Search

Lexitropsins are small molecules that bind to the minor groove of DNA as antiparallel dimers in a specific orientation. These molecules have shown therapeutic potential in the treatment of several diseases; however, the development of these molecules to target particular genes requires revealing the factors that dictate their preferred orientation in the minor grooves, which to date have not been investigated. In this study, a distinct structure (thzC) was carefully designed as an analog of a well-characterized lexitropsin (thzA) to reveal the factors that dictate the preferred binding orientation. Comparative evaluations of the biophysical and molecular modeling results of both compounds showed that the position of the dimethylaminopropyl group and the orientation of the amide links of the ligand with respect to the 5'-3'-ends; dictate the preferred orientation of lexitropsins in the minor grooves. These findings could be useful in the design of novel lexitropsins to selectively target specific genes.

Molecular dynamics simulations are used to elucidate the structure and thermodynamics of DNA triplexes associated with the neurodegenerative disease Friedreich's ataxia (FRDA), as well as complexes of these triplexes with the small molecule netropsin, which is known to destabilise triplexes. The ability of molecular simulations in explicit solvent to accurately capture triplex thermodynamics is verified for the first time, with the free energy to dissociate a 15-base antiparallel purine triplex-forming oligomer (TFO) from the duplex found to be slightly higher than reported experimentally. The presence of netropsin in the minor groove destabilises the triplex as expected, reducing the dissociation free energy by approximately 50%. Netropsin binding is associated with localised narrowing of the minor groove near netropsin, an effect that has previously been under contention. This leads to localised widening of the major groove, weakening hydrogen bonds between the TFO and duplex. Consequently, destabilisation is found to be highly localised, occurring only when netropsin is bound directly opposite the TFO. The simulations also suggest that near saturation of the minor groove with ligand is required for complete triplex dissociation. A structural analysis of the DNA triplexes that can form with the FRDA-related duplex sequence indicates that the triplex with a parallel homopyrimidine TFO is likely to be more stable than the antiparallel homopurine-TFO triplex, which may have implications for disease onset and treatment.

A-tracts are sequences of repeated adenine bases that, under the proper conditions, are capable of mediating DNA curvature. A-tracts occur naturally in the regulatory regions of many organisms, yet their biological functions are not fully understood. Orienting multiple A-tracts together constructively or destructively in a phase has the potential to create different shapes in the DNA helix axis. One means of detecting these molecular shape differences is from altered DNA mobilities measured using electrophoresis. The small molecule netropsin binds the minor groove of DNA, particularly at AT-rich sequences including A-tracts. Here, we systematically test the hypothesis that netropsin binding eliminates the curvature of A-tracts by measuring the electrophoretic mobilities of seven 98-base pair DNA samples containing different numbers and arrangements of centrally located A-tracts under varying conditions with netropsin. We find that netropsin binding eliminates the mobility difference between the DNA fragments with different A-tract arrangements in a concentration-dependent manner. This work provides evidence for the straightening of A-tracts upon netropsin binding and illustrates an artificial approach to re-sculpt DNA shape.

Studies on DNA-ligand interactions in the cellular environment are problematic due to the lack of suitable biophysical tools. To address this need, we developed an in-cell NMR-based approach for monitoring DNA-ligand interactions inside the nuclei of living human cells. Our method relies on the acquisition of NMR data from cells electroporated with preformed DNA-ligand complexes. The impact of the intracellular environment on the integrity of the complexes is assessed based on in-cell NMR signals from unbound and ligand-bound forms of a given DNA target. This technique was tested on complexes of two model DNA fragments and four ligands, namely, a representative DNA minor-groove binder (netropsin) and ligands binding DNA base-pairing defects (naphthalenophanes). In the latter case, we demonstrate that two of the three in vitro-validated ligands retain their ability to form stable interactions with their model target DNA in cellulo, whereas the third one loses this ability due to off-target interactions with genomic DNA and cellular metabolites. Collectively, our data suggest that direct evaluation of the behavior of drug-like molecules in the intracellular environment provides important insights into the development of DNA-binding ligands with desirable biological activity and minimal side effects resulting from off-target binding.

DNA condensation is a ubiquitous phenomenon in biology, yet the physical basis for it has remained elusive. Here, we have explored the mechanism of DNA condensation through the protamine-DNA interaction, and by examining on it the influence of DNA binding drugs. We observed that the DNA condensation is accompanied by B to Ψ-DNA transition as a result of DNA base pair distortions due to protamine binding, bringing about the formation of toroidal structure through coil-globule transition. The binding energetics suggested that electrostatic energy, bending energy and hydration energy must play crucial roles in DNA condensation. EtBr intercalation interferes with the protamine-DNA interaction, challenging the distortion of the DNA helix and separation of DNA base pairs by protamine. Thus, EtBr, by competing directly with protamine, resists the phenomenon of DNA condensation. On the contrary, netropsin impedes the DNA condensation by an allosteric mechanism, by resisting the probable DNA major groove bending by protamine. In summary, we demonstrate that drugs with distinct binding modes use different mechanism to interfere with DNA condensation.

