Search

To acquire iron (Fe), graminaceous plants secrete mugineic acid family phytosiderophores (MAs) from their roots into the rhizosphere. MAs are biosynthesized from methionine via nicotianamine (NA). ...

Radioactivity levels of cesium (Cs)-134 and 137Cs in bamboo [Phyllostachys reticulata (Rupr) K. Koch] sprouts grown from April to June 2011 over a wide area (including Fukushima Prefecture) were elevated (max. 3100 Bq kg−1 fresh weight) after the Tokyo Electric Power Company, Inc. (TEPCO) Fukushima Daiichi Nuclear Power Plant disaster in March 2011. Bamboo sprouts in 2012 also contained high radioactivity levels. Radioactivity imaging analysis of bamboo sprouts harvested in 2012 showed increasing concentration gradients of radioactivity from the lower parts to the top of the sprouts. The peels were individually separated from the sprouts, and the inner edible part (trunk) was cross-sectioned at the internodal sections from the top to the lower parts. Each segmented trunk and its corresponding peel were analyzed for radioactive cesium (134Cs and 137Cs) and stable cesium (133Cs). The concentrations of 134Cs and 137Cs showed significant increases from the lower part to the top, whereas 133Cs showed a...

“Urushi” syrup from Rhus vernicifera DC. was collected monthly from June to October 2011, to represent sieve tube exudates from trees, and the radioactivity of samples was measured. In the syrup, the cesium (Cs) concentration (134Cs and 137Cs) originating from the meltdown at the Tokyo Electric Power Company, Inc. (TEPCO) Nuclear Power Station in Fukushima peaked in July and decreased to a minimum in October, while the natural radioactive potassium-40 (40K) remained constant during the same period. On the basis of these results, we assumed that the radioactive Cs in the urushi syrup was directly translocated from the fallout adsorbed to tree bark rather than from contaminated soil.

Barley (Hordeum vulgare L.) nicotianamine synthase gene (HvNAS1) expression in barley is strongly induced by Fe deficiency in the roots and rice (Oryza sativa L.) nicotianamine synthase gene (OsNAS1) expression in rice is induced by Fe deficiency both in the roots and in the shoots. In dicots, NAS genes are not strongly induced by Fe deficiency, and they function to maintain Fe homeostasis. Rice OsNAS1promoter::GUS or barley HvNAS1promoter::GUS was introduced into tobacco (Nicotiana tabacum L.) and tissue specificities and systemic regulation of their expression were compared. A split-root experiment revealed that the HvNAS1 promoter exhibited functions similar to those of Fe-acquisition-related genes in tobacco roots, suggesting that this promoter responded to certain Fe-deficiency systemic signals and to the Fe concentration in the rhizosphere. The HvNAS1 promoter might harbor a type of universal system of gene expression for Fe acquisition. However, the OsNAS1 promoter did not respond to local...

Summary Nicotianamine (NA), a metal chelator ubiquitous in higher plants, serves as an antihypertensive substance in humans. To engineer a novel antihypertensive rice that contains larger amounts of NA, the barley NA synthase gene, HvNAS1, was introduced into rice via Agrobacterium-mediated transformation. The introduced HvNAS1 was driven by pGluB-1, which induces strong gene expression in the endosperm of rice seeds. The NA content in transgenic rice seeds was up to fourfold greater than that in non-transgenic rice seeds. The Cre/loxP DNA excision (CLX) system was used to remove the selectable marker gene for antibiotic resistance. Furthermore, the transgenic rice was crossed with a cleistogamous mutant to prevent gene transfer via pollen dispersal. These two modifications may minimize public concern with regard to the use of this transgenic rice.

Typical for a graminaceous plant, barley secretes mugineic acid-family phytosiderophores (MAs) to acquire iron (Fe). Under Fe-deficient conditions, MAs secretion from barley roots increases markedly. Secretion shows a diurnal pattern, with a clear peak 2-3 h after sunrise and cessation within a few hours. Microarray analyses were performed to profile the Fe deficiency-inducible genes in barley roots and diurnal changes in the expression of these genes. Genes encoding enzymes involved in MAs biosynthesis, the methionine cycle, and methionine biosynthesis were highly induced by Fe deficiency. The expression of sulfate transporters was also upregulated by Fe deficiency. Therefore, all of the genes participating in the MAs pathway from sulfur uptake and assimilation to the biosynthesis of MAs were upregulated in Fe-deficient barley roots. In contrast to MAs secretion, the transcript levels of these genes did not show diurnal changes. The amount of endogenous MAs gradually increased during the day after MAs secretion ceased, and was highest before secretion began. These results show that MAs biosynthesis, including the supply of the substrate methionine, occurs throughout the day, and biosynthesized MAs likely accumulate in barley roots until their secretion into the rhizosphere. In contrast, the levels of transcripts encoding an Fe(III)-MAs complex transporter, two putative metal-MAs complex transporters, and HvYS1 were also increased in Fe-deficient barley roots, and the levels of two of these transcripts showed diurnal rhythms. The Fe(III)-MAs complex transporters may absorb Fe(III)-MAs diurnally, synchronous with the diurnal secretion of MAs.

The real-time translocation of iron (Fe) in barley (Hordeum vulgare L. cv. Ehimehadaka no. 1) was visualized using the positron-emitting tracer (52)Fe and a positron-emitting tracer imaging system (PETIS). PETIS allowed us to monitor Fe translocation in barley non-destructively under various conditions. In all cases, (52)Fe first accumulated at the basal part of the shoot, suggesting that this region may play an important role in Fe distribution in graminaceous plants. Fe-deficient barley showed greater translocation of (52)Fe from roots to shoots than did Fe-sufficient barley, demonstrating that Fe deficiency causes enhanced (52)Fe uptake and translocation to shoots. In the dark, translocation of (52)Fe to the youngest leaf was equivalent to or higher than that under the light condition, while the translocation of (52)Fe to the older leaves was decreased, in both Fe-deficient and Fe-sufficient barley. This suggests the possibility that the mechanism and/or pathway of Fe translocation to the youngest leaf may be different from that to the older leaves. When phloem transport in the leaf was blocked by steam treatment, (52)Fe translocation from the roots to older leaves was not affected, while (52)Fe translocation to the youngest leaf was reduced, indicating that Fe is translocated to the youngest leaf via phloem in addition to xylem. We propose a novel model in which root-absorbed Fe is translocated from the basal part of the shoots and/or roots to the youngest leaf via phloem in graminaceous plants.

