Search

We aimed to determine gene expression patterns in the anterior pituitary (AP) of heifers before and after ovulation via deep sequencing of the transcriptome (RNA-seq) to identify new genes and clarify important pathways. Heifers were slaughtered on the estrus day (pre-ovulation; n=5) or 3 days after ovulation (post-ovulation; n=5) for AP collection. We randomly selected 4 pre-ovulation and 4 post-ovulation APs, and the ribosomal RNA-depleted poly (A)+RNA were prepared to assemble next-generation sequencing libraries. The bovine APs expressed 12,769 annotated genes at pre- or post-ovulation. The sum of the reads per kilobase of exon model per million mapped reads (RPKM) values of all transcriptomes were 599,676 ± 38,913 and 668,209 ± 23,690, and 32.2 ± 2.6% and 44.0 ± 4.4% of these corresponded to the AP hormones in the APs of pre- and post-ovulation heifers, respectively. The bovine AP showed differential expression of 396 genes (P

As has been shown previously, fibroblast growth factor 2 (FGF2), leukaemia inhibitory factor (LIF), and insulin-like growth factor 1 (IGF1) in combination play a positive role in maintaining the quality of mammalian oocytes maturing invitro. In the present work, we studied the effects of these cytokines in optimal concentrations when added in combination to IVM medium on the nuclear status and development competence of bovine oocytes. Slaughterhouse-derived cumulus–oocyte complexes (COC) (n = 1107 COC) were cultured for 22 h in either IVM medium [TCM-199 supplemented with 10% fetal calf serum (FCS), 0.2 mM sodium pyruvate, 10 μg mL−1 porcine FSH, and 10 μg mL−1 ovine LH] (Control) or the same IVM medium supplemented with FGF2, LIF, and IGF1. The eight combinations of cytokines tested during maturation were (1) 20 ng mL−1 LIF/10 ng mL−1 IGF1/10 ng mL−1 FGF2 (Group 1); (2) 20 ng mL−1 LIF/10 ng mL−1 IGF1/40 ng mL−1 FGF2 (Group 2); (3) 20 ng mL−1 LIF/20 ng mL−1 IGF1/10 ng mL−1 FGF2 (Group 3); (4) 20 ng mL−1 LIF/20 ng mL−1 IGF1/40 ng mL−1 FGF2 (Group 4); (5) 5 ng mL−1 LIF/10 ng mL−1 IGF1/10 ng mL−1 FGF2 (Group 5); (6) 5 ng mL−1 LIF/10 ng mL−1 IGF1/40 ng mL−1 FGF2 (Group 6); (7) 5 ng mL−1 LIF/20 ng mL−1 IGF1/10 ng mL−1 FGF2 (Group 7); and (8) 5 ng mL−1 LIF/20 ng mL− 1 IGF1/40 ng mL−1 FGF2 (Group 8). After IVM, matured and denuded oocytes were activated by culturing in 5 μM ionomycin solution for 5 min followed by 4 h in 2 mM 4-dimethylaminopyridine (DMAP) and 10 mg mL−1 cyclohexamide. Activated oocytes were cultured in CR1aa medium until Day 5 and then transferred to the same medium supplemented with 5% FCS and cultured until Day 7. All cultures were performed at 38.5°C and 5% CO2 in humidified air. At Days 2 and 7 after activation, the cleavage and blastocyst rates were determined. The data from 6 to 7 replicates (122–181 oocytes per treatment) were analysed by ANOVA. The rate of MII oocytes, assessed by the presence of the first polar body, did not differ between the groups and reached 67.1 to 84.5%. Cleavage rate was higher (84.5 ± 2.9%, P

Recovery of oocytes from live animals through ultrasound-guided transvaginal follicular aspiration (ovum pickup, OPU) is an essential element of modern livestock development. To increase the number of OPU oocytes retrieved, hormonal stimulation is broadly applied; however, the results are ambiguous. The aim of the present study was to compare recovery rate, quality of oocytes, and efficiency of invitro production of cattle embryos using OPU oocytes derived from hormonal treated and untreated cows. The study was performed in Simmental heifers at the age of 17 to 23 months. The heifers in the first group (n=7) were previously synchronized using prostaglandin F2α (Estrumate, MSD Animal Health) and gonadotrophin-releasing hormone (GnRH; Receptal, MSD Animal Health) and then underwent superstimulation with Stimofol (Reprobiol SPRL, Belgium) in a total amount of 0.25mg of FSH and 0.05mg of LH in a treatment of 6 injections on 3 consecutive days starting on Day −4 before OPU. The heifers of the second group (n=2) underwent OPU once a week for 5 weeks (10 OPU sessions). Groups of recovered cumulus–oocyte complexes (COCs) were matured in TCM-199 containing 10% fetal calf serum, 1mM Na-pyruvate, 50μg mL−1 gentamycin, 10μg mL−1 FSH, and 10μg mL−1 LH for 24h, fertilized in Fert-TALP (Tyrode’s-albumin-lactate-pyruvate) for 18 to 20h, and cultured in CR1aa medium for 7 days. All steps of IVP were performed at 38.5°C with 5% CO2 and 90% humidity. The cleavage and blastocysts rates were assessed on Day 2 and 7, respectively. In addition, Day-7 blastocysts were fixed, and the total cell number was determined using 4′,6-diamidino-2-phenylindole (DAPI) staining. The data were analysed by ANOVA using SigmaStat software package. As expected, the number of aspirated follicles per session in the first group of cows was higher than that in the second group: 14.6±1.2 vs. 6.8±0.5 (P