DNA is the target of chemical compounds (drugs, pollutants, photosensitizers, etc.), which bind through non-covalent interactions. Depending on their structure and their chemical properties, DNA binders can associate to the minor or to the major groove of double-stranded DNA. They can also intercalate between two adjacent base pairs, or even replace one or two base pairs within the DNA double helix. The subsequent biological effects are strongly dependent on the architecture of the binding motif. Discriminating between the different binding patterns is of paramount importance to predict and rationalize the effect of a given compound on DNA. The structural characterization of DNA complexes remains, however, cumbersome at the experimental level. In this contribution, we employed all-atom molecular dynamics simulations to determine the standard binding free energy of DNA with netropsin, a well-characterized antiviral and antimicrobial drug, which associates to the minor groove of double-stranded DNA. To overcome the sampling limitations of classical molecular dynamics simulations, which cannot capture the large change in configurational entropy that accompanies binding, we resort to a series of potentials of mean force calculations involving a set of geometrical restraints acting on collective variables.

The small molecules that bind to DNA minor groove are considered as potential therapeutic agents to fight against many human diseases. They induce cell death by interfering with transcription, replication and progression of cell cycle. Herein, we report the synthesis of imidazopyridine-3-amines using sulfated ceria catalyst by employing Groebkee-Blackburne-Bienayme reaction. We evaluated the possible antiproliferative and antimycobacterial activity against A549 cells and Mycobacterium tuberculosis, respectively. Among the tested compounds, N-tert-butyl-2-(2-butyl-4-chloro-1H-imidazol-5-yl)-5,7-dimethylimidazo[1,2-a]pyridin-3-amine (4g) was identified as cytotoxic heterocycle and antimycobacterial agent. Molecular docking studies of the imidazopyridine derivatives revealed the consistent positioning in the minor groove with a tight shape fit between receptor and ligands. Therefore, we speculate that new imidazopyridines induce their pharmacological effect by targeting the minor groove of DNA.

We review the preparation of new compounds with good solution and cell uptake properties that can selectively recognize mixed A·T and G·C bp sequences of DNA. Our underlying aim is to show that these new compounds provide important new biotechnology reagents as well as a new class of therapeutic candidates with better properties and development potential than other currently available agents. In this review, entirely different ways to recognize mixed sequences of DNA by modifying AT selective heterocyclic cations are described. To selectively recognize a G·C base pair an H-bond acceptor must be incorporated with AT recognizing groups as with netropsin. We have used pyridine, azabenzimidazole and thiophene-N-methylbenzimidazole GC recognition units in modules crafted with both rational design and empirical optimization. These modules can selectively and strongly recognize a single G·C base pair in an AT sequence context. In some cases, a relatively simple change in substituents can convert a heterocyclic module from AT to GC recognition selectivity. Synthesis and DNA interaction results for initial example lead modules are described for single G·C base pair recognition compounds. The review concludes with a description of the initial efforts to prepare larger compounds to recognize sequences of DNA with more than one G·C base pairs. The challenges and initial successes are described along with future directions.

DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2 0 -deoxyadenosine and 2 0 -deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3-(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2 0 -deoxycytidine lesions form the base pair with guanine while the 2 0 -deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides.

Although the molecular mechanism and thermodynamic profile of a wide variety of chemical agents have been examined intensively in the past decades in terms of specific recognition of their protein receptors, to date the physicochemical nature of DNA-drug recognition and association still remains largely unexplored. The present study focused on understanding the structural basis, energetic landscape, and biological implications underlying the binding of small-molecule ligands to their cognate or non-cognate DNA receptors. First, a new method to capture the structural features of DNA-drug complex architecture was proposed and then used to correlate the extracted features with binding affinity of the complexes. By employing this method, a statistical regression-based predictor was developed to quantitatively evaluate the interaction potency of drug compounds with DNA in a fast and reliable manner. Subsequently, we use the predictor to examine the binding behavior of a number of structure-available, affinity-known DNA-drug complexes as well as a large pool of randomly generated DNA decoys in complex with the same drugs. It was found that (1) as compared with protein-DNA recognition, small-molecule agents have relatively low specificity in selecting their cognate DNA targets from the background of numerous random decoys; (2) the abundance of A-T base pairs in the DNA core motif exhibits a significant positive correlation with the affinity of drug ligand binding to the DNA receptor; and (3) high affinity seems not to be closely related to high selectivity for a DNA-targeting drug, although high-affinity drug entities have a greater possibility of being ranked computationally as top binders. We hope that this work will provide a preliminary insight into the molecular origin of sequence-specific interactions in DNA-drug recognition.