The term “co-situs application” refers to a technology that uses controlled-release fertilizer (CRF) attached with the seeds or seedlings as the single application for the entire growing season without causing salt injury. Using a co-situs application technique, a pot experiment was carried out to evaluate the importance of contact between rice roots and co-situs applied fertilizer granules on Fe absorption by paddy rice in a calcareous paddy soil. Oriza sativa cv. Hatajirushi was used as the test plant. The treatments were as follows: (1) co-situs application of CRF containing only NPK (CRFNPK), (2) co-situs application of CRF containing only NPK and broadcast application of micronutrients (CRFNPK + M), (3) co-situs application of CRF containing NPK and micronutrients without a barrier between the roots and the fertilizer (CRFM), (4) co-situs application of the same fertilizer as on the CRFM treatment with a barrier between the roots and the fertilizer (CRFM + barrier). In the final treatment, a...

Zinc (Zn) excess has significant toxicity to biological systems through metal-based cytotoxic reactions. Nicotianamine (NA) and deoxymugineic acid (DMA) are low-molecular-weight, high-affinity transition metal chelators. Studies have shown that NA may have a role in the tolerance of excess Zn. We show that a gene coding the iron (Fe)-regulated DNA-binding transcription factor (OsIRO2) and the downstream genes of OsIRO2, such as NA synthase, DMA synthase and the DMA-Fe3+ transporter, were induced in rice roots by excess Zn. Consistent with the expression of these genes, the amounts of endogenous NA, endogenous DMA and DMA secretion increased in the excess Zn roots. Although the Fe concentration in the excess Zn roots was much higher than that in the control, rice ferritin gene, OsFer1, was downregulated in Zn excess roots. OsIRT1, which is upregulated by Fe deficiency, was not induced in Zn excess roots, suggesting that OsIRO2 may not be induced simply by the Fe deficiency caused by excess Zn. The...

Iron (Fe) deficiency stress is a widespread problem in agriculture and must be overcome to increase crop yields, particularly in calcareous soils. Unlike barley, rice, one of the three major crops in the world, is very susceptible to low Fe availability because of a low capacity to secrete mugineic acid family phytosiderophores (MAs), which are Fe chelators secreted by graminaceous plants. We tested three transgenic rice lines possessing three barley genes involved in MAs synthesis in a field experiment on a calcareous soil under paddy conditions. Two rice lines, one with a barley gene encoding nicotianamine synthase (NAS) and the other with a barley gene encoding a dioxygenase, referred to as Fe-deficiency specific clone no. 3 (IDS3), showed higher tolerance to low Fe availability under these conditions. The rice line with the IDS3 gene also had increased concentrations of Fe and zinc (Zn) in the grains. These results show that introducing barley genes involved in the synthesis of MAs into rice is an effective and practical method to improve agricultural productivity in calcareous soils.

Deoxymugineic acid (DMA) is a member of the mugineic acid family phytosiderophores (MAs), which are natural metal chelators produced by graminaceous plants. Rice secretes DMA in response to Fe deficiency to take up Fe in the form of Fe(III)–MAs complex. In contrast with barley, the roots of which secrete MAs in response to Zn deficiency, the amount of DMA secreted by rice roots was slightly decreased under conditions of low Zn supply. There was a concomitant increase in endogenous DMA in rice shoots, suggesting that DMA plays a role in the translocation of Zn within Zn-deficient rice plants. The expression of OsNAS1 and OsNAS2 was not increased in Zn-deficient roots but that of OsNAS3 was increased in Zn-deficient roots and shoots. The expression of OsNAAT1 was also increased in Zn-deficient roots and dramatically increased in shoots; correspondingly, HPLC analysis was unable to detect nicotianamine in Zn-deficient shoots. The expression of OsDMAS1 was increased in Zn-deficient shoots. Analyses using the positron-emitting tracer imaging system (PETIS) showed that Zn-deficient rice roots absorbed less 62Zn-DMA than 62Zn2+. Importantly, supply of 62Zn-DMA rather than 62Zn2+ increased the translocation of 62Zn into the leaves of Zn-deficient plants. This was especially evident in the discrimination center (DC). These results suggest that DMA in Zn-deficient rice plants has an important role in the distribution of Zn within the plant rather than in the absorption of Zn from the soil. Electronic supplementary material The online version of this article (doi:10.1007/s11103-008-9292-x) contains supplementary material, which is available to authorized users.

Rice plants (Oryza sativa L.) take up iron using iron-chelating compounds known as mugineic acid family phytosiderophores (MAs). In the biosynthetic pathway of MAs, nicotianamine aminotransferase (NAAT) catalyses the key step from nicotianamine to the 3''-keto form. In the present study, we identified six rice NAAT genes (OsNAAT1-6) by screening a cDNA library made from Fe-deficient rice roots and by searching databases. Among the NAAT homologues, OsNAAT1 belongs to a subgroup containing barley functional NAAT (HvNAAT-A and HvNAAT-B) as well as a maize homologue cloned by cDNA library screening (ZmNAAT1). Northern blot and RT-PCR analysis showed that OsNAAT1, but not OsNAAT2-6, was strongly up-regulated by Fe deficiency, both in roots and shoots. The OsNAAT1 protein had NAAT enzyme activity in vitro, confirming that the OsNAAT1 gene encodes functional NAAT. Promoter-GUS analysis revealed that OsNAAT1 was expressed in companion and pericycle cells adjacent to the protoxylem of Fe-sufficient roots. In addition, expression was induced in all cells of Fe-deficient roots, with particularly strong GUS activity evident in the companion and pericycle cells. OsNAAT1 expression was also observed in the companion cells of Fe-sufficient shoots, and was clearly induced in all the cells of Fe-deficient leaves. These expression patterns highly resemble those of OsNAS1, OsNAS2 and OsDMAS1, the genes responsible for MAs biosynthesis for Fe acquisition. These findings strongly suggest that rice synthesizes MAs in whole Fe-deficient roots to acquire Fe from the rhizosphere, and also in phloem cells to maintain metal homeostasis facilitated by MAs-mediated long-distance transport.