Melatonin, the antioxidant pineal hormone, is a strong regulator for various cellular processes essential for reproduction. Although the protective role of 0.1µM melatonin against the toxicity of different anti-developmental compounds has been elucidated in numerous studies, its effect on the autophagy level in invitro-produced blastocysts has not been entirely clarified. In this study, oocytes were incubated for 24h in the presence and absence of melatonin, administered during IVM, to investigate the effect of 0.1µM melatonin on the developmental competence of bovine oocytes and pre-implantation embryos, autophagy, and quality of embryos. The developmental potential of embryos were basically the stages from oocytes fertilization to blastocyst production. Gene expression levels were evaluated in matured oocytes, whereas blastocysts were used for immunofluorescence experiments. The differences between treated and control groups were analysed using Student’s t-test (GraphPad Prism version 6; GraphPad Inc.), where P-values 0.05), whereas the level of reactive oxygen species (ROS) was reduced (P0.05) were overexpressed, in Day-8 embryos of melatonin-treatment. Additionally, the total number of cells per blastocysts, inspected via nuclei-based 4′,6-diamidino-2-phenylindole (DAPI) staining was higher in the melatonin-treated group (P

Production of invivo embryos for transfer in dromedary camel is a well-established practice, whereas freezing of these embryos is still an ongoing challenge. A common approach in evaluation of freeze–thawing method is achieved by studying invitro development of frozen–thawed embryos. However, not much is known about the development pattern of fresh dromedary embryos during incubation. The objectives of this study were to evaluate the usefulness of commercial holding media for easy short-term culture of these embryos and to provide preliminary insights on the growth and development of hatched blastocysts with different shapes. Recovered hatched blastocysts from superovulated donors were graded as transferable and non-transferable. Embryos with significant folding or crinkliness were further categorized as collapsed, whereas those with a round or oval appearance were categorized as spherical. Culture was performed in 500-μL drops at 38.5°C, 5% O2, 0–6% CO2, and maximum humidity in groups of 2 to 4. The 4 experimental media included culture medium (CM; TCM-199, 10% fetal calf serum (FCS), 0.3mM sodium pyruvate, 2.2mg mL−1 sodium bicarbonate), serum-supplemented holding medium (SSH; Syngro+10% FCS), serum-free holding medium (Syngro) and V-Onestep (Vitromed). In experiment 1, a total of 36 embryos were assigned to 4 groups and further development of the embryos was monitored up to 96h by morphological evaluations, identifying static and degenerating embryos on daily basis. In experiment 2, a total of 16 spherical and 16 collapsed embryos were cultured in SSH and CM and two-thirds of the culture drop was replaced with fresh medium at 72h. The proportion of developing embryos and their size expansion was compared between treatments by Fisher’s test and Mann–Whitney U test, respectively. Statistically similar proportions of embryos continued to develop in all media within the first 48h despite a numeric advantage in CM group; at 72h, the proportion of growing embryos was significantly higher in CM (77.8%) and SSH (66.6%) compared with SFH (11.1%) and OneStep (22.2%) (P0.05). Replacing the medium did not favour continuation of embryonic growth in SSH beyond 72 h; only 5/16 embryos survived to 96h compared with 12/16 in CM. In conclusion, serum-supplemented commercial holding preparations provide comparable results to culture medium for short-term incubation of invivo dromedary embryos. Natural collapsing of hatched blastocysts might be associated with lower developmental competence.

The objective of this study was to evaluate the embryonic development of alpaca oocytes collected by ovum pickup from superstimulated females (OPU, Group 1) and from slaughterhouse ovaries of 8 non-superstimulated females (SHO, Group 2) using a conventional aspiration technique (20 G needle and a 3-mL syringe). A total of 8 nonpregnant alpacas, 3 to 4 years old, were superstimulated with a single dose of 200 IU of equine chorionic gonadotrophin (eCG, Day = 0). Three days later, alpacas were examined by transrectal ultrasonography with a 7.5-MHz linear-array transducer to determine the number and diameter of follicles available for aspiration. A total of 101 follicles were aspirated, recovering 67 oocytes (66.3%) by OPU using an endocavity transducer attached to a 21 G needle adapted for alpacas. The follicular fluid was aspirated using a regulated vacuum pump (40 mmHg) into a tube containing 5 mL of phosphate-buffered saline (PBS), 0.2% bovine serum albumin (BSA), and 10 IU mL−1 heparin, at 37°C. In the SHO group we used 16 ovaries maintained at 28°C. The recovery of oocytes was carried out within 3 h of ovary collection. We aspirated 155 follicles from SHO and recovered 117 oocytes (75.5%). After collection, all oocytes recovered were morphologically classified into categories (I and II) and cultured for 26 h in an incubator (5% CO2 in air at 38.5°C), in TCM-199 supplemented with 0.2 mmol sodium pyruvate, 50 µg mL−1 gentamicin sulphate, 0.02 IU mL−1 FSH, 1 µg mL−1 oestradiol 17β, and 10% fetal calf serum (FCS). After maturation, oocytes were invitro fertilized with epididymal spermatozoa recovered from postmortem males and co-cultured for 18 to 20 h. After this period, all cleaved oocytes were incubated (5% CO2 in air, 38.5°C) for 6 days in synthetic oviductal fluid-serum medium. Number and morphological quality of oocytes collected, invitro cleaved, and embryos ratea were registered and compared between groups. Statistical significance was determined using Kruskal–Wallis test. The mean and standard error were calculated from average of the percentages obtained in each repetition. Results indicated that the mean number of oocytes collected per ovary was higher (P