Most of the clinically used anticancer drugs exert their antitumor effect by damaging the replication machinery of DNA either by covalent or non-covalent binding. Intercalation and groove fitting are the major modes of non-covalent interaction. Small crescent shaped molecules have been claimed to bind with DNA via minor grooves. A plethora of hybrid molecules based on distamycin or netropsin have been synthesised with the objectives of improved selectivity and specificity with no/reduced unwanted side effects. This review critically and objectively describes the previously known hybrid DNA minor groove binding agents based on five membered, distamycin or netropsin. Moreover, the future use of six-membered benzamides has also been highlighted. Special emphasis has been put on developing structure-activity relationships of DNA minor groove binding agents.

Molecular docking, molecular mechanics, molecular dynamics and relaxation matrix simulation protocols have been extensively used to generate the structural details of ligand-receptor complexes in order to understand the binding interactions between the two entities. Experimental methods like NMR spectroscopy and X-ray crystallography are known to provide structural information about ligand-receptor complexes. In addition, fluorescence spectroscopy, circular dichroism (CD) spectroscopy and molecular docking have also been utilized to decode the phenomenon of the ligand-DNA interactions, with good correlation between experimental and computational results. The DNA binding affinity was demonstrated by analysing fluorescence spectral data. Structural rigidity of DNA upon ligand binding was identified by CD spectroscopy. Docking is carried out using the DNA-Dock program which results in the binding affinity data along with structural information like interatomic distances and H-bonding, etc. The complete structural analyses of various drug-DNA complexes have afforded results that indicate a specific DNA binding pattern of these ligands. It also exhibited that certain structural features of ligands can make a ligand to be AT- or GC-specific. It was also demonstrated that changing specificity from AT base pairs to GC base pairs further improved the DNA topoisomerase inhibiting activity in certain ligands. Thus, a specific molecular recognition signature encrypted in the structure of ligand can be decoded and can be effectively employed in designing more potent antiviral and antitumour agents.

Structural results with minor groove binding agents, such as netropsin, have provided detailed, atomic level views of DNA molecular recognition. Solution studies, however, indicate that there is complexity in the binding of minor groove agents to a single site. Netropsin, for example, has two DNA binding enthalpies in isothermal titration calorimetry (ITC) experiments that indicate the compound simultaneously forms two thermodynamically different complexes at a single AATT site. Two proposals for the origin of this unusual observation have been developed: (i) two different bound species of netropsin at single binding sites and (ii) a netropsin induced DNA hairpin to duplex transition. To develop a better understanding of DNA recognition complexity, the two proposals have been tested with several DNAs and the methods of mass spectrometry (MS), polyacrylamide gel electrophoresis (PAGE) and nuclear magnetic resonance spectroscopy in addition to ITC. All of the methods with all of the DNAs investigated clearly shows that netropsin forms two different complexes at AATT sites, and that the proposal for an induced hairpin to duplex transition in this system is incorrect.

The conformational substates BI and BII of the phosphodiester backbone in B-DNA are thought to contribute to DNA flexibility and protein recognition. We have studied by rapid scan FTIR spectroscopy the isothermal BI-BII transition on its intrinsic time scale. Correlation analysis of IR absorption changes occurring within seconds after a reversible incremental growth of the DNA hydration shell identifies water populations w1 (PO2--bound) and w2 (non-PO2--bound) exhibiting weaker and stronger H-bonds, respectively, than those dominating in bulk water. The BII substate is stabilized by w2. The water H-bond imbalance of 3-4 kJ mol-1 is equalized at little enthalpic cost upon formation of a contiguous water network (at 12-14 H2O molecules per DNA phosphate) of reduced n(OH) band width. In this state, hydration water cooperatively stabilizes the BI conformer via the entropically favored replacement of w2-DNA interactions by additional w2-water contacts, rather than binding to BI-specific hydration sites. Such water rearrangements contribute to the recognition of DNA by indolicidin, an antimicrobial 13-mer peptide from bovine neutrophils which, despite little intrinsic structure, preferentially binds to the BI conformer in a water-mediated induced fit. The FTIR spectra resolve sequential steps leading from PO2--solvation to substate transition and eventually to base stacking changes in the complex. In combination with CD-spectral titrations, the data indicate that in the absence of a bulk aqueous phase, as in molecular crowded environments, water relocation within the DNA hydration shell allows for entropic contributions similar to those assigned to water upon DNA ligand recognition in solution.

Binding of ligands to DNA gives rise to several relevant biological and biomedical effects. Here, through the use of atomic force microscopy (AFM), we studied the consequences of drug binding on the morphology of single DNA molecules. In particular, we quantitatively analyzed the effects of three different DNA-binding molecules (doxorubicin, ethidium bromide, and netropsin) that exert various pharmacologic and therapeutic effects. The results of this study show the consequences of intercalation and groove molecular binding on DNA conformation. These single-molecule measurements demonstrate morphological features that reflect the specific modes of drug-DNA interaction. This experimental approach may have implications in the design of therapeutically effective agents.

