestion of genomic DNA with ChIP coupled with high-throughput sequencing. We have determined the in vivo binding sites of a Bacillus subtilis global regulator, AbrB, using GeF-seq. This method shows that exact DNA-binding sequences, which were protected from in vivo DNase I digestion, were resolved at a comparable resolution to that achieved by in vitro DNase I footprinting, and this was simply attained without the necessity of prediction by peak-calling programs. Moreover, DNase I digestion of the bacterial nucleoid resolved the closely positioned AbrB-binding sites, which had previously appeared as one peak in ChAP-chip and ChAP-seq experiments. The high-resolution determination of AbrB-binding sites using GeF-seq enabled us to identify bipartite TGGNA motifs in 96% of the AbrB-binding sites. Interestingly, in a thousand binding sites with very low-binding intensities, single TGGNA motifs were also identified. Thus, GeF-seq is a powerful method to elucidate the molecular mechanism of target protein binding to its cognate DNA sequences.

Thousands of genes in Drosophila have Pol II paused in the promoter proximal region. Almost half of these genes are associated with either GAGA factor (GAF) or a newly discovered factor we call M1BP. Although both factors dictate the association of Pol II at their target promoters, they are nearly mutually exclusive on the genome and mediate different mechanisms of regulation. High-resolution mapping of Pol II using permanganate-ChIP-seq indicates that pausing on M1BP genes is transient and could involve the +1 nucleosome. In contrast, pausing on GAF genes is much stronger and largely independent of nucleosomes. Distinct regulatory mechanisms are reflected by transcriptional plasticity: M1BP genes are constitutively expressed throughout development while GAF genes exhibit much greater developmental specificity. M1BP binds a core promoter element called Motif 1. Motif 1 potentially directs a distinct transcriptional mechanism from the canonical TATA box, which does not correlate with paused Pol II on the genomic scale. In contrast to M1BP and GAF genes, a significant portion of TATA box genes appear to be controlled at preinitiation complex formation.

The genes required for 3-hydroxybenzoate and gentisate catabolism in Corynebacterium glutamicum are closely clustered in three operons. GenR, an IclR-type regulator, can activate the transcription of genKH and genDFM operons in response to 3-hydroxybenzoate and gentisate, and it can repress its own expression. Footprinting analyses demonstrated that GenR bound to four sites with different affinities. Two GenR-binding sites (DFMn01 and DFMn02) were found to be located between positions --41 and --84 upstream of the --35 and --10 regions of the genDFM promoter, which was involved in positive regulation of genDFM transcription. The GenR binding site R-KHn01 (located between positions --47 and --16) overlapped the --35 region of the genKH promoter sequence and is involved in positive regulation of its transcription. The binding site R-KHn02, at which GenR binds to its own promoter, was found within a footprint extending from position --44 to --67. It appeared to be involved in negative regulation of the activity of the genR promoter. A consensus motif with a 5-bp imperfect palindromic sequence [ATTCC-N(7(5))-GGAAT] was identified among all four GenR binding sites and found to be necessary to GenR regulation through site-directed mutagenesis. The results reveal a new regulatory function of the IclR family in the catabolism of aromatic compounds.

Rhodopseudomonas palustris assimilates CO2 by the Calvin-Benson-Bassham (CBB) reductive pentose phosphate pathway. Most genes required for a functional CBB pathway are clustered into the cbbI and cbbII operons, with the cbbI operon subject to control by a LysR transcriptional activator, CbbR, encoded by cbbR, which is divergently transcribed from the cbbLS genes (encoding form I RubisCO) of the cbbI operon. Juxtaposed between the genes encoding CbbR and CbbLS are genes that encode a three-protein two-component system (CbbRRS system) that functions to modify the ability of CbbR to regulate cbbLS expression. Previous studies indicated that the response regulators, as well as various coinducers (effectors), specifically influence CbbR-promoter interactions. In the current study, it was shown via several experimental approaches that the response regulators and coinducers act synergistically on CbbR to influence cbbLS transcription. Synergistic effects on the formation of specific CbbR-DNA complexes were quantified using surface plasmon resonance (SPR) procedures. Gel mobility shift and DNA footprint analyses further indicated structural changes in the DNA arising from the presence of response regulators and coinducer molecules binding to CbbR. Based on previous studies, and especially emphasized by the current investigation, it is clear that protein complexes influence promoter activity and the cbbLS transcription machinery.