Zinc (Zn), an essential nutrient in cells, plays a vital role in controlling cellular processes such as growth, development, and differentiation. Although the mechanisms of Zn translocation in rice plants (Oryza sativa) are not fully understood, it has recently received increased interest. OsZIP4 is a Zn transporter that localizes to apical cells. Transgenic rice plants overexpressing the OsZIP4 gene under the control of the cauliflower mosaic virus (CaMV) 35S promoter were produced. The Zn concentration in roots of 35S-OsZIP4 transgenic plants was 10 times higher than in those of vector controls, but it was five times lower in shoots. The Zn concentration in seeds of 35S-OsZIP4 plants was four times lower compared with vector controls. Northern blot analysis and quantitative real-time reverse transcription-PCR revealed transcripts of OsZIP4 expression driven by the CaMV 35S promoter in roots and shoots of 35S-OsZIP4 plants, but levels of endogenous OsZIP4 transcripts were low in roots and high in shoots compared with vector controls. Microarray analysis revealed that the genes expressed in shoots of 35S-OsZIP4 plants coincided with those induced in shoots of Zn-deficient plants. These results indicate that constitutive expression of OsZIP4 changes the Zn distribution within rice plants, and that OsZIP4 is a critical Zn transporter that must be strictly regulated.

Iron (Fe) deficiency is a major abiotic stress in crop production. Although responses to Fe deficiency in graminaceous plants, such as increased production and secretion of mugineic acid family phytosiderophores (MAs), have been described, the gene regulation mechanisms related to these responses are largely unknown. To elucidate the regulation mechanisms of the genes related to Fe acquisition in graminaceous plants, we characterized the Fe-deficiency-inducible basic helix-loop-helix transcription factor OsIRO2 in rice. In yeast cells, OsIRO2 functioned as a transcriptional activator. In rice, overexpression of OsIRO2 resulted in increased MAs secretion, whereas repression of OsIRO2 resulted in lower MAs secretion and hypersensitivity to Fe deficiency. Northern blots revealed that the expression of the genes involved in the Fe(III)-MAs transport system was dependent on OsIRO2. The expression of the genes for nicotianamine synthase, a key enzyme in MAs synthesis, was notably affected by the level of OsIRO2 expression. Microarray analysis demonstrated that OsIRO2 regulates 59 Fe-deficiency-induced genes in roots. Some of these genes, including two transcription factors upregulated by Fe deficiency, possessed the OsIRO2 binding sequence in their upstream regions. OsIRO2 possesses a homologous sequence of the Fe-deficiency-responsive cis-acting elements (IDEs) in its upstream region. We propose a novel gene regulation network for Fe-deficiency responses, including OsIRO2, IDEs and the two transcription factors.

Under conditions of iron deficiency, graminaceous plants induce the expression of genes involved in the biosynthesis of mugineic acid family phytosiderophores. We previously identified the novel cis -acting elements IDE1 and IDE2 (iron-deficiency-responsive element 1 and 2) through promoter analysis of the barley ( Hordeum vulgare L.) iron-deficiency-inducible IDS2 gene in tobacco ( Nicotiana tabacum L.). To gain further insight into plant gene regulation under iron deficiency, we analyzed the barley iron-deficiency-inducible IDS3 gene, which encodes mugineic acid synthase. IDS3 promoter fragments were fused to the β-glucuronidase ( GUS ) gene, and this construct was introduced into Arabidopsis thaliana L. and tobacco plants. In both Arabidopsis and tobacco, GUS activity driven by the IDS3 promoter showed strongly iron-deficiency-inducible and root-specific expression. Expression occurred mainly in the epidermis of Arabidopsis roots, whereas expression was dominant in the pericycle, endodermis, and cortex of tobacco roots, resembling the expression pattern conferred by IDE1 and IDE2. Deletion analysis revealed that a sequence within −305 nucleotides from the translation start site was sufficient for specific expression in both Arabidopsis and tobacco roots. Gain-of-function analysis revealed functional regions at −305/−169 and −168/−93, whose coexistence was required for the induction activity in Arabidopsis roots. Multiple IDE-like sequences were distributed in the IDS3 promoter and were especially abundant within the functional region at −305/−169. A sequence moderately homologous to that of IDE1 was also present within the −168/−93 region. These IDE-like sequences would be the first candidates for the functional iron-deficiency-responsive elements in the IDS3 promoter.

Until now, the real-time uptake and movement of manganese (Mn), an essential plant nutrient, has not been documented in plants. In this study, the real-time translocation of Mn in barley (Hordeum vulgare L. cv. Ehimehadaka no. 1) was visualized using the positron-emitting tracer 52Mn and a positron-emitting tracer imaging system (PETIS). PETIS allowed the non-destructive monitoring of Mn translocation in barley under various conditions. In all cases, 52Mn first accumulated in the discrimination center (DC) at the basal portion of the shoot, suggesting that this region may play an important role in Mn distribution in graminaceous plants. Manganese-deficient barley showed greater translocation of 52Mn from roots to shoots than did Mn-sufficient barley, demonstrating that Mn deficiency causes enhanced Mn uptake and loading into vascular bundles. In contrast, the translocation of 52Mn from roots to shoots was suppressed in Mn-excess barley. In these plants, the uptake of Mn may be suppressed or Mn ma...

