Search

The composition of proanthocyanidins in the testa (seed coat) of bread wheat was analysed by thiolysis of PA oligomers from developing grain and found to consist of (+)-catechin monomers, with a small amount of (+)-gallocatechin. The average chain length of soluble PA stayed relatively constant between 10 and 20 days post-anthesis, whereas that of unextractable PA increased over the same period, suggesting that increases in chain length might account for the insolubility of PAs from mature wheat grain. We carried out RNAseq followed by differential expression analysis from dissected tissues of developing grain from red- and white-grained near-isogenic lines differing in the presence of an active R gene that encodes a MYB transcription factor involved in control of PA biosynthesis. In addition to genes already identified encoding chalcone synthase, chalcone isomerase, flavanone 3-hydroxylase and dihydroxyflavonoid 4-reductase, we showed that wheat genes encoding phenylalanine ammonia lyase, flavonoid 3’5’-hydroxylase, leucoanthocyanidin reductase and a glutathione S-transferase (the orthologue of maize Bronze-2) were more highly expressed in the red NIL. We also identified candidate orthologues of other catalytic and regulatory components of flavonoid biosynthesis in wheat.

Amino acids are delivered into developing wheat grains to support the accumulation of storage proteins in the starchy endosperm, and transporters play important roles in regulating this process. RNA-seq, RT-qPCR, and promoter-GUS assays showed that three amino acid transporters are differentially expressed in the endosperm transfer cells (TaAAP2), starchy endosperm cells (TaAAP13), and aleurone cells and embryo of the developing grain (TaAAP21), respectively. Yeast complementation revealed that all three transporters can transport a broad spectrum of amino acids. RNAi-mediated suppression of TaAAP13 expression in the starchy endosperm did not reduce the total nitrogen content of the whole grain, but significantly altered the composition and distribution of metabolites in the starchy endosperm, with increasing concentrations of some amino acids (notably glutamine and glycine) from the outer to inner starchy endosperm cells compared with wild type. Overexpression of TaAAP13 under the endosperm-specific HMW-GS (high molecular weight glutenin subunit) promoter significantly increased grain size, grain nitrogen concentration, and thousand grain weight, indicating that the sink strength for nitrogen transport was increased by manipulation of amino acid transporters. However, the total grain number was reduced, suggesting that source nitrogen remobilized from leaves is a limiting factor for productivity. Therefore, simultaneously increasing loading of amino acids into the phloem and delivery to the spike would be required to increase protein content while maintaining grain yield. © 2021 Wan et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Background The gibberellin (GA) pathway plays a central role in the regulation of plant development, with the 2-oxoglutarate-dependent dioxygenases (2-ODDs: GA20ox, GA3ox, GA2ox) that catalyse the later steps in the biosynthetic pathway of particularly importance in regulating bioactive GA levels. Although GA has important impacts on crop yield and quality, our understanding of the regulation of GA biosynthesis during wheat and barley development remains limited. In this study we identified or assembled genes encoding the GA 2-ODDs of wheat, barley and Brachypodium distachyon and characterised the wheat genes by heterologous expression and transcript analysis. Results The wheat, barley and Brachypodium genomes each contain orthologous copies of the GA20ox, GA3ox and GA2ox genes identified in rice, with the exception of OsGA3ox1 and OsGA2ox5 which are absent in these species. Some additional paralogs of 2-ODD genes were identified: notably, a novel gene in the wheat B genome related to GA3ox2 was shown to encode a GA 1-oxidase, named as TaGA1ox-B1. This enzyme is likely to be responsible for the abundant 1β-hydroxylated GAs present in developing wheat grains. We also identified a related gene in barley, located in a syntenic position to TaGA1ox-B1, that encodes a GA 3,18-dihydroxylase which similarly accounts for the accumulation of unusual GAs in barley grains. Transcript analysis showed that some paralogs of the different classes of 2-ODD were expressed mainly in a single tissue or at specific developmental stages. In particular, TaGA20ox3, TaGA1ox1, TaGA3ox3 and TaGA2ox7 were predominantly expressed in developing grain. More detailed analysis of grain-specific gene expression showed that while the transcripts of biosynthetic genes were most abundant in the endosperm, genes encoding inactivation and signalling components were more highly expressed in the seed coat and pericarp. Conclusions The comprehensive expression and functional characterisation of the multigene families encoding the 2-ODD enzymes of the GA pathway in wheat and barley will provide the basis for a better understanding of GA-regulated development in these species. This analysis revealed the existence of a novel, endosperm-specific GA 1-oxidase in wheat and a related GA 3,18-dihydroxylase enzyme in barley that may play important roles during grain expansion and development. Electronic supplementary material The online version of this article (doi:10.1186/s12870-015-0520-7) contains supplementary material, which is available to authorized users.