In Gram-positive bacteria, CodY is an important regulator of genes whose expression changes under conditions of nutrient limitation. Bacillus anthracis CodY represses or activates directly or indirectly approximately 500 genes. Affinity purification of CodY-DNA complexes was used to identify the direct targets of CodY. Of the 389 DNA binding sites that were copurified with CodY, 132 sites were in or near the regulatory regions governing the expression of 197 CodY-controlled genes, indicating that CodY controls many other genes indirectly. CodY-binding specificity was verified using electrophoretic mobility shift and DNase I footprinting assays for three CodY targets. Analysis of the bound sequences led to the identification of a B. anthracis CodY-binding consensus motif that was found in 366 of the 389 affinity-purified DNA regions. Regulation of the expression of the two genes directly controlled by CodY, sap and eag, encoding the two surface layer (S-layer) proteins, was analyzed further by monitoring the expression of transcriptional lacZ reporter fusions in parental and codY mutant strains. CodY proved to be a direct repressor of both sap and eag expression. Since the expression of the S-layer genes is under the control of both CodY and PagR (a regulator that responds to bicarbonate), their expression levels respond to both metabolic and environmental cues.

Previously, Lrp-like transcriptional regulator LysM from the hyperthermoacidophilic crenarchaeon Sulfolobus solfataricus was proposed to have a single target, the lysWXJK operon of lysine biosynthesis, and a single effector molecule, l-lysine. Here we identify ∼70 novel binding sites for LysM in the S. solfataricus genome with a LysM-specific nanobody-based chromatin immunoprecipitation assay coupled to microarray hybridization (ChIP-chip) and in silico target site prediction using an energy-based position weight matrix, and validate these findings with in vitro binding. LysM binds to intergenic and coding regions, including promoters of various amino acid biosynthesis and transport genes. We confirm that l-lysine is the most potent effector molecule that reduces, but does not completely abolish, LysM binding, and show that several other amino acids and derivatives, including d-lysine, l-arginine, l-homoarginine, l-glutamine and l-methionine and branched-chain amino acids l-leucine, l-isoleucine and l-valine, significantly affect DNA-binding properties of LysM. Therefore, it appears from this study that LysM is a much more versatile regulator than previously thought, and that it uses a variety of amino acids to sense nutritional quality of the environment and to modulate expression of the metabolic machinery of Sulfolobus accordingly.

Aim: To explore the transcriptional regulation of the psaEF and psaABC loci by the RovA and PhoP regulators in Yersinia pestis., Materials & Methods: Primer extension, LacZ fusion, gel mobility shift and DNase I footprinting assays were conducted in combination for this gene regulation study., Results: It was determined that PhoP and RovA recognized the promoter-proximal regions of psaEF and psaABC in order to repress and stimulate their transcription, respectively. The translation/transcription start sites, Shine-Dalgarno sequences (ribosomal binding site), core promoter -10 and -35 elements, PhoP and RovA sites and PhoP/RovA consensus-like sequences were identified to determine the structural organization of PhoP/RovA-dependent promoters of psaEF and psaABC., Conclusion: RovA stimulated psaEF and psaABC, while PhoP repressed these two operons involving the direct association between RovA/PhoP and target promoter regions. The reciprocal regulation of psa genes by PhoP and RovA could contribute to the tightly controlled expression of the pH 6 antigen during infection.

Escherichia coli contains 30 two-component systems (TCSs), each consisting of a histidine kinase and a response regulator. Whereas most TCSs are well characterized in this model organism, little is known about the YpdA/YpdB system. To identify YpdB-regulated genes, we compared the transcriptomes of E. coli cells overproducing either YpdB or a control protein. Expression levels of 15 genes differed by more than 1.9-fold between the two strains. A comprehensive evaluation of these genes identified yhjX as the sole target of YpdB. Electrophoretic mobility shift assays with purified YpdB confirmed its interaction with the yhjX promoter. Specifically, YpdB binds to two direct repeats of the motif GGCATTTCAT separated by an 11-bp spacer in the yhjX promoter. yhjX encodes a cytoplasmic membrane protein of unknown function that belongs to the major facilitator superfamily of transporters. Finally, we characterized the pattern of yhjX expression and identified extracellular pyruvate as a stimulus for the YpdA/YpdB system. It is suggested that YpdA/YpdB contributes to nutrient scavenging before entry into stationary phase.