Among micronutrient deficiencies, Fe deficiency is the most difficult nutritional disorder to prevent in the fruits of trees growing on calcareous soils. In this study, a pot experiment was carried out to evaluate the potential of co-situs application of controlled release fertilizers (CRF) in alleviating Fe deficiency and improving the growth of fruit trees growing on calcareous soil (pH 9.3). Guava (Psidium guajava L.) seedlings were used as test plants because of their sensitivity to Fe deficiency. Treatments consisted of the following: (1) broadcast application of readily soluble Fe, Zn, Cu, B and Mn fertilizers (Control) or (2) co-situs application of CRF containing N, P, K, Mg, Fe, Zn, B, Cu and Mn (Co-situs). For the Control treatment, CRF containing only N, P and K was used. Both treatments received the same amount of all nutrients. Plants were more chlorotic in young leaves under the Control treatment and the Fe content of young leaves was significantly (least significant difference [LSD0.05]) higher under the Co-situs treatment. Dry matter production of shoots under the Co-situs treatment was 5.2-fold higher than under the Control treatment, and the total accumulations of macro and micronutrients were much higher under the Co-situs treatment than the Control treatment. Total accumulations of N, P, K, Ca and Mg were 5.0, 4.1, 9.6, 3.2 and 2.2-fold higher, respectively, under the Co-situs treatment compared with the Control treatment, and Fe, Zn, Cu and Mn accumulations were 3.2, 4.1, 6.0 and 3.7-fold higher, respectively. Iron deficiency in guava seedlings was successfully alleviated by the co-situs application of controlled fertilizer, proving the high potential of this method in alleviating Fe deficiency in fruit trees growing on calcareous soils.

Mugineic acid family phytosiderophores (MAs) are metal chelators that are produced in graminaceous plants in response to iron (Fe) deficiency, but current evidence regarding secretion of MAs during zinc (Zn) deficiency is contradictory. Our studies using HPLC analysis showed that Zn deficiency induces the synthesis and secretion of MAs in barley plants. The levels of the HvNAS1, HvNAAT-A, HvNAAT-B, HvIDS2 and HvIDS3 transcripts, which encode the enzymes involved in the synthesis of MAs, were increased in Zn-deficient roots. Studies of the genes involved in the methionine cycle using microarray analysis showed that the transcripts of these genes were increased in both Zn-deficient and Fe-deficient barley roots, probably allowing the plant to meet its demand for methionine, a precursor in the synthesis of MAs. In addition, HvNAAT-B transcripts were detected in Zn-deficient shoots, but not in those that were deficient in Fe. Increased synthesis of MAs in Zn-deficient barley was not due to a deficiency of Fe, because Zn-deficient barley accumulated more Fe than did the control plants, ferritin transcripts were increased in Zn-deficient plants, and Zn deficiency promoted Fe transport from root to shoot. Moreover, analysis using the positron-emitting tracer imaging system (PETIS) confirmed that more 62Zn(II)-MAs than 62Zn2+ were absorbed by the roots of Zn-deficient barley plants. These data suggest that the increased biosynthesis and secretion of MAs arising from a shortage of Zn are not due to an induced Fe deficiency, and that secreted MAs are effective in absorbing Zn from the soil.

Zinc (Zn) is an essential element for the normal growth of plants but information is scarce on the mechanisms whereby Zn is transported in rice (Oryza sativa L.) plants. Four distinct genes, OsZIP4, OsZIP5, OsZIP6, and OsZIP7 that exhibit sequence similarity to the rice ferrous ion transporter, OsIRT1, were isolated. Microarray and northern blot analysis revealed that OsZIP4 was highly expressed under conditions of Zn deficiency in roots and shoots. Real-time-PCR revealed that the OsZIP4 transcripts were more abundant than those of OsZIP1 or OsZIP3 in Zn-deficient roots and shoots. OsZIP4 complemented a Zn-uptake-deficient yeast (Saccharomyces cerevisiae) mutant, Deltazrt1,Deltazrt2, indicating that OsZIP4 is a functional transporter of Zn. OsZIP4-synthetic green fluorescent protein (sGFP) fusion protein was transiently expressed in onion epidermal cells localized to the plasma membrane. In situ hybridization analysis revealed that OsZIP4 in Zn-deficient rice was expressed in shoots and roots, especially in phloem cells. Furthermore, OsZIP4 transcripts were detected in the meristem of Zn-deficient roots and shoots. These results suggested that OsZIP4 is a Zn transporter that may be responsible for the translocation of Zn within rice plants.

*† Summary We identified 18 putative yellow stripe 1 (YS1)-like genes (OsYSLs) in the rice genome that exhibited 36–76% sequence similarity to maize iron(III)-phytosiderophore transporter YS1. Of particular interest was OsYSL2, the transcripts of which were not detected in the roots of either iron-sufficient or iron-deficient plants, but dramatic expression was induced in the leaves by iron deficiency. Based on the nucleotide sequence, OsYSL2 was predicted to encode a polypeptide of 674 amino acids containing 14 putative transmembrane domains. OsYSL2:green fluorescent protein (GFP) was localized in the plasma membrane of onion epidermal cells. Promoter:b-glucuronidase (GUS) analysis revealed that OsYSL2 was expressed in companion cells in ironsufficient roots. GUS activity was increased in companion cells, but no GUS staining was observed in epidermal or cortex cells, even in iron-deficient roots. In the leaves and leaf sheaths of iron-sufficient rice, GUS staining was observed in phloem cells of the vascular bundles. In iron-deficient leaves, the OsYSL2 promoter was active in all tissues with particularly strong GUS activity evident in companion cells. The phloem-specific expression of the OsYSL2 promoter suggests that OsYSL2 is involved in the phloem transport of iron. Strong OsYSL2 promoter activity was also detected in developing seeds. Electrophysiological measurements using Xenopus laevis oocytes showed that OsYSL2 transported iron(II)-nicotianamine (NA) and manganese(II)-NA, but did not transport iron(III)-phyosiderophore. These results suggest that OsYSL2 is a rice metal-NA transporter that is responsible for the phloem transport of iron and manganese, including the translocation of iron and manganese into the grain.