The objective of the present study was to evaluate the effect of length of the FSH superstimulatory treatment on ovarian response and embryo production in sheep. Poll Dorset ewes (n = 63) 3.2 ± 0.2 years old weighing 58.5 ± 1.5 kg and with a body condition score of 2.7 ± 0.1 (0 = emaciated; 5 = obese) were used during the transition from the breeding to the non-breeding season. All ewes received an ovarian superstimulatory treatment during the first follicular wave (Day 0 protocol). On Day −9 all ewes received a 0.3-g progesterone intravaginal device (CIDR, Zoetis) for 6 days. On Day −3, the CIDR was removed and all ewes were administered 125 μg of cloprostenol sodium intramuscularly (IM) (PGF, estroPLAN, Parnell) and 200 IU of equine chorionic gonadotrophin (eCG) + 100 IU of human chorionic gonadotrophin (hCG) IM (P.G. 600, Merck). Thirty-six hours after CIDR removal (Day −1.5) ewes were administered 100 μg of gonadorelin acetate IM (gonadotrophin-releasing hormone, GnRH; Gonabreed, Parnell). Superstimulatory treatments were initiated on Day 0 (84 h after CIDR removal) with a total of 240 mg of NIH-FSH-P1 (12 mL, Folltropin, Vetoquinol), and a new CIDR was used from the first to the last FSH dose (6-dose = 3 days; 8-dose = 4 days). Ewes were randomised to receive the total dose of FSH distributed in eight decreasing doses (8-dose group, n = 33) or six decreasing doses (6-dose group, n = 30) twice daily 12 h apart. Two doses of PGF were administered with the last two doses of FSH, and GnRH was administered 12 h after the last FSH administration. Intrauterine AI with fresh semen was performed by laparoscopy 16 h after GnRH administration. Ovarian response was determined by laparoscopy 6 days after AI and ova/embryos were collected surgically in ewes with >2 corpora lutea (CL). Data were analysed using generalized linear mixed models (SAS 9.4; SAS Institute Inc.) and presented as mean ± s.e.m. in Table 1. The percentage of responding donors (>2 CL) was 93.3% (28/30) and 78.8% (26/33; P = 0.5) for the 6-dose and 8-dose groups, respectively. The number of CL tended (P = 0.06) to be lesser in ewes in the 6-dose than the 8-dose group. However, no differences (P > 0.10) were found in total ova/embryo, fertilized ova, transferable embryos, or freezable embryos. In conclusion, despite a tendency for a greater ovarian response in ewes treated with 8 doses of FSH, embryo yield did not appear to differ after either 6 or 8 doses of FSH administered during the first follicular wave in sheep. Table 1. Ovulatory response and embryo production in responding ewes (>2 corpora lutea) superstimulated with either 6 or 8 doses of FSH during the first follicular wave Outcome Treatment P-value 6-dose 8-dose Number of ewes 28 26 Corpora lutea (n) 14.2 ± 1.7 20.3 ± 2.8 0.06 Total ova/embryos (n) 9.0 ± 1.3 10.9 ± 1.8 0.38 Fertilized ova (n) 8.1 ± 1.4 10.2 ± 1.9 0.34 Fertilized ova (% per ewe) 89.0 ± 5.0 81.7 ± 7.0 0.40 Degenerate embryos 1.3 ± 0.4 2.0 ± 0.8 0.89 Transferable embryos (Grade 1–3) 6.8 ± 1.2 8.2 ± 1.8 0.52 Transferable embryos (% per ewe) 85.7 ± 4.4 75.4 ± 8.4 0.46 Freezable embryos (Grade 1–2) 6.6 ± 1.1 8.2 ± 1.8 0.43 Freezable embryos (% per ewe) 80.5 ± 5.6 75.4 ± 8.4 0.61