Transcription of the Escherichia coli hydrogenase-1 operon (hyaABCDEF) is increased by the transcription factors ArcA and AppY under anaerobic growth conditions. However, IscR, which represses transcription of the hyaA promoter (P(hyaA)) under aerobic conditions, was not known to repress transcription of this promoter under anaerobic conditions. Here, we report that ArcA and AppY increase P(hyaA) expression under anaerobic conditions by antagonizing IscR binding at P(hyaA), since IscR repression is observed when either ArcA or AppY is eliminated. The ability of ArcA and AppY to act as antirepressors of IscR repression of P(hyaA) depended on IscR levels, suggesting that IscR competes with ArcA and/or AppY for binding. In support of this competition model, electrophoretic mobility shift assays and DNase I footprinting showed that the ArcA and IscR binding sites overlap and that binding of ArcA and IscR is mutually exclusive. Unexpectedly, IscR with a C92A mutation (IscR-C92A), which mimics the clusterless form of the protein that is present predominantly under aerobic conditions, was a better repressor under anaerobic conditions of both P(hyaA) and a constitutive promoter containing the IscR binding site from P(hyaA) than wild-type IscR, which is predominantly in the [2Fe-2S] form under anaerobic conditions. This observation could not be explained by differences in DNA binding affinities or IscR levels, so we conclude that [2Fe-2S]-IscR is a weaker repressor of P(hyaA) than clusterless IscR. In sum, a combination of ArcA and AppY antirepression of IscR function, lower levels of IscR, and weak repression by [2Fe-2S]-IscR leads to increased P(hyaA) expression under anaerobic conditions.

CosR is an essential response regulator in Campylobacter jejuni, a major food-borne pathogen causing enteritis worldwide. A transcriptomic analysis performed in this study discovered 93 genes whose transcriptional levels were changed >2-fold due to the repression of CosR expression by antisense peptide nucleic acid. The identified CosR-regulated genes are involved in various cellular functions, such as energy production, protein synthesis and folding, flagellum biogenesis, and lipid metabolism. Interestingly, 17 of the 93 CosR-regulated genes (18.3%) are predicted essential genes, indicating that CosR may participate in the regulation of vital biological processes in C. jejuni. In particular, CosR knockdown increased the transcriptional levels of cmeA, cmeB, and cmeC genes, whose protein product (CmeABC) is an important determinant conferring multidrug resistance in Campylobacter. Negative regulation of cmeABC by CosR was verified by quantitative real-time PCR (qRT-PCR) and P(cmeABC)::lacZ assay. The results of electrophoretic mobility shift assays (EMSAs) and DNase I footprinting assays demonstrated that CosR directly binds to the cmeABC promoter. Another notable finding is that CosR regulates the transcription of katA, the sole catalase gene in C. jejuni. Further characterization with qRT-PCR, the catalase enzyme assay, EMSA, and DNase I footprinting assays successfully demonstrated that CosR affects the katA transcription and the catalase activity by direct interactions with the katA promoter. The findings in this study clearly demonstrated that CosR regulates resistance mechanisms in C. jejuni by controlling the expression of genes involved in oxidative stress defense and extrusion of toxic compounds out of the cell.

The transcriptional regulation of Corynebacterium glutamicum gnd, encoding 6-phosphogluconate dehydrogenase, was investigated. Two transcriptional regulators, GntR1 and RamA, were isolated by affinity purification using gnd promoter DNA. GntR1 was previously identified as a repressor of gluconate utilization genes, including gnd. Involvement of RamA in gnd expression had not been investigated to date. The level of gnd mRNA was barely affected by the single deletion of ramA. However, gnd expression was downregulated in the ramA gntR1 double mutant compared to that of the gntR1 single mutant, suggesting that RamA activates gnd expression. Two RamA binding sites are found in the 5' upstream region of gnd. Mutation proximal to the transcriptional start site diminished the gluconate-dependent induction of gnd-lacZ. DNase I footprinting assay revealed two GntR1 binding sites, with one corresponding to a previously proposed site that overlaps with the -10 region. The other site overlaps the RamA binding site. GntR1 binding to this newly identified site inhibits DNA binding of RamA. Therefore, it is likely that GntR1 represses gnd expression by preventing both RNA polymerase and RamA binding to the promoter. In addition, DNA binding activity of RamA was reduced by high concentrations of NAD(P)H but not by NAD(P), implying that RamA senses the redox perturbation of the cell.