The roots of graminaceous plants secrete mugineic acid family phytosiderophores (MAs), allowing the acquisition of sparingly soluble iron (Fe) from the soil. In barley, the secretion of MAs occurs in a distinct diurnal rhythm. Rice also secretes deoxymugineic acid (DMA) in response to Fe deficiency, but it is unclear whether the secretion also occurs in a diurnal rhythm. A time course analysis with Northern blots was used to examine the expression of genes encoding enzymes in the MA biosynthetic pathway. The transcriptional levels of the NAS and NAAT genes fluctuated diurnally in Fe-deficient rice roots. These results suggest that, as in barley, the secretion of DMA in rice changes in a diurnal rhythm. Furthermore, the transcriptional levels of genes encoding translation initiation factor 4A2 (elF4A2), ras-related small GTP-binding protein (GTPase), and ADP-ribosylation factor 1 (ARF1), which fluctuate diurnally in barley and are thought to be involved in the diurnal changes in MA secretion, also...

We identified four putative AtFRD3-like genes (OsFRDL) in the rice genome that exhibited 39.1 to 56.7% amino acid sequence similarities to Arabidopsis FRD3. Of these, we cloned three OsFRDL genes from a cDNA library prepared from iron-deficient rice roots: OsFRDL1, OsFRDL2, and OsFRDL3. OsFRDL1 was expressed weakly in Fe-sufficient roots, and slight expression was induced in the roots of Fe-deficient plants. OsFRDL2 was expressed constitutively in both roots and leaves, and Fe deficiency reduced its expression in leaves. OsFRDL3 was expressed in leaves, but not in roots; Fe deficiency induced slight expression in leaves. An OsFRDL1-sGFP fusion protein was localized in the plasma membrane in onion epidermal cells. The promoter GUS analysis showed that OsFRDL1 was localized in the cells involved in long-distance transport, in both Fe-sufficient and Fe-deficient plants. Furthermore, OsFRDL1 expression was observed during the reproductive stage. These results suggest that OsFRDL1 is a transporter tha...

Co-situs is the placement with one application of a sufficient amount of controlled-release fertilizer for an entire growing season at any site, together with seeds or seedlings, without causing fertilizer salt injury. An experiment was conducted to find an efficient method for ameliorating Fe deficiency in two rice cultivars (cv. Tsukinohikari and cv. Sasanishiki) grown in a calcareous soil (pH 9.2, CaCO3 384 g kg−1), which was poor in organic matter (0.1 g kg−1) and available Fe (3.0 μg g−1 soil). The field treatments consisted of co-situs application of the following fertilizers: 1) controlled-release NPK fertilizer (CRF-NPK) containing no micronutrients; 2) controlled-release NPK fertilizer containing micronutrients (CRF-M1); and 3) controlled-release NPK fertilizer containing micronutrients (CRF-M2). The main difference between CRF-M1 and CRF-M2 was that the former had larger granules than the latter. All the fertilizers were placed in contact with the roots of rice seedlings at transplantin...

Experiment was carried out to evaluate the, efficiency of different iron sources including polyolefin resin coated slow release Fe fertilizer (PRCCFe) and its methods of application on the performance of rice var. Swarna during rainy seasons of 2001 and 2002 under calcareous soil at Research Farm, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, India. The pots were filled with 10 kg calcareous soil having high CaCO3 (36.32%) and low iron contents (1.45 pp—less than critical limit). The experimental treatments comprised five iron sources (NPK + 100% pyrite, NPK + 100% polyolefin resin coated slow release Fe (PRCSRFe), NPK + 50% pyrite + 50% PRCSRFe, NPK + 75% pyrite + 25% PCRSRFe, and NPK + 25% pyrite + 75% PCRSRFe and two methods of application (uniform and co-situs) including one control (NPK only). These 11 treatment combinations were laid out in Completely Randomized Block Design (CRBD) replicated thrice. The two methods of iron application did not differ significantly ...

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.

The crown roots of rice (Oryza sativa L. cv. Nipponbare) nursery seedlings were more tolerant of Al than the seminal roots, in terms of elongation. Intense hematoxylin staining was observed in the root cap and meristem for the seminal roots, whereas in the meristem for the crown roots, which correspond to the Al concentration in both types of roots. Mottled hematoxylin staining was observed in the basal area, in a region located at approximately 4 mm from the tip of the seminal roots, in contrast to the crown roots, which showed laterally-striped staining. The concentration of callose induced by Al in the seminal roots was comparable to that in the crown roots, regardless of the root growth. Confocal laser scanning microscopy of roots stained with fluorescein diacetate-propidium iodide (FDA-PI) indicated that the plasma membrane of the epidermis of the root tip was damaged even in the absence of Al treatment. Al further impaired the plasma membrane of the root cap cells in the seminal and crown roots to a similar extent. These findings contradicted typical Al-injury phenomenon reported for Al-sensitive and Al-tolerant plants. It is also likely that different metabolic processes operate in the crown and seminal roots. Crown roots can develop Al tolerance either constitutively or inductively by exposure to Al. A comparison of gene expression should lead to the isolation of the genes that confer Al tolerance in higher plants.

To determine the responses of plants to deficiencies of multiple metals, tobacco plants (Nicotiana tabacum L.) were subjected to treatments that were deficient in combinations of Fe and two other micronutrients, Zn and Mn. The response was measured using macro indices, including plant appearance, FW, chlorophyll concentration, and mineral concentrations, and with a molecular index, the barley (Hordeum vulgare L.) Ids2 promoter/GUS fusion gene system (Yoshihara et al. 2003, Plant Biotech 20: 33-41). Tobacco plants grown in medium with combined deficiencies grew better and had higher chlorophyll concentrations than did plants grown on medium deficient in Fe only, although the measured Fe concentrations in the plant tissues were essentially the same. The 1ds2/GUS expression responded to Fe deficiency, but not to Mn or Zn deficiencies in tobacco plants when Fe was present. Tobacco plants grown in medium with combined deficiencies had clearly detectable GUS activity, but the response was significantly lower than that in tobacco plants deficient in Fe only. The Fed-deficiency symptoms were mitigated at both the visible and molecular levels. Although more precise experimental evidence is needed to explain the mitigation mechanism, the balance of minerals was shown to be an important parameter to consider when estimating iron deficiency based on tobacco plant responses.