Herein, we study the nanomechanical characteristics of single DNA molecules in the presence of DNA binders, including intercalating agents (ethidium bromide and doxorubicin), a minor groove binder (netropsin) and a typical alkylating damaging agent (cisplatin). We have used magnetic tweezers manipulation techniques, which allow us to measure the contour and persistence lengths together with the bending and torsional properties of DNA. For each drug, the specific variations of the nanomechanical properties induced in the DNA have been compared. We observed that the presence of drugs causes a specific variation in the DNA extension, a shift in the natural twist and a modification of bending dependence on the imposed twist. By introducing a naive model, we have justified an anomalous correlation of torsion data observed in the presence of intercalators. Finally, a data analysis criterion for discriminating between different molecular interactions among DNA and drugs has been suggested.

DNA-binding small molecules are widespread in the cell and heavily used in biological applications. Here, we use magnetic tweezers, which control the force and torque applied to single DNAs, to study three small molecules: ethidium bromide (EtBr), a well-known intercalator; netropsin, a minor-groove binding anti-microbial drug; and topotecan, a clinically used anti-tumor drug. In the low-force limit in which biologically relevant torques can be accessed (

To determine what topological changes antiparasitic heterocyclic dications can have on kinetoplast DNA, we have constructed ligation ladders, with phased A5 and ATATA sequences in the same flanking sequence context, as models. Bending by the A5 tract is observed, as expected, while the ATATA sequence bends DNA very little. Complexes of these DNAs with three diamidines containing either furan, thiophene or selenophene groups flanked by phenylamidines were investigated along with netropsin. With the bent A5 ladder the compounds caused either a slight increase or decrease in the bending angle. Surprisingly, however, with ATATA all of the compounds caused significant bending, to values close to or even greater than the A5 bend angle. Results with a mixed cis sequence, which has one A5 and one ATATA, show that the compounds bend ATATA in the same direction as a reference A5 tract, that is, into the minor groove. These results are interpreted in terms of a groove structure for A5 which is largely pre-organized for a fit to the heterocyclic amidines. With ATATA the groove is intrinsically wider and must close to bind the compounds tightly. The conformational change at the binding site then leads to significant bending of the alternating DNA sequence.

To better understand the molecular basis for recognition of the DNA minor groove by heterocyclic cations, a series of "reversed amidine" substituted heterocycles has been prepared. Amidine derivatives for targeting the minor groove have the amidine carbon linked to a central heterocyclic system, whereas in the reverse orientation, an amidine nitrogen provides the link. The reverse system has a larger dihedral angle as well as a modified spatial relationship with the groove relative to amidines. Because of the large dihedral, the reversed amidines should have reduced binding to DNA relative to similar amidines. Such a reduction is observed in footprinting, circular dichroism (CD), biosensor-surface plasmon resonance (SPR), and isothermal titration calorimetric (ITC) experiments with DB613, which has a central phenyl-furan-phenyl heterocyclic system. The reduction is not seen when a pyrrole (DB884) is substituted for the furan. Analysis of a number of derivatives defines the pyrrole and a terminal phenyl substituent on the reversed amidine groups as critical components in the strong binding of DB884. ITC and SPR comparisons showed that the better binding of DB884 was due to a more favorable binding enthalpy and that it had exceptionally slow dissociation from DNA. Crystallographic analysis of DB884 bound to an AATT site shows that the compound was bound in the minor groove in a 1:1 complex as suggested by CD solution studies. Surprisingly, unlike the amidine derivative, the pyrrole -NH of DB884 formed an H-bond with a central T of the AATT site and this accounts for the enthalpy-driven strong binding. The structural results and molecular modeling studies provide an explanation for the differences in binding affinities for related amidine and reversed amidine analogues.

Isothermal titration calorimetry, ITC, has been used to determine the thermodynamics (DeltaG, DeltaH, and -TDeltaS) for binding netropsin to a number of DNA constructs. The DNA constructs included: six different 20-22mer hairpin forming sequences and an 8-mer DNA forming a duplex dimer. All DNA constructs had a single -AT-rich netropsin binding with one of the following sequences, (A(2)T(2))(2), (ATAT)(2), or (AAAA/TTTT). Binding energetics are less dependent on site sequence than on changes in the neighboring single stranded DNA (hairpin loop size and tail length). All of the 1:1 complexes exhibit an enthalpy change that is dependent on the fractional saturation of the binding site. Later binding ligands interact with a significantly more favorable enthalpy change (partial differential DeltaH(1-2) from 2 to 6 kcal/mol) and a significantly less favorable entropy change (partial differential (-TDeltaS(1-2))) from -4 to -9 kcal/mol). The ITC data could only be fit within expected experimental error by use of a thermodynamic model that includes two independent binding processes with a combined stoichiometry of 1 mol of ligand per 1 mol of oligonucleotide. Based on the biophysical evidence reported here, including theoretical calculations for the energetics of "trapping" or structuring of a single water molecule and molecular docking computations, it is proposed that there are two modes by which flexible ligands can bind in the minor groove of duplex DNA. The higher affinity binding mode is for netropsin to lay along the floor of the minor groove in a bent conformation and exclude all water from the groove. The slightly weaker binding mode is for the netropsin molecule to have a slightly more linear conformation and for the required curvature to be the result of a water molecule that bridges between the floor of the minor groove and two of the amidino nitrogens located at one end of the bound netropsin molecule.