Type IV secretion systems (T4SS) are multiprotein structures that direct the translocation of specific molecules across the bacterial cell envelope. As in other bacteria, pathogenicity of the genus Brucella essentially depends on the integrity of the T4SS-encoding virB operon, whose expression is regulated by multiple transcription factors belonging to different families. Previously, we identified IHF and HutC, two direct regulators of the virB genes that were isolated from total protein extracts of Brucella. Here, we report the identification of MdrA, a third regulatory element that was isolated using the same screening procedure. This transcription factor, which belongs to the MarR-family of transcriptional regulators, binds at two different sites of the virB promoter and regulates expression in a growth phase-dependent manner. Like other members of the MarR family, specific ligands were able to dissociate MdrA from DNA in vitro. Determination of the MdrA-binding sites by DNase I footprinting and analyses of protein-DNA complexes by electrophoresis mobility shift assays (EMSAs) showed that MdrA competes with IHF and HutC for the binding to the promoter because their target DNA sequences overlap. Unlike IHF, both MdrA and HutC bound to the promoter without inducing bending of DNA. Moreover, the two latter transcription factors activated virB expression to similar extents, and in doing so, they are functionally redundant. Taken together, our results show that MdrA is a regulatory element that directly modulates the activity of the virB promoter and is probably involved in coordinating gene expression in response to specific environmental signals.

The single-component RcoM transcription factor couples an N-terminally bound heme cofactor with a C-terminal "LytTR" DNA-binding domain. Here the RcoM(Bx)-1 protein from Burkholderia xenovorans LB400 was heterologously expressed and then purified in a form with minimal bound CO (~10%) and was found to stably bind this effector with a nanomolar affinity. DNase I protection assays demonstrated that the CO-associated form binds with a micromolar affinity to two ~60-bp DNA regions, each comprised of a novel set of three direct-repeat binding sites spaced 21 bp apart on center. Binding to each region was independent, while binding to the triplet binding sites within a region was cooperative, depended upon spacing and sequence, and was marked by phased DNase I hyperactivity and protection patterns consistent with considerable changes in the DNA conformation of the nucleoprotein complex. Each protected binding site spanned a conserved motif (5'-TTnnnG-3') that was present, in triplicate, in putative RcoM-binding regions of more than a dozen organisms. In vivo screens confirmed the functional importance of the conserved "TTnnnG" motif residues and their triplet arrangement and were also used to determine an improved binding motif [5'-CnnC(C/A)(G/A)TTCAnG-3'] that more closely corresponds to canonical LytTR domain/DNA-binding sites. A low-affinity but CO-dependent binding of RcoM(Bx)-1 to a variety of DNA probes was demonstrated in vitro. We posit that for the RcoM(Bx)-1 protein, the high CO affinity combined with multiple low-affinity DNA-binding events constitutes a transcriptional "accumulating switch" that senses low but persistent CO levels.

Following the consumption of contaminated food or water by a human host, the Vibrio cholerae bacterium produces virulence factors, including cholera toxin (CT), which directly causes voluminous diarrhea, producing cholera. A complex regulatory network controls virulence gene expression and responds to various environmental signals and transcription factors. Ultimately, ToxT, a member of the AraC/XylS transcription regulator family, is responsible for activating the transcription of the virulence genes. ToxT-regulated promoters all contain one or more copies of the toxbox, a 13-bp DNA sequence which ToxT recognizes. Nucleotides 2 through 7 of the toxbox sequence are well conserved and contain an invariant tract of four consecutive T nucleotides, whereas the remainder of the toxbox sequence is not highly conserved other than being A/T rich. The binding of ToxT to toxboxes is required to activate the transcription of virulence genes, and toxboxes in several virulence gene promoters have been characterized. However, the toxboxes required for the activation of transcription from the cholera toxin promoter PctxAB have not been identified. PctxAB contains a series of heptad repeats (GATTTTT), each of which matches the 5' end of the toxbox consensus sequence and is a potential binding site for ToxT. Using site-directed mutagenesis and high-resolution copper-phenanthroline footprinting, we have identified the functional toxboxes required for the ToxT activation of PctxAB. Our findings suggest that ToxT binds to only two toxboxes within PctxAB, despite the presence of several other potential ToxT binding sites within the promoter. Both toxboxes are essential for DNA binding and the full activation of ctxAB transcription.