Oviducal fluid (OF) and uterine fluid (UF) improve the quality of embryos during invitro culture, and their extracellular vesicles (EV) may be involved in such an effect. We aimed to evaluate the effect of EV from OF and UF in sequential invitro culture on the development and quality of bovine embryos. Zygotes were cultured in synthetic oviduct fluid supplemented either with 3mg mL−1 BSA (n=1584) or 5% EV-depleted fetal calf serum (dFCS, n=1594) in absence or presence (BSAEV, n=1853 and dFCSEV, n=1473) of 3×105 EV mL−1 from OF (Day 1 to Day 4) and UF (Day 5 to Day 8), mimicking invivo conditions. EV from oviducts (early luteal phase) and uterine horns (mid luteal phase) from slaughtered heifers were isolated by size exclusion chromatography; size and concentration were assessed by nanotracking analysis (NTA) and morphology by transmission electron microscopy (TEM). Blastocyst rate was recorded on Days 7–8 and their quality was assessed for mitochondrial activity by staining with Mitotracker Deep Red (ThermoFisher Scientific), survival rate after vitrification/warming by invitro culture for up to 72h, and relative mRNA abundance of lipid metabolism-related transcripts by quantitative PCR. Housekeeping genes were H2AFZ and ACTB. Data were analysed by one-way ANOVA and Tukey test. TEM confirmed the presence and morphology of EVs, and NTA indicated mode size and concentration of particles (137.2 and 151.2 nm; 2.97×1010 and 7.98×1010 particles mL−1, for OF and UF, respectively). Blastocyst yield was lower (P

The aim was to evaluate 4 co-culture systems and 4 culture medium types to produce alpaca embryos by IVF. Gametes were obtained from ovaries and testes collected from a slaughterhouse. Oocytes were recovered by follicle aspiration using a 5-mL syringe. Oocytes with at least 3 layers of cumulus cells and a homogeneous cytoplasm were matured for 26 h in an incubator (5% CO2 in air at 38.5°C), in TCM-199 supplemented with 10% fetal calf serum (FCS), 0.02 IU mL−1 FSH, 1 µg mL−1 oestradiol 17β, 0.2 mM sodium pyruvate, and 50 µg mL−1 gentamicin sulphate. After maturation, oocytes were placed in FERT-TALP (fertilization- Tyrode’s medium with albumin, lactate, and pyruvate) solution for 30 min before IVF with epididymal sperm. Motile sperm were selected by swim-up method. Oocytes were co-cultured with 3 × 106 spermatozoa mL−1 for 18 to 20 h under the same atmospheric conditions mentioned above. In Experiment 1, we evaluated 4 co-culture systems: ear fibroblasts (T1, n = 224), fetal fibroblasts (T2, n = 154), granulosa cells (T3, n = 225), oviduct cells (T4, n = 169) and synthetic oviductal fluid (SOF) invitro culture (IVC) (T5, n = 116). As culture base, we used 0.5 mL of SOF IVC medium supplemented with 10% FCS in all treatments. In Experiment 2, we evaluated 4 culture media: TCM-199 + 10% FCS (T1, n = 137), CR1aa + 3 mg of bovine serum albumin (BSA) mL−1 (T2, n = 85), KSOM medium + 3 mg of BSA mL−1 (T3, n = 110), and SOF IVC + 10% FCS (T4, n = 66). The volume of culture medium used was 0.5 mL in 4-well Nunc plates for each treatment. The time (8 days) and culture (38.5°C, 5% CO2 in air and high humidity) conditions, and change of medium (each 24 h) were the same in both experiments. Statistical significance was determined using ANOVA. The mean and s.d. were calculated from the average of the percentages obtained in each repetition. In experiment 1, the cleavage rates were higher (P

During invitro maturation (IVM), bovine oocytes undergo important metabolic, epigenetic, and transcriptional changes for the acquisition of developmental competence. Particularly, metabolic changes that alter the availability of cytoplasmic acetyl-CoA, the main substrate for histones acetylation, may alter the epigenetic profile of the oocyte, with consequences for correct molecular maturation. To test this hypothesis, cumulus–oocyte complexes (COCs) were IVM in three experimental groups: Control [IVM medium (TCM-199-Bicarbonate, 10% fetal bovine serum, 1 µg mL−1 oestradiol, 10 µg mL−1 FSH, and 10 µg mL−1 human chorionic gonadotrophin)], DCA (IVM medium supplemented with 1.5 mM sodium dichloroacetate, a pyruvate to acetyl-CoA conversion stimulator) and IA (IVM medium supplemented with 5 µM sodium iodoacetate, a glycolysis inhibitor). Cumulus cells (CC) and oocytes (Oo) were analysed separately at 24 h (mitochondrial activity, MA; MitoTracker Red CMXRos, ThermoFisher Scientific] and at 0, 4, 8, 16, and 24 h of IVM [lysine 9 histone 3 acetylation (H3K9ac immunofluorescence) and new transcript synthesis (only CC; Click-iT® RNA, ThermoFisher Scientific). The images were acquired using a fluorescence microscope and analysed by Image J software. The results from at least 3 replicates were compared by Student’s t-test (treatment vs. control) or by ANOVA followed by Tukey’s test (comparison within the same group in different time points) considering P