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.

Binding of a small molecule to a macromolecular target reduces its conformational freedom, resulting in a negative entropy change that opposes the binding. The goal of this study is to estimate the configurational entropy change of two minor-groove-binding ligands, netropsin and distamycin, upon binding to the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). Configurational entropy upper bounds based on 10-ns molecular dynamics simulations of netropsin and distamycin in solution and in complex with DNA in solution were estimated using the covariance matrix of atom-positional fluctuations. The results suggest that netropsin and distamycin lose a significant amount of configurational entropy upon binding to the DNA minor groove. The estimated changes in configurational entropy for netropsin and distamycin are -127 J K(-1) mol(-1) and -104 J K(-1) mol(-1), respectively. Estimates of the configurational entropy contributions of parts of the ligands are presented, showing that the loss of configurational entropy is comparatively more pronounced for the flexible tails than for the relatively rigid central body.

We report the temperature and salt dependence of the volume change (DeltaVb) associated with the binding of ethidium bromide and netropsin with poly(dA).poly(dT) and poly[d(A-T)].poly[d(A-T)]. The DeltaV(b) of binding of ethidium with poly(dA).poly(dT) was much more negative at temperatures approximately 70 degrees C than at 25 degrees C, whereas the difference is much smaller in the case of binding with poly[d(A-T)].poly[d(A-T)]. We also determined the volume change of DNA-drug interaction by comparing the volume change of melting of DNA duplex and DNA-drug complex. The DNA-drug complexes display helix-coil transition temperatures (Tm several degrees above those of the unbound polymers, e.g., the Tm of the netropsin complex with poly(dA)poly(dT) is 106 degrees C. The results for the binding of ethidium with poly[d(A-T)].poly[d(A-T)] were accurately described by scaled particle theory. However, this analysis did not yield results consistent with our data for ethidium binding with poly(dA).poly(dT). We hypothesize that heat-induced changes in conformation and hydration of this polymer are responsible for this behavior. The volumetric properties of poly(dA).poly(dT) become similar to those of poly[d(A-T)].poly[d(A-T)] at higher temperatures.

Netropsin is a well-characterized DNA minor groove binding compound that serves as a model for the study of drug–DNA interactions. Our laboratory has developed a novel host–guest approach to study drug–DNA interactions in which the host, the Nterminal fragment of Moloney murine leukemia virus reverse transcriptase (MMLV RT) is co-crystallized with a DNA oligonucleotide guest in the presence and absence of drug. We have co-crystallized netropsin with the RT fragment bound to the symmetric 16mer d(CTTAATTCGAATTAAG)2 and determined the structure of the complex at 1.85 A u . In contrast to previously reported netropsin–DNA structures, our oligonucleotide contains two AATT sites that bind netropsin with flanking 5 0 and 3 0 sequences that are not symmetric. The asymmetric unit of the RT fragment–DNA–netropsin crystals contains one protein molecule and one-half of the 16mer with one netropsin molecule bound. The guanidinium moiety of netropsin binds in a narrow part of the minor groove, while the amidinium is bound in the widest region within the site. We compare this structure to other Class I netropsin–DNA structures and find that the asymmetry of minor groove widths in the AATT site contributes to the orientation of netropsin within the groove while hydrogen bonding patterns vary in the different structures.

Sugar-oligoamides have been designed and synthesized as structurally simple carbohydrate-based ligands to study carbohydrate-DNA interactions. The general design of the ligands 1-3 has been done as to favor the bound conformation of Distamycin-type gamma-linked covalent dimers which is a hairpin conformation. Indeed, NMR analysis of the sugar-oligoamides in the free state has indicated the presence of a percentage of a hairpin conformation in aqueous solution. The DNA binding activity of compounds 1-3 was confirmed by calf thymus DNA (ct-DNA) NMR titration. Interestingly, the binding of the different sugar-oligoamides seems to be modulated by the sugar configuration. Semiquantitative structural information about the DNA ligand complexes has been derived from NMR data. A competition experiment with Netropsin suggested that the sugar-oligoamide 3 bind to DNA in the minor groove. The NMR titrations of 1-3 with poly(dA-dT) and poly(dG-dC) suggested preferential binding to the ATAT sequence. TR-NOE NMR experiments for the sugar-oligoamide 3-ct-DNA complex both in D(2)O and H(2)O have confirmed the complex formation and given information on the conformation of the ligand in the bound state. The data confirmed that the sugar-oligoamide ligand is a hairpin in the bound state. Even more relevant to our goal, structural information on the conformation around the N-glycosidic linkage has been accessed. Thus, the sugar asymmetric centers pointing to the NH-amide and N-methyl rims of the molecule have been characterized.