The combinatorial cross-regulation of hundreds of sequence-specific transcription factors (TFs) defines a regulatory network that underlies cellular identity and function. Here we use genome-wide maps of in vivo DNaseI footprints to assemble an extensive core human regulatory network comprising connections among 475 sequence-specific TFs and to analyze the dynamics of these connections across 41 diverse cell and tissue types. We find that human TF networks are highly cell selective and are driven by cohorts of factors that include regulators with previously unrecognized roles in control of cellular identity. Moreover, we identify many widely expressed factors that impact transcriptional regulatory networks in a cell-selective manner. Strikingly, in spite of their inherent diversity, all cell-type regulatory networks independently converge on a common architecture that closely resembles the topology of living neuronal networks. Together, our results provide an extensive description of the circuitry, dynamics, and organizing principles of the human TF regulatory network., (Copyright © 2012 Elsevier Inc. All rights reserved.)

Regulatory factor binding to genomic DNA protects the underlying sequence from cleavage by DNase I, leaving nucleotide-resolution footprints. Using genomic DNase I footprinting across 41 diverse cell and tissue types, we detected 45 million transcription factor occupancy events within regulatory regions, representing differential binding to 8.4 million distinct short sequence elements. Here we show that this small genomic sequence compartment, roughly twice the size of the exome, encodes an expansive repertoire of conserved recognition sequences for DNA-binding proteins that nearly doubles the size of the human cis-regulatory lexicon. We find that genetic variants affecting allelic chromatin states are concentrated in footprints, and that these elements are preferentially sheltered from DNA methylation. High-resolution DNase I cleavage patterns mirror nucleotide-level evolutionary conservation and track the crystallographic topography of protein-DNA interfaces, indicating that transcription factor structure has been evolutionarily imprinted on the human genome sequence. We identify a stereotyped 50-base-pair footprint that precisely defines the site of transcript origination within thousands of human promoters. Finally, we describe a large collection of novel regulatory factor recognition motifs that are highly conserved in both sequence and function, and exhibit cell-selective occupancy patterns that closely parallel major regulators of development, differentiation and pluripotency.

Global transcriptional regulators that respond to specific environmental signals are crucial in bacterial pathogenesis. In the case of the Gram-positive pathogen Streptococcus pneumoniae (the pneumococcus), the sp1800 gene of the clinical isolate TIGR4 encodes a protein that exhibits homology to the Mga "stand-alone" response regulator of the group A Streptococcus. Such a pneumococcal protein was shown to play a significant role in both nasopharyngeal colonization and development of pneumonia in murine infection models. Moreover, it was shown to repress the expression of several genes located within the rlrA pathogenicity islet. The pneumococcal R6 strain, which derives from the D39 clinical isolate, lacks the rlrA islet but has a gene (here named mga(Spn)) equivalent to the sp1800 gene. In this work, and using in vivo approaches, we have identified the promoter of the mga(Spn) gene (Pmga) and demonstrated that four neighboring open reading frames of unknown function (spr1623 to spr1626) constitute an operon. Transcription of this operon is under the control of two promoters (P1623A and P1623B) that are divergent from the Pmga promoter. Furthermore, we have shown that the Mga(Spn) protein activates the P1623B promoter in vivo. This activation requires sequences located around 50 to 120 nucleotides upstream of the P1623B transcription start site. By DNase I footprinting assays, we have also demonstrated that such a region includes an Mga(Spn) binding site. This is the first report on the activator role of the pneumococcal Mga-like protein.