Heat stress (HS) is characterised by an elevation in body temperature that ultimately undermines organism physiology. Most livestock production occurs in tropical regions under potential HS conditions that diminish productive and reproductive potential. Despite extensive evidence of HS-mediated effects in cell function, stage-specific detrimental effects of HS during oogenesis remain elusive. Mouse models represent an attractive alternative for faster interrogation of stage-specific phenomena during oogenesis. Therefore, the aim of the study was to determine the effects of HS exposure during the major window of female mice germ-cell DNA methylation programming. CD1/Swiss female mice with litters (F0 progeny) at postnatal Day 10 (P10) were randomly allocated to HS (35°C/12-h light; 21°C/12-h dark) or control (CTL: 21°C/24 h) for 11 days. The F0 progeny were weaned at P21 and superovulated after reaching puberty at P35. F0 females were superovulated by intraperitoneal injections with 5.0 IU of equine chorionic gonadotrophin (PMSG) followed by 5.0 IU of human chorionic gonadotrophin (hCG) within a 48-h interval. Pre-implantation embryos were harvested at Day E3.5 in M2 medium under a stereomicroscope. One F0 female per litter was randomly mated to control mice when it reached 6 weeks of age. Data were subjected to least-squares analysis of variance using the General Linear Models procedure of SAS (SAS Institute Inc.). The experiment was replicated twice (CTL: n = 4 F0 females and HS: n = 4 F0 females). Preliminary results are given as LSM ± s.e.m. There was no effect of heat stress on the number of embryos collected per female (CTL: 9.75 ± 4.87 vs. HS: 11.25 ± 4.81) or the percentage of non-viable embryos (CTL: 25.0 ± 0.23% vs. HS: 42.5 ± 0.25%). However, heat stress tended (P = 0.07) to reduce the percentage of embryos that reached the morula stage from 63.5 ± 0.08% for CTL to 35.1 ± 0.09% for HS. The percentage of blastocysts collected (CTL: 11.45 ± 0.18% vs. HS: 22.32 ± 0.19%) and litter size of F0 females (CTL: 7.47 ± 1.76 vs. HS: 7.66 ± 1.47) was not affected by treatment. In conclusion, exposure of female mice to 11-day HS during the major wave of de novo DNA methylation during oocyte growth tended to reduce subsequent pre-implantation embryonic development, although it did not affect full-term development after natural mating.

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24 h of IVM (V24), vitrification at 44 h of IVM (V44), and a control group consisting of fresh oocytes after 48 h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24 h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48 h of maturation (24 h for V24 and 4 h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n = 26, V44 n = 27, V24 n = 28) were frozen in 50 µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n = 32, V44 n = 30, V24 n = 32) were snap-frozen in ∼1 µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69 ± 19 207.23, V44 170 483.67 ± 18 127.18, V24 176 767.50 ± 27 211.09; P = 0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36 ± 4.99, V44 20.26 ± 6.61, V24 16.54 ± 8.07; P

Trophectoderm (TE) biopsying for single nucleotide polymorphisms (SNPs) analysis is being implemented as a tool for the selection of elite bovine embryos. This biopsy method renders ample cells for analysis without compromising the inner cell mass (ICM), and the blastocyst recovers quickly after biopsy. To use the SNP data for embryo selection before the transfer, the blastocysts need to be cryopreserved either with vitrification or slow-freezing. In intact invitro-produced (IVP) blastocysts, vitrification has already proven optimal regarding embryo survival and pregnancy rates. This study aimed to investigate which cryopreservation approach is superior regarding blastocyst re-expansion rate as well as ICM, TE, and dead cell numbers after biopsying bovine IVP blastocysts. All IVP media and vitrification kits were from IVF Bioscience, and ethylene glycol with sucrose was from EggTech. Oocytes from slaughterhouse ovaries were used for blastocyst IVP. At Day 7, the blastocysts were pooled and randomised into 3 groups: (1) biopsy-control (BC), (2) biopsy-vitrification (BV), (3) biopsy-slow freeze (BSF). Subsequently, 5 to 10 TE cells were biopsied in BO-transfer medium using a 25-µm (inner diameter) biopsy pipette and flicking against the holding pipette. The BC group was incubated at 6% CO2 and 38.8°C for 5h. After scoring the re-expansion rate, the blastocysts were fixed with 4% paraformaldehyde/sucrose for further analyses. The BV and BSF groups were subjected to cryopreservation/thawing protocols according to the manufacturers’ instructions. Both groups, recovered under the same culture conditions as BC, were subsequently scored for re-expansion rate and finally fixed. For cell counting, the embryos were stained with Hoechst (DNA) and CDX2 (TE), combined with the TUNEL staining. ImageJ software (National Institutes for Health) was used for cell counting. P0.05). The average cell counts for TE cells in BV and BSF were 59±6 and 47±10, respectively, and neither was statistically different from BC (56±8; P>0.05). The average numbers of dead cells in BV and BSF were 8±3 and 9±2, respectively, and neither was statistically different from BC (10±4; P>0.05). In summary, the biopsied bovine IVP blastocysts recovered better after vitrification, and neither of cryopreservation methods had any effect on the numbers of ICM, TE, or dead cells. This project was supported by Innovation Fund Denmark and the Danish Milk Levy Foundation.