Expression of the Ids2 (iron deficiency-specific clone 2) gene was compared between native barley and heterogenous tobacco regarding spatial specificity and iron-deficiency responsiveness. The results of Northern blot and in situ hybridization analyses demonstrated that the Ids2 expression in barley was specific to the endodermis and/or pericycle and in the cortex of roots, and responded exactly to iron starvation. Analysis of the GUS activity regulated by eight 5’-deletion clones of the Ids2 promoter in tobacco exhibited that every clone could promote root specific and iron-deficiency responsive expression. Aspects of the spatial specificity and iron-deficiency responsiveness (e.g. sensitivity, stability and returnability) in tobacco were also similar to those in barley, although a few variations were recognized. It is probable that even the shortest Ids2 promoter region in this experiment (-272/-47) contains the iron-deficiency-inducible and the root-specific cis-element(s), which is recognized by two different types of iron-acquisition strategy plants, barley and tobacco.

Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30–38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

Using H2 15O as a tracer, the effect of the nutrient concentration on the water flow at the discrimination center (DC) of rice was monitored using a positron multi-probe system (PMPS). The maximum velocity of the water flow was achieved by the use of 20× Kasugai's culture solution. The addition of 0.01 to 0.1% NaCl gradually decreased the velocity. In intact plants, the ionic strength of essential elements in the xylem sap may be effective in decreasing the xylem resistance, resulting in the increase of the water flow in the xylem.

Cyanidium caldarium (Tilden) Geitler, a unicellular red alga, has extraordinarily high aluminum (Al) tolerance. Algal cells cultured in the presence or absence of Al were subjected to transmission electron microscopy and energy dispersive X-ray analysis. Substantial changes to the thylakoid lumens were observed for the algal cells cultured in medium containing 200 mM Al, while other organelles were largely unaffected. Several spherical electron-dense bodies were found in the cytoplasm near the nucleus of both of the control and Al-treated cells. Although high levels of Fe and P were found in the bodies of control cells, immunocytochemical and morphological analysis data did not match the criteria established for Fe-accumulating substances like ferritin and phytate. In addition to these elements, Al was found in the bodies of the Al-treated cells. These results suggest that the electron-dense bodies function as an Fe-storage site under normal culture conditions, and that sequestration of Al in these bodies contributes to the high Al tolerance exhibited by C. caldarium.

Summary The change in polysaccharide synthesis was studied in the roots of barley and wheat seedlings exposed to Al. Rapid inhibition of 14C-glucose incorporation into the cellulose fraction, which occurred within 15 min of Al exposure, occurred in both barley and wheat root cells. The reduction in cellulose synthesis was more severe in an Al-sensitive wheat cultivar (Scout 66) than in an Al-tolerant wheat cultivar (Atlas 66). From these results, it can be hypothesized that a reduction in cellulose synthesis causes the Al-induced rapid inhibition of root elongation. Coumarin, a potent inhibitor of cellulose synthesis, inhibited root elongation, which supports the hypothesis. Roots exposed to Al also showed a rapid enhancement of radioactivity incorporation into the hemicellulose fraction, which was attributed to the induction of callose formation. Callose was formed simultaneously with the inhibition of cellulose synthesis, in inverse proportion to the decrease in cellulose. Therefore, the cellulose synthesis system can be switched to a callose synthesis system in Al-injured root cells.

Water (H 2 15 O) translocation from the roots to the top of rice plants (Oryza saliva L. cv. Nipponbare) was visualized over time by a positron-emitting tracer imaging system (PETIS). H 2 15 O flow was activated 8 min after plants were exposed to bright light (1500 μmol m -2 s -1 ). When the light was subsequently removed, the flow gradually slowed and completely stopped after 12 min. In plants exposed to low light (500 μmol m -2 s -1 ), H 2 15 O flow was activated more slowly, and a higher translocation rate of H 2 15 O was observed in the same low light at the end of the next dark period. NaCI (80 mM) and methylmercury (1 mM) directly suppressed absorption of H 2 15 O by the roots, while methionine sulfoximine (1 mM), abscisic acid (10 pM) and carbonyl cyanide m-chlorophenylhydrazone (10 mM) were transported to the leaves and enhanced stomatal closure, reducing H 2 15 O translocation.

We proposed that an Fe-deficiency-induced gene, Ids3 (Iron deficiency specific clone no. 3), from barley (Hordeum vulgare L.) roots encodes a dioxygenase that catalyzes the hydroxylation step from 2'-deoxymugineic acid (DMA) to mugineic acid (MA). To prove this hypothesis, we introduced the Ids3 gene into rice (Oryza sativa L.), which lacks Ids3 homologues and secretes DMA, but not MA. Transgenic rice plants, carrying either Ids3 cDNA or a barley genomic DNA fragment (20 kb) containing Ids3, were obtained using Agrobacterium-mediated transformation. Ids3 cDNA under the control of the cauliflower mosaic virus 35S promoter was constitutively expressed in both the roots and the leaves of the transgenic rice, regardless of Fe nutrition status. In contrast, in the roots of transformants carrying a barley genomic fragment, transcripts of Ids3 were markedly increased in response to Fe deficiency. Slight expression of Ids3 was also observed in the leaves of the Fe-deficient plants. Western blot analysis confirmed the induction of Ids3 in response to Fe deficiency in the roots of the transformants carrying a genomic fragment. These expression patterns indicate that the 5'-flanking region of Ids3 works as a strong Fe-deficiency-inducible promoter in rice, as well as in barley. Both kinds of transgenic rice secreted MA in addition to DMA under Fe-deficient conditions, but wild-type rice secreted only DMA. This is in vivo evidence that IDS3 is the "MA synthase" that converts DMA to MA.