Functional analysis of a gibberellin-regulated wheat alpha-amylase promoter, alpha-Amy2/54, has indicated that three regions were essential for expression. By studying the ability of mutant promoters, containing a randomly inserted 22 bp excision linker, to direct expression in oat aleurone protoplasts we have refined the positions and extents of these three cis elements and also demonstrated the presence of two additional elements. By converting the linker insertions to either single base point mutations or deletions using the class IIS restriction endonuclease BsmI we have shown that nucleotides -119 and -109 within the GARE -121GTAACAGAGTCTGG-108 and nucleotide -152 within the proposed element -156GATTGACTTGACC-144 are essential for high level expression from this promoter.

Gibberellins (GAs) are involved in the control of a number of key developmental processes in plants, including endosperm mobilisation stem elongation and flowering. In many of these systems, GA modulates the transcription of specific genes. The aim of this paper is to review current progress in identifying and characterising GA-regulated genes; both the control of gene expression and the function of the gene products are discussed. The most well-characterised system in which GA is active in controlling transcription is the aleurone layer of cereal grains, where it induces the synthesis of a range of hydrolytic enzymes, including a-amylase. Analysis of the promoters of a-Amy1 and a-Amy2 genes by transient expression in aleurone cells and protoplasts together with DNase 1 footprinting and gel-retardation assays, has identified a number of cis-acting elements important for high-level, GA-regulated expression. In particular a GA-response element (GARE) including the sequence TAACRRA has been characterised. Recent reports describe cDNA clones encoding trans-acting factors that bind to elements in the a-amylase promoters. Expression of the factor capable of binding to the TAACRRA element is itself induced by GA. In elongating tissues, GA has been shown to control the expression of a number of genes, including the tonoplast intrinsic protein, a water channel which may regulate water flux into the vacuole during cell expansion. In flower development, expression of flavonoid biosynthetic genes, such as chalcone synthase in Petunia corollas, is regulated by GA at the level of transcription. Analysis of GA-response mutants led to the suggestion that one consequence of GA action is to regulate its own biosynthesis. Genes encoding GA 20-oxidase and 3β-hydroxylase have recently been shown to be down-regulated by applied GA, providing a possible mechanism for feedback regulation of the GA biosynthetic pathway. There is evidence that cells perceive GA at the cell surface, implying the existence of a signal transduction system between plasma membrane and nucleus. This signal transduction system has barely begun to be elucidated but is likely to become a major focus of gibberellin research.

cDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.

The sequence and expression characteristics are described of a wilt-inducible gene in Arabidopsis thaliana. A 1494 encodes a potential thiol protease whose mRNA accumulates rapidly in shoot tissue upon the loss of turgor. A1494 mRNA levels peaked after ca. 4 h and declined thereafter. Dehydration also induced rapid biosynthesis of the phytohormone abscisic acid (ABA), which continued for at least 9 h. Exogenous ABA induced the accumulation of A1494 mRNA, with kinetics similar to those after wilting. Rehydration of wilted shoots led to a rapid decline in the content of both ABA and A1494 mRNA. Wilting and ABA independently induced A1494 expression as evidenced by the effects of ABA and wilting on the ABA-deficient aba-1 and ABA-insensitive abi-1 and abi-3 genotypes. A1494 mRNA was not detectable in aba-1 shoots but accumulated rapidly after either wilting or ABA treatment, whereas the shoot ABA content was increased only by ABA treatment. ABA had no effect on A1494 mRNA levels in the abi-1 and abi-3 mutants but wilting did result in enhanced A1494 expression. Heat shock had only a minor effect on A1494 mRNA levels, whereas exposure to low temperature resulted in substantial accumulation of A1494 mRNA in wild-type shoots. However, this latter response, unlike that to drought, was mediated exclusively via ABA synthesis as demonstrated by the lack of A1494 mRNA accumulation in cold-treated aba-1 shoots.

The Arabidopsis ga1 mutant has very low levels of endogenous, active gibberellins and thus has an extreme dwarf phenotype; application of GA3 induces stem elongation and flower development. To test the hypothesis that GA action in this system involves changes in gene expression, we have cloned mRNAs whose abundance changes following GA application. A subtraction cloning scheme for the isolation of differentially regulated cDNAs was established, involving hybridization of single-stranded cDNA to biotinylated mRNA. cDNA populations enriched up to 150-fold in GA-regulated sequences were produced and cDNA libraries generated. Screening of these libraries has isolated two clones that identify mRNAs of ca. 1100 and 750 bases whose abundance is markedly increased 24 h after GA application. One of these clones encodes the vegetative form of the Arabidopsis tonoplast intrinsic protein (gamma-TIP), a water channel protein, the expression of which has recently been shown to be correlated with regions of cell expansion. The second clone is expressed only in the inflorescence and encodes a proline- and glycine-rich protein that may be a cell wall component.