Invitro-produced (IVP) porcine embryos are developmentally delayed compared with those derived invivo. Thus, efforts have been made to modify the current medium for IVP of porcine embryos in an attempt to shift the abundance of target transcripts towards the invivo level. The objective of the current study was to identify differences in mRNA abundance that may account for reduced developmental competence in IVP embryos and to determine whether alterations to maturation and culture media directed the transcriptional profiles of IVP embryos towards an invivo state. Following AI of gilts, an oviduct and tip of the uterine horn were flushed on Day 2 to recover 4-cell stage embryos; these were cultured for 4 days in MU3, generating IVM and invitro-cultured (IVC) blastocyst-stage embryos. On Day 6, the gilts were killed, and the contralateral horns were flushed to obtain invivo-derived (IVV) blastocyst-stage embryos. The third group of blastocyst-stage embryos, referred to as invitro-matured and cultured (IVMC), were created by aspirating cumulus–oocyte complexes from slaughterhouse-derived ovaries, maturing and fertilizing invitro, and culturing for 6 days in MU3. Total RNA was extracted from pools of 10 blastocyst-stage embryos with 3 replicates per group. First- and second-strand cDNA was synthesised and sequenced by using the Illumina platform (Illumina Inc.). After removal of adapters and reads that mapped to porcine rRNA genes and the PhiX genome, reads were mapped to the Sus scrofa genome by using STAR (version 2.7.1a) with default options. Pairwise comparisons were performed to test for differential expression of genes by using the Bioconductor package DESEqn 2. Transcripts were differentially abundant (false discovery rate

Domestic cat invitro embryo production (IVEP) begins with IVM of oocytes to produce mature oocytes; that is, MII. The domestic cat (Felis catus) has been used as a model to carry out assisted reproductive technology (ART) research for application in wild feline species that may be threatened or endangered. The objective of this research was to evaluate oocyte maturation of domestic cats in different reproductive stages: (1) prepubertal, (2) oestrus, (3) pregnant, and (4) anoestrus. The present study was carried out at the Universidad Autónoma Metropolitana Unidad Xochimilco in Mexico City. Unless otherwise stated, all reagents used were from Sigma-Aldrich. The domestic cat ovaries were obtained from a veterinary clinic using salpingo-oophorectomy hysterectomy (OSH). Ovaries were classified as one of the following: (1) prepubertal (female cats under 6 months of age); (2) in oestrus (one or more 2-mm mature follicles); (3) pregnant (presence of fetuses with one or more corpora lutea; and (4) anoestric (ovaries without follicular activity). The ovaries were transported (0.05). This study shows that the domestic cat reproductive stage does not significantly affect the production of mature oocytes for use in ART.

Cryosurvival of invitro-produced bovine embryos is lower than that of invivo-produced embryos, limiting their usability in the field. Previous work showed that the embryo’s lipid composition relates to its quality and cryosurvival. The present study aimed to investigate the effects of free fatty acid (FA) additions to embryo culture media during the oviduct phase of embryonic development on the improvement of cryosurvival of invitro-produced blastocysts. Bovine cumulus–oocyte complexes (n=1675, 3 replicates) were harvested from slaughterhouse ovaries, invitro matured (23h), and subsequently fertilized (18–20h). Embryos were cultured until Day 5 post-fertilization in synthetic oviductal fluid (SOF) with (1) bovine serum albumin (BSA; control, n=253); (2) delipidified BSA (>96% FA free, n=460); (3), delipidified BSA complexed with 25µM unsaturated oleic acid (C18:1, n=455); or (4) with saturated stearic acid (C18:0, n=507) with a stoichiometry of 5:1. At Day 5, SOF was refreshed and embryos were cultured without supplementation. At Days 7 and 8, blastocyst rates were determined. Blastocysts were LD540 stained for lipid droplets (LD), and the LD number and size were analysed by ANOVA. Cryosurvival%, defined by re-expansion of the blastocoel, was analysed by logistic regression. Additionally, fresh and frozen–thawed blastocysts were stained for apoptosis (terminal deoxynucleotidyl transferase dUTP nick-end labelling, TUNEL), necrosis (EthD-1), and DNA (Hoechst 33342) and analysed using negative binomial regression. Group differences were tested using a post hoc Tukey test. Statistical analysis was performed in R Studio (version 3.4.2), and P-values

Currently, invitro embryo production (IVP) is successfully applied commercially in cattle. However, the high sensitivity of embryos to cryopreservation compared with invivo-derived (IVD) embryos still impairs the dissemination of this biotechnology. Reduced cryotolerance is frequently associated with lipid accumulation in the cytoplasm mainly due to invitro culture conditions. The objective of this study was to evaluate the lipid content of fresh and frozen sexed bovine grade 1 IVP or IVD embryos. The same 8 Holstein heifers were used in a Latin square design for both IVP and IVD embryo production. Zygotes were cultured in synthetic oviductal fluid (SOF) supplemented with 1% oestrus cow serum. The same bull was used for IVP and IVD. All expanded Day 7 blastocysts (n=40 IVP and 40 IVD) were biopsied and sexed. Half of the embryos (n=20 in each group) was slow frozen (1.5M ethylene glycol, 0.1m sucrose) and thawed before lipid extraction. Remaining embryos underwent lipid extraction in the fresh state. Briefly, the liposoluble fraction of the embryos was extracted according to the Bligh and Dyer method using chloroform and methanol. Liquid chromatography–high-resolution mass spectrometry (LC-HRMS) analysis was performed and operated in positive ionization mode. Lipids with variance intensities greater than 30% in quality control samples were removed as well as those identified as background noise. Partial least square discriminant analysis (PLS-DA) was used to show the relationship between variance in the data and difference among embryo origin (IVP vs. IVD), state before extraction (fresh vs. frozen), and sex of the embryos (male vs. female). The differentially lipid species groups were identified using Wilcoxon test, and considered significantly different when P