Energetics of interactions occurring in the model ligand-DNA systems constituted from distamycin A (DST), netropsin (NET) and the oligomeric duplexes d(GCAAGTTGCGATATACG)d(CGTATATCGCAACTTGC)=D#1 and d(GCAAGTTGCGAAAAACG)d(CGTTTTTCGCAACTTGC)=D#2 was studied by spectropolarimetry, UV-absorption spectroscopy and isothermal titration calorimetry. Model analysis of the measured signals was applied to describe individual and competitive binding in terms of populations of various species in the solution. Our results reveal several unprecedented ligand-DNA binding features. DST binds to the neighboring 5'-AAGTT-3' and 5'-ATATA-3' sites of D#1 statistically in a 2:1 binding mode. By contrast, its association to D#2 appears to be a 2:1 binding event only at the DST/D#2 molar ratios between 0 and 2 while its further binding to D#2 may be considered as a step-by-step binding to the unoccupied 5'-AAAAA-3' sites resulting first in DST3D#2 and finally in DST4D#2 complex formation. Competition between DST and NET binding shows that for the most part DST displaces NET from its complexes with D#1 and D#2. In contrast to the obligatory 1:1 binding of DST to the ligand-free 5'-AAAAA-3' sites observed at DST/5'-AAAAA-3'

Isopropyl-thiazole ((iPr)Th) represents a new addition to the building blocks of nucleic acid minor groove-binding molecules. The DNA decamer duplex d(CGACTAGTCG)(2) is bound by a short lexitropsin of sequence formyl-PyPy(iPr)Th-Dp (where Py represents N-methyl pyrrole, (iPr)Th represents thiazole with an isopropyl group attached, and Dp represents dimethylaminopropyl). NMR data indicate ligand binding in the minor groove of DNA to the sequence 5'-ACT(5)AG(7)T-3' at a 2:1 ratio of ligand to DNA duplex. Ligand binding, assisted by the enhanced hydrophobicity of the (iPr)Th group, occurs in a head-to-tail fashion, the formyl headgroups being located toward the 5'-ends of the DNA sequence. Sequence reading is augmented through hydrogen bond formation between the exocyclic amine protons of G(7) and the (iPr)Th nitrogen, which lies on the minor groove floor. The B(I)/B(II) DNA backbone equilibrium is altered at the T(5) 3'-phosphate position to accommodate a B(II) configuration. The ligands bind in a staggered mode with respect to one another creating a six base pair DNA reading frame. The introduction of a new DNA sequence-reading element into the recognition jigsaw, combined with an extended reading frame for a small lexitropsin with enhanced hydrophobicity, holds great promise in the development of new, potentially commercially viable drug lead candidates for gene targeting.

Continuing our studies on combilexines, compounds consisting of a DNA intercalator linked to a minor groove ligand, new results are presented. The synthesis of a series of new propylamine oligopyrrole carboxamides closely related to netropsin and distamycin A, linked to a heterocyclic or anthraquinone system is reported. The cytotoxic activity in vitro, the DNA binding characteristics and the inhibition of the topoisomerase I of the compounds were studied in order to explain the biological mechanism of action of these new potential combilexines. Some of the synthesised compounds showed cytotoxic activity against human tumour cell lines, as well as DNA binding and topoisomerase I inhibiting properties.

International audience; Bis-netropsins (bis-Nts) are efficient catalytic inhibitors of human DNA topoisomerase I (top I). These DNA minor groove binders are considered to serve as suppressors of top I-linked DNA breaks, which is generally believed to be related to their affinity to DNA. In this study, it was found that bis-Nts exhibit sequence-specificity of suppression of the strong top I-specific DNA cleavage sites and that this sequence-specificity is determined by differential ligand-induced structural alterations of DNA. Raman scattering analysis of bis-Nts interactions with double-stranded oligonucleotides, each containing the site of specific affinity to one of bis-Nts and a distinctly located top I degenerate consensus, demonstrated that bis-Nts induce not only structural changes in duplex DNA at their loading position, but also conformational changes in a distant top I-specific DNA cleavage site. The ability to alter the DNA structure correlates with the anti-top I inhibitory activities of the ligands. In addition, DNA structural alterations induced by bis-Nts were shown to be responsible for modulation of the camptothecin (CPT)-mediated DNA cleavage by top I. This effect is expressed in the bis-Nts-induced enhancement of some of the CPT-dependent DNA cleavage sites as well as in the CPT-induced enhancement of some of the top I-specific DNA cleavage sites suppressed by bis-Nts in the absence of CPT.