The ammonium ion is an indispensable nitrogen source for crops, especially paddy rice ( Oryza sativa L. cv Nipponbare). Until now, it has been impossible to measure ammonium uptake and nitrogen movement in plants in real time. Using the new technologies of PETIS (positron emitting tracer imaging system) and PMPS (positron multi-probe system), we were able to visualize the real time translocation of nitrogen and water in rice plants. We used positron-emitting 13 N-labeled ammonium ( 13 NH 4 + ) and 15 O-water to monitor the movement. In plants cultured under normal conditions, 13 NH 4 + supplied to roots was taken up, and a 13 N signal was detected at the discrimination center, the basal part of the shoots, within 2 minutes. This rapid translocation of 13 N was almost completely inhibited by a glutamine synthetase inhibitor, methionine sulfoximine. In general, nitrogen deficiency enhanced 13 N translocation to the discrimination center. In the dark, 13 N translocation to the discrimination center was suppressed to 40% of control levels, whereas 15 O-water flow from the root to the discrimination center stopped completely in the dark. In abscisic acid-treated rice, 13 N translocation to the discrimination center was doubled, whereas translocation to leaves decreased to 40% of control levels. Pretreatment with NO 3 − for 36 hours increased 13 N translocation from the roots to the discrimination center to 5 times of control levels. These results suggest that ammonium assimilation (from the roots to the discrimination center) depends passively on water flow, but actively on NH 4 + -transporter(s) or glutamine synthetase(s).

15P-water flow from the roots to the top in tomato (Lycopersicon esculentum Mill.) and rice (Oryza sativa L.) plants was visualized with time using a positron-emitting tracer imaging system (PETIS). The 15O-water flow was switched on by light and completely stopped in the dark. The flow rate in the stem of tomato and the shoot of rice at a light intensity of 500 μmol·m−2·s−1 was 1.9 and 0.4 cm min−1, respectively.

A new Fe-deficiency-inducible cDNA, IDI2, was isolated from Fe-deficient barley roots using the cDNA MACRO Array Technique. Accumulation of IDI2 transcripts in barley roots was strongly correlated with iron nutritional status. IDI2 encoded a protein with a low similarity to the alpha subunit of eukaryotic initiation factor 2B (eIF2Balpha). In addition, many hypothetical proteins homologous to IDI2 were also found in a database search. These proteins had limited similarity to eIF2Balpha as well as IDI2. It has been reported that these eIF2Balpha-like proteins (eIF2Balpha-LPs) are a family that is distinct from the eIF2Balpha/beta/delta family and widely distributed in the archaea, bacteria, and eukarya. A phylogenic analysis revealed that IDI2 is the first member of the eIF2Balpha-LP family to be found in higher plants. A possible role of IDI2 protein in regulating protein synthesis in Fe-deficient barley roots is proposed.

To isolate the genes involved in the response of graminaceous plants to Fe-deficient stress, a protein induced by Fe-deficiency treatment was isolated from barley (Hordeum vulgare L.) roots. Based on the partial amino acid sequence of this protein, a cDNA (HvAPT1) encoding adenine phosphoribosyltransferase (APRT: EC 2.4.2.7) was cloned from a cDNA library prepared from Fe-deficient barley roots. Southern analysis suggested that there were at least two genes encoding APRT in barley. Fe deficiency increased HvAPT1 expression in barley roots and resupplying Fe to the Fe-deficient plants rapidly negated the increase in HvAPT1 mRNA. Analysis of localization of HvAPT1-sGFP fusion proteins in tobacco BY-2 cells indicated that the protein from HvAPT1 was localized in the cytoplasm of cells. Consistent with the results of Northern analysis, the enzymatic activity of APRT in barley roots was remarkably increased by Fe deficiency. This induction of APRT activity by Fe deficiency was also observed in roots of other graminaceous plants such as rye, maize, and rice. In contrast, the induction was not observed to occur in the roots of a non-graminaceous plant, tobacco. Graminaceous plants generally synthesize the mugineic acid family phytosiderophores (MAs) in roots under Fe-deficient conditions. In this paper, a possible role of HvAPT1 in the biosynthesis of MAs related to adenine salvage in the methionine cycle is discussed.

IDI1, a cDNA induced by Fe-deficiency, was isolated from Fe-deficient barley roots by differential hybridization screening. IDI1 transcripts in roots increased with Fe-deficiency treatment. IDI1 cDNA encoded a protein with 198 amino acids. The IDI1 protein is homologous to the bacterial protein E-2, which catalyzes the formation of a 2-keto-methylthiobutyric acid in the methionine salvage pathway. IDI1 protein is postulated to be an enzyme that participates in the pathway providing methionine for phytosiderophore production in Fedeficient barley roots.

A cDNA clone, Ids3 (iron deficiency-specific clone 3), was isolated from an Fe-deficient-root cDNA library of Hordeum vulgare. Ids3 encodes a protein of 339 amino acids with a calculated molecular mass of 37.7 kDa, and its amino acid sequence shows a high degree of similarity with those of plant and fungal 2-oxoglutarate-dependent dioxygenases. One aspartate and two histidine residues for ferrous Fe binding (Asp-211, His-209, His-265) and arginine and serine residues for 2-oxoglutarate binding (Arg-275, Ser-277) are conserved in the predicted amino acid sequence of Ids3. Ids3 expression was rapidly induced by Fe deficiency, and was suppressed by re-supply of Fe. Among eight graminaceous species tested, Ids3 expression was observed only in Fe-deficient roots of H. vulgare and Secale cereale, which not only secrete 2′-deoxymugineic acid (DMA), but also mugineic acid (MA) and 3-epihydroxymugineic acid (epiHMA, H. vulgare), and 3-hydroxymugineic acid (HMA, S. cereale). The Ids3 gene is encoded on the long arm of chromosome 4H of H. vulgare, which also carries the hydroxylase gene that converts DMA to MA. Moreover, the Ids2 gene, which is the plant dioxygenase with the highest homology to Ids3, is encoded on the long arm of chromosome 7H of H. vulgare, which carries the hydroxylase gene that converts MA to epiHMA. The observed expression patterns of the Ids3 and Ids2 genes strongly suggest that IDS3 is an enzyme that hydroxylates the C-2′ positions of DMA and epiHDMA, while IDS2 hydroxylates the C-3 positions of MA and DMA.