Supplementation of rumen-protected amino acids (RPAA) has proven to be an effective tool to supply limiting AA in dairy diets. Methionine and lysine are the two most limiting AA for lactating dairy cows. Recently, it has been shown that methionine supplementation seems to affect pre-implantation embryos collected from superovulated cows enhancing their developmental competence because there is strong evidence that endogenous lipid reserves serve as an energy substrate (Acosta et al. 2016 Theriogenology 85, 1669–1679). Moreover, higher concentrations of methionine were determined in the follicular fluid of the first dominant follicle postpartum in cows supplemented with rumen-protected methionine and rumen-protected choline from 21 days before calving to 30 days postpartum and it was assumed that higher methionine concentrations in the follicular fluid could affect oocyte quality (Acosta et al. 2017 Theriogenology 96, 1–9). There is no information available so far regarding the effect of a combined methionine and lysine supplementation (each rumen-protected) on oocyte quality. Therefore, the objective of this study was to evaluate the effect of a combined methionine and lysine supplementation during early to mid-lactation on the developmental competence of oocytes collected from lactating dairy cows (days 0 to 100 p.p.). Thirty pregnant multiparous German Holstein dairy cows were grouped 3 weeks before their expected calving date, receiving identical diets. After calving, they were randomly allocated to 2 groups fed a total mixed ration supplemented with (N = 14 cows; RPAA) or without (N = 16 cows; CON) LysiGEMTM (encapsulated lysine; Kemin Industries) and Metasmart DryTM (isopropyl ester of the hydroxylated analogue of methionine adsorbed onto a silicon dioxide carrier; Adisseo). Starting from 45 days p.p., animals from both groups were submitted to an ovum pickup (OPU) session once a week for at least 8 weeks. Collected cumulus–oocyte complexes (COC) were subjected to a standard invitro production (IVP) protocol (Stinshoff et al. 2014 Reprod. Fertil. Dev. 26, 502–10) including IVM, IVF, and invitro culture (IVC). Cleavage and developmental rates up to the morula/blastocyst stage were recorded on Days 3, 7, and 8. In total, 1211 follicles have been aspirated from RPAA animals compared with 1413 from CON animals, from which 742 and 885 COC were collected, respectively. The calculated recovery rate based on the number of aspirated follicles and collected COC was similar for both groups (61.3 ± 29.4% vs. 62.6 ± 33.5%). Cleavage and developmental rates based on 240 (RPAA group) and 299 (CON group) COC also showed similar results [RPAA: 84.1 ± 5.9% (202/240), 18.3 ± 4.4% (44/240), 18.8 ± 4.7% (45/240); CON: 81.9 ± 8.6% (245/299), 15.4 ± 8.9% (46/299), 16.7 ± 8.4% (50/299)]. In conclusion, supplementation of RPAA (methionine and lysine) had no beneficial effect on the developmental competence of COC obtained from these animals compared with those collected from cows fed the diet without RPAA supplementation.

Cadmium (Cd) is one of the most toxic environmental and industrial heavy metals, with adverse effect on female reproduction. Earlier invitro studies have demonstrated that exposure to Cd during IVM impairs oocyte fertilization through the induction of oxidative stress (Martino et al. 2017 Reprod. Toxicol. 69, 132-145). The aim of this study was to evaluate the effect of supplementing IVM medium with resveratrol (Res), a phytoalexin with antioxidant activity, on IVF of ovine oocytes matured under Cd exposure and to evaluate whether this effect could be mediated by alterations of cortical granules (CGs) distribution and/or intracellular levels of reactive oxygen species (ROS). Cumulus-oocyte complexes collected from slaughterhouse-derived ovaries of prepubertal ewes were invitro matured with 0μM CdCl2 (control), 2μM CdCl2 (Cd group), or 2μM CdCl2 + 1μM Res (Cd-Res). Groups of MII oocytes were invitro fertilized with ram semen (Bogliolo et al. 2011 Reprod. Fertil. Dev. 23, 809-817). After 16h, oocytes were fixed with absolute ethanol, stained with Hoechst 33342, and classified as follows: normally fertilized (two pronuclei), polyspermic (more than two pronuclei), and abnormally fertilized (asynchronous pronucleus formation). Levels of ROS and distribution of CG in MII oocytes (n=25 each group) were evaluated by confocal laser scanning microscopy after staining with 2’,7’dichlorodihydrofluorescein diacetate and Alexa Fluor 488-conjugated lectin peanut agglutinin, respectively (Jiao et al. 2013 PLoS One 8, 58018). Data of fertilization and CGs distribution were analysed by Chi-squared test and ROS levels (mean±standard error) by Kruskal-Wallis test with STATA\IC 11.0 (Stata Corp.). Oocytes matured in presence of Res had higher normal fertilization and lower polyspermy rates than those matured without Res (Table 1). Levels of ROS in oocytes were lower in the Cd-Res group than in the Cd group (74.4±1.3 vs. 122.4±1.5 pixel/oocyte; P