The CLAVATA1 (CLV1) receptor kinase controls stem cell number and differentiation at the Arabidopsis shoot and flower meristems. Other components of the CLV1 signaling pathway include the secreted putative ligand CLV3 and the receptor-like protein CLV2. We report evidence indicating that all intermediate and strong clv1 alleles are dominant negative and likely interfere with the activity of unknown receptor kinase(s) that have functional overlap with CLV1. clv1 dominant-negative alleles show major differences from dominant-negative alleles characterized to date in animal receptor kinase signaling systems, including the lack of a dominant-negative effect of kinase domain truncation and the ability of missense mutations in the extracellular domain to act in a dominant-negative manner. We analyzed chimeric receptor kinases by fusing CLV1 and BRASSINOSTEROID INSENSITIVE1 (BRI1) coding sequences and expressing these in clv1 null backgrounds. Constructs containing the CLV1 extracellular domain and the BRI1 kinase domain were strongly dominant negative in the regulation of meristem development. Furthermore, we show that CLV1 expressed within the pedicel can partially replace the function of the ERECTA receptor kinase. We propose the presence of multiple receptors that regulate meristem development in a functionally related manner whose interactions are driven by the extracellular domains and whose activation requires the kinase domain.

Two cDNA clones (NtmybAS1 andNtmybAS2) encoding MYB-related proteins with strong sequence similarity to petunia (Petunia hybrida) PhMYB3 were isolated from a tobacco (Nicotiana tabacumcv Samsun) pollen cDNA library. Northern blot and in situ hybridization revealed that NtmybAS transcripts are specifically expressed in both sporophytic and gametophytic tissues of the anther including tapetum, stomium, vascular tissue, and developing pollen. Random binding site selection assays revealed that NtMYBAS1 bound to DNA sequences closely resembling consensus MYB binding sites MBSI and MBSIIG, with a higher affinity for MBSI. Transient expression analyses of the N-terminal MYB domain demonstrated the presence of functional nuclear localization signals, and full-length NtMYBAS1 was able to activate two different phenylalanine ammonia-lyase promoters (PALA and gPAL1) in tobacco leaf protoplasts. Similar analysis of truncated NtmybAS1cDNAs identified an essential, C-terminal trans-activation domain. Further in situ hybridization analyses demonstrated strict co-expression of NtmybAS and gPAL1 in the tapetum and stomium. Despite abundant expression ofNtmybAS transcripts in mature pollen,gPAL1 transcripts were not detectable in pollen. Our data demonstrate that NtMYBAS1 is a functional anther-specific transcription factor, which is likely to be a positive regulator ofgPAL1 expression and phenylpropanoid synthesis in sporophytic, but not in gametophytic, tissues of the anther.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid.

The aim of the present study was to provide useful background information and evidence of the functionality of the maize Activator/Dissociation (Ac/Ds) system in hexaploid wheat. Two transgenic parental wheat lines, one harbouring the immobilised Ac element (iAc) and the other the Ds element (pUbi[Ds-uidA]bar), were crossed. Transient GUS assays confirmed that the iAc transposase is active in hexaploid wheat. Selected F1 and F2 lines were analysed by PCR using primers specific to Ac, uidA and bar genes. The primer pair Ubi/bar-tag was used to detect excision of the Ds-uidA sequence, which occurred at a frequency of 39% in the F1 generation. Lines free of Ac and showing evidence of Ds excision were subject to Southern analysis, which indicated that at least one transposition event might have occurred in these lines. Although more evidence is required to unequivocally support the reintegration of the Ds element in the wheat genome, the evidence presented here nevertheless demonstrates the effectiveness and potential value of using this system to tag genes in wheat.

Summary Free asparagine is the precursor for acrylamide, which forms during the baking, toasting and high‐temperature processing of foods made from wheat. In this study, CRISPR/Cas9 was used to knock out the asparagine synthetase gene, TaASN2, of wheat (Triticum aestivum) cv. Cadenza. A 4‐gRNA polycistronic gene was introduced into wheat embryos by particle bombardment and plants were regenerated. T1 plants derived from 11 of 14 T0 plants were shown to carry edits. Most edits were deletions (up to 173 base pairs), but there were also some single base pair insertions and substitutions. Editing continued beyond the T1 generation. Free asparagine concentrations in the grain of plants carrying edits in all six TaASN2 alleles (both alleles in each genome) were substantially reduced compared with wildtype, with one plant showing a more than 90 % reduction in the T2 seeds. A plant containing edits only in the A genome alleles showed a smaller reduction in free asparagine concentration in the grain, but the concentration was still lower than in wildtype. Free asparagine concentration in the edited plants was also reduced as a proportion of the free amino acid pool. Free asparagine concentration in the T3 seeds remained substantially lower in the edited lines than wildtype, although it was higher than in the T2 seeds, possibly due to stress. In contrast, the concentrations of free glutamine, glutamate and aspartate were all higher in the edited lines than wildtype. Low asparagine seeds showed poor germination but this could be overcome by exogenous application of asparagine.

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from Arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1–2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1–2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.