The stability of complexes of NaDNA with bipyridyl- (ethylenediamine)platinum(II) (abbreviated [(bipy)Pt(en)](2+)) and with netropsin has been studied using two techniques: (i) ultraviolet (UV) melting experiments were done on NaDNA* [(bipy)Pt(en)](2+), showing that the [(bipy)Pt(en)](2+) ligand stabilizes the DNA double helix structure; and (ii) swelling measurements (via optical microscopy) as a function of relative humidity were done on wet-spun oriented films of NaDNA*[(bipy)Pt(en)](2+) and of NaDNA*netropsin. The swelling data shows that an irreversible transition of the films occurs at high relative humidity, first for the NaDNA*netropsin, then for pure NaDNA, and lastly for the NaDNA*[(bipy)Pt(en)](2+). These results are indicative that the [(bipy)Pt(en)](2+) complex stabilizes the intermolecular bonds which mediate the film swelling characteristics. A model is suggested for the binding of [(bipy)Pt(en)](2+) to DNA to explain why the swelling experiments show this ligand as increasing the intermolecular bond strength between the DNA double helices, while netropsin decreases this degree of stabilization.

The exact understanding of the interaction of minor groove binding drugs with DNA is of interest due to their importance as transcription controlling drugs. In this study we performed four molecular dynamics simulations, one of the uncomplexed d(CGCGAATTCGCG)2 dodecamer and three simulations of the DNA complexed with the minor groove binder netropsin. The charged guanidinium and amidinium ends of the small ligand were in one simulation formally uncharged, in the second one normally charged, and in the third simulation we doubled the charges of the two ends. So we are able to filter out the influence the charges exert on the DNA structure. The positive charges reduce the width of the minor groove showing that charges are able to modify the groove width by charge neutralization of the negative phosphate groups. The quality of the used force field was successfully tested by comparing the results of the uncomplexed dodecamer with already reported NMR and x-ray studies. Thus our simulations should be able to describe the minor groove width of DNA in a correct manner underlying the validity of the results. © 2002 Wiley Periodicals, Inc. Biopolymers 61: 276–286, 2002

Full details of the development of a simple, nondestructive, and high-throughput method for establishing DNA binding affinity and sequence selectivity are described. The method is based on the loss of fluorescence derived from the displacement of ethidium bromide or thiazole orange from the DNA of interest or, in selected instances, the change in intrinsic fluorescence of a DNA binding agent itself and is applicable for assessing relative or absolute DNA binding affinities. Enlisting a library of hairpin deoxyoligonucleotides containing all five base pair (512 hairpins) or four base pair (136 hairpins) sequences displayed in a 96-well format, a compound's rank order binding to all possible sequences is generated, resulting in a high-resolution definition of its sequence selectivity using this fluorescent intercalator displacement (FID) assay. As such, the technique complements the use of footprinting or affinity cleavage for the establishment of DNA binding selectivity and provides the information at a higher resolution. The merged bar graphs generated by this rank order binding provide a qualitative way to compare, or profile, DNA binding affinity and selectivity. The 96-well format assay (512 hairpins) can be conducted at a minimal cost (presently ca. $100 for hairpin deoxyoligonucleotides/assay with ethiduim bromide or less with thiazole orange), with a rapid readout using a fluorescent plate reader (15 min), and is adaptable to automation (Tecan Genesis Workstation 100 robotic system). Its use in generating a profile of DNA binding selectivity for several agents including distamycin A, netropsin, DAPI, Hoechst 33258, and berenil is described. Techniques for establishing binding constants from quantitative titrations are compared, and recommendations are made for use of a Scatchard or curve fitting analysis of the titration binding curves as a reliable means to quantitate the binding affinity.

S-shaped binding curves often characterize interactions of ligands with nucleic acid molecules as analyzed by different physico-chemical and biophysical techniques. S-shaped experimental binding curves are usually interpreted as indicative of the positive cooperative interactions between the bound ligand molecules. This paper demonstrates that S-shaped binding curves may occur as a result of the "mixed mode" of DNA binding by the same ligand molecule. Mixed mode of the ligand-DNA binding can occur, for example, due to 1) isomerization or dimerization of the ligands in solution or on the DNA lattice, 2) their ability to intercalate the DNA and to bind it within the minor groove in different orientations. DNA-ligand complexes are characterized by the length of the ligand binding site on the DNA lattice (so-called "multiple-contact" model). We show here that if two or more complexes with different lengths of the ligand binding sites could be produced by the same ligand, the dependence of the concentration of the complex with the shorter length of binding site on the total concentration of ligand should be S-shaped. Our theoretical model is confirmed by comparison of the calculated and experimental CD binding curves for bis-netropsin binding to poly(dA-dT) poly(dA-dT). Bis-netropsin forms two types of DNA complexes due to its ability to interact with the DNA as monomers and trimers. Experimental S-shaped bis-netropsin-DNA binding curve is shown to be in good correlation with those calculated on the basis of our theoretical model. The present work provides new insight into the analysis of ligand-DNA binding curves.