Hypothermic storage (4°C) of ovaries for long-distance transport holds great potential to expand access to fertility preservation in animals and humans (Duncan et al. 2016 Reproduction 152, 201-210). However, storage for prolonged periods (over 24 h) leads to structural/functional changes in the ovarian tissue with a critical reduction of follicular viability and oocyte quality (Piras et al. 2018 Reprod. Biol. Endocrinol. 10, 16-76; Isachenko et al. 2009 Fertil. Steril. 91, 1556-1559). The radio electric asymmetric conveyer (REAC) is a novel technology platform for neuro and bio-modulation that optimize the ion fluxes and the mechanisms driving cellular asymmetry and polarization in biological structures (Maioli et al. 2016 Sci. Rep. 6, 28682). The REAC has already proved to be effective in promoting cell differentiation and reprogramming and to counteract the biological mechanisms linked to aging and the degenerative process (Berlinguer et al. 2017 Reprod. Biol. Endocrinol. 15, 11; Maioli et al. 2014 Age 36, 9-20). In the present study, the domestic cat was used as an experimental model to evaluate the effect of REAC treatment during ovary storage at 4°C for 48 h on in vitro developmental ability of oocytes retrieved from antral follicles. Ovaries harvested from healthy domestic queens during ovariectomy were randomly assigned to the REAC-treated (R: n = 13) and untreated (C: n = 13) groups. In detail, ovaries were maintained in 4 mL of phosphate-buffered saline at 4°C for 48 h. The REAC device was set at 2.4 GHz, and its conveyer electrodes were immersed into the phosphate-buffered saline. After 48 h, ovaries were sliced to release cumulus-oocyte complexes, which were selected according to their morphological characteristics (Johnston et al. 1991 Biol. Reprod. 45, 898-906) for IVM (R: n = 130; C: n = 133). Matured oocytes were fertilised (IVF) with frozen-thawed epididymal spermatozoa and presumptive zygote were in vitro cultured (IVC) for 7 days. On Day 2 and Day 7 of IVC, respectively, the number of embryos cleaved and developing to the blastocyst stage was determined. The IVM, IVF, and IVC were performed according to the procedure of Piras et al. (2018 Reprod. Biol. End. 16, 76). Data were analysed by chi-square test with STATA\IC 11.0. Maturation rate of oocytes did not differ between groups (R: n = 59/130, 45.4%; C: n = 66/133, 49.6%). Cleavage rate was higher (P

Canine oocyte in vitro maturation (IVM) is one of the challenges of animal reproduction because of low maturation and high degeneration rates. In the bitch, after ovulation, oocytes remain in an immature stage and acquire their competence in the intra- and extrafollicular (oviductal) environments. Oxidative stress and reactive oxygen species affect canine oocytes, which can be related to the high amount of lipids they contain. Therefore, the use of antioxidants such as insulin-transferrin-selenium (ITS) and lower oxygen tension during IVM could be beneficial for oocyte maturation and survival. The purpose of this study was to determine an optimum IVM culture medium and to evaluate the effect of ITS and lower oxygen tension in canine IVM. In experiment 1, TCM-199 and synthetic oviductal fluid (SOF) media were evaluated for their ability to promote nuclear maturation at 72 and 48 h of culture. Also, two protein sources were used: 8% bovine serum albumin (BSA) and 2.5% fetal bovine serum (FBS), and media were supplemented with hormones. The results revealed that SOF with FBS and BSA had similar results to TCM-199 supplemented with FBS after 72 and 48 h of IVM (MII rates of 7% and 4% for the 72-h group, and 4% and 10% for the 48-h group). Synthetic oviductal fluid supplemented with BSA but without FBS produced significantly higher degeneration rates compared with SOF with FBS and BSA (44% and 23%, respectively). Forty-eight hours of IVM decreased degeneration rates, with higher MII rates compared with 72 h of IVM. In experiment 2, SOF medium supplemented with FBS and BSA was chosen. Oocytes were cultured in SOF with FBS and BSA supplemented at two concentrations of ITS (1 and 10 μL mL−1 ITS). Supplementation with 1 μL mL−1 ITS demonstrated a beneficial effect by improving maturation rates up to 20%, compared to control and 10 μL mL−1 supplemented group (4% and 6% MII, respectively) after 72 h of IVM. For experiment 3, oocytes were cultured in SOF medium with or without ITS (0 and 1 μL mL−1 ITS) under two oxygen tensions (5% and 20% O2) for 48 h. Results from this experiment demonstrated that the combination of low oxygen tension and ITS (5% O2 