Nicotianamine synthase (NAS) catalyzes the trimerization of S-adenosylmethionine to form one molecule of nicotianamine (NA). NA is present in all the plants; it chelates metal cations, and is considered to play a role in metal homeostasis in plants. Moreover, in graminaceous monocotyledonous plants, NA is an essential intermediate in the biosynthesis of mugineic acid family phytosiderophores (MAs). In order to identify the gene encoding NAS in dicotyledonous plants, Arabidopsis thaliana databases were searched using the nucleotide sequence of the NAS gene from barley (HvNAS), which we have recently isolated. We found several ESTs and three genomic sequences highly homologous to HvNAS in the databases. Based on these nucleotide sequences and that of HvNAS, we designed 2 sets of primers to isolate the NAS orthologues in Arabidopsis and succeeded in obtaining three DNA clones encoding AtNAS (AtNAS1, 2, and 3). These clones were expressed in Escherichia coli and their protein products displayed the N...

To clarify the mechanism(s) involved in the short-term inhibition of root elongation by AI, we monitored the morphological changes of barley roots by digital microscopy. Within 30 min after exposure to 37 µM AI, the surface of the root epidermis in the region of a distance of 1.5 mm from the root tip became rough and began to show signs of damage. After 38 min, callose was rapidly excreted from the junction between the root cap and the root epidermis, and formed a spherical lump approximately 60 µm in diameter. The fine structure of the callose deposits on the root surface was analyzed by low-vacuum scanning electron microscopy. After 50 min, there was a significant increase in the callose contents in the distal 0.6 mm part. At the same time, root elongation stopped completely. Fluorescence staining indicated that callose was localized on the surface of the cell elongation area (the elongation zone of primary roots and root hairs), but not on the surface of the meristem. The root growth reduction...

A strain of an acidophilic, thermophilic alga, Cyanidium caldarium, was cultured in a medium containing various metal ions (A1, Cd, Cr, Cu, Mn, Ni, Zn). Among these metals, the alga tolerates especially high levels of AI: it can grow in a medium containing 200 mM AI, although the growth rate was reduced to 58%. The cellular Al concentration was kept at a considerably lower level as compared to the medium Al concentration. This may account for the Al tolerance of the alga. Treatment of the algal cells with carbonylcyanide m-chlorophenylhydrazone in the presence of Al increased the cellular Al concentration. It was suggested that energy-coupled Al exclusion mechanisms can operate in the alga.

Nicotianamine synthase (NAS) catalyzes the synthesis of nicotianamine, which is an intermediate in the biosynthetic pathway of mugineic acid family phytosiderophores (MAs). Using polyclonal anti-NAS antibodies and recombinant NAS proteins, we identified five NAS isozymes and one NAS homologue in Fe-deficient barley roots using two-dimensional electrophoresis followed by Western blot analysis. Other unidentified NAS homologues that were induced by Fe-deficiency were also detected in barley roots. Western analysis enabled to detect NAS homologues in wheat, oats, rice, maize, and sorghum roots. In graminaceous species, both the amount and number of NAS homologues were correlated with the total NAS activity and Fe-deficiency tolerance. The NAS isoform patterns differed among the graminaceous plants.

Fe(III) reduction at the root surface is an obligatory step in Fe uptake used by Strategy-I plants. The genes FRE1 and FRE2 are responsible for a similar mechanism of Fe acquisition in the cell membrane of Saccharomyces cerevisiae. We introduced the FRE1 gene into tobacco plants (Nicotiana tabacum L. cv. SR1). However, the transgenic tobacco showed no additional reductase activity, because the FRE1 transcripts from this transgenic tobacco were shorter than expected. Further investigation revealed that the coding region of the FRE1 gene was polyadenylated. We then reconstructed the whole sequence of the FRE1 gene and named it refre1 (reconstructed FRE1). The refre1 gene was introduced into tobacco plants. The transgenic plants carrying the refre1 gene produced full length mRNA and had constitutive ferric reductase activity.

Alfalfa (Medicago sativa L.) grows well in soils with a moderately high pH and dissolves insoluble iron in the rhizosphere. We have investigated active uptake mechanisms under Fe-deficient nutrient conditions and the effects of Fe-deficiency on plants. Previously, we observed that Fe-deficient alfalfa roots exuded many compounds (Masaoka et al. 1993) such as fiavonoids. We also identified a new compound “alfafuran” which is a phenol compound and is different from organic acids or phytosiderophore-type amino acid derivatives exuded by Fe-deficient plant roots. This compound is also very effective in dissolving ferric phosphate (Noguchi et al. 1994), suggesting that alfalfa may have developed several strategies against Fe-deficient stress including the exudation of organic compounds like alfafuran which accelerate the Fe3+-reducing activity on the root cell membrane to dissolve insoluble iron compounds. Suzuki et al. (1995, 1997) observed that in barley several peptide spots obtained by electrophor...

To identify the proteins induced by Fe deficiency, we have compared the proteins of Fe-sufficient and Fe-deficient barley (Hordeum vulgare L.) roots by two-dimensional polyacrylamide gel electrophoresis. Peptide sequence analysis of induced proteins revealed that formate dehydrogenase (FDH), adenine phosphoribosyltransferase, and the Ids3gene product (for Fe deficiency-specific) increased in Fe-deficient roots. FDH enzyme activity was detected in Fe-deficient roots but not in Fe-sufficient roots. A cDNA encoding FDH (Fdh) was cloned and sequenced. Fdh expression was induced by Fe deficiency. Fdh was also expressed under anaerobic stress and its expression was more rapid than that induced by Fe deficiency. Thus, the expression of Fdh observed in Fe-deficient barley roots appeared to be a secondary effect caused by oxygen deficiency in Fe-deficient plants.

Translocation studies of 59 Fe(IH)-epihydroxymugineic acid in intact barley plants revealed that Fe transport from leaf veins to mesophyll cells is light-regulated. Similarly, Fe absorption studies with isolated chloroplasts showed that the Fe influx is light-dependent whereas its efflux occurred in the dark.