Imidazole and compounds containing imidazole residues have been shown to cleave RNA in an RNase A-mimicking manner. Di-imidazole lexitropsin is a compound which is derived from the polyamide drugs distamycin and netropsin essentially by the replacement of two pyrrole heterocycles with N-methyl-imidazole residues. This enables it to bind to the minor groove of B-DNA in a sequence-specific manner. We demonstrate here that this lexitropsin derivative has RNA cleavage activity, as tested on model RNAs. Optimal cleavage conditions and cleavage specificity resemble those known from other imidazole conjugates and are thus consistent with an RNase A type cleavage mechanism. The optimum concentration of the compound for cleavage is similar to previously investigated imidazole-based RNase mimics. As a whole new class of chemical compounds capable of interacting with nucleic acids through extensive hydrogen bonding, these imidazole containing compounds constitute promising scaffolds and ligands, for the construction of novel RNase mimics with high affinity.

The Human Genome Project as well as sequencing of the genomes of other organisms offers a wealth of DNA targets for both therapeutic and diagnostic applications, and it is important to develop additional DNA binding motifs to fully exploit the potential of this new information. We have recently found that an aromatic dication, DB293, with an amidine-phenyl-furan-benzimidazole-amidine structure can recognize specific sequences of DNA by binding in the minor groove as a dimer [Wang, L., Bailly, C., Kumar, A., Ding, D., Bajic, M., Boykin, D. W., and Wilson, W. D. (2000) Proc. Natl. Acad. Sci. U.S.A. 97, 12-16]. The dimer binding is strong, highly cooperative and, in contrast to many closely related heterocyclic dications, has both GC and AT base pairs in the minor groove binding site. The aromatic heterocycle stacked dimer is quite different in structure from the polyamide-lexitropsin type compounds, and it is a dication while all lexitropsin dimers are monocations. The heterocyclic dimer represents only the second small molecule class that can recognize mixed sequences of DNA. To test the structural limits on the new type of complex, it is important to probe the influence of compound charge, chemical groups, and structural features. The effects of these compound molecular variations on DNA complex formation with several DNA sequences were evaluated by DNase I footprinting, CD and UV spectroscopy, thermal melting, and quantitative analysis with surface plasmon resonance biosensor methods. Conversion of the amidines to guanidinium groups does permit the cooperative dimer to form but removal of one amidine or addition of an alkyl group to the amidine strongly inhibited dimer formation. Changing the phenyl of DB293 to a benzimidazole or the benzimidazole to a phenyl or benzofuran also inhibited dimer formation. The results show that formation of the minor groove stacked-dimer complex is very sensitive to compound structure. The discovery of the aromatic dimer mode offers new opportunities to enhance the specificity and expand the range of applications of the compounds that target DNA.

Circular dichroism (CD), isothermal calorimetric titrations (ITC), and temperature-dependent UV spectroscopy were used to investigate binding of the minor groove-directed ligands distamycin A (Dst) and netropsin (Net) to the following duplexes: d(GTTAGTATTTGG). d(CCAAATACTAAC), d(GTTAGTATATGG).d(CCATATACTAAC), d(GTTAGTACTTGG). d(CCAAGTACTAAC), and d(GTTAGTAGTTGG).d(CCAACTACTAAC). Our results reveal that Dst binds within the minor grooves of these dodecamers that contain five-AT and/or four-AT.GC binding sites exclusively in a dimeric high-affinity 2:1 binding mode (K approximately 10(16) M(-)(2)). By contrast, Net exhibits high-affinity binding only when it binds in a 1:1 mode (K(1) approximately 10(9) M(-)(1)) to the two duplexes that contain five-AT sites (5'-TATTT-3' and 5'-TATAT-3'). Its further binding to these two duplexes occurs in a low-affinity mode (K(2) approximately 10(6) M(-)(1)) and results in the formation of 2:1 Net-DNA complexes. To the other two duplexes that contain sequences with at most three AT consecutive base pairs Net binds in two distinctive low-affinity 1:1 binding modes (K(1) approximately 10(7) M(-)(1), K(2) approximately 10(6) M(-)(1)). Competition experiments (CD and ITC titrations) reveal that Dst entirely displaces Net from its 1:1 and 2:1 complexes with any of the four duplexes. We discuss and interpret our optical and calorimetric results in the context of the available structural information about the complexes between DNA and the sequence-specific minor groove binders Dst and Net.

▪ Abstract In the past decade, a general design for sequence-specific minor groove ligands has evolved, based on the natural products distamycin and netropsin. By utilizing a basic set of design rules for connecting pyrrole, imidazole, and hydroxypyrrole modules, new ligands can be prepared to target almost any sequence of interest with both high affinity and specificity. In this review we present the design rules with a brief history of how they evolved. The structural basis for sequence-specific recognition is explained, together with developments that allow linking of recognition modules that enable targeting of long DNA sequences. Examples of the affinity and specificity that can be achieved with a number of variations on the basic design are given. Recently these molecules have been used to compete with proteins both in vitro and in vivo, and a brief description of the experimental results are given.

Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo . To address this issue, we report here 23 Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B -DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B -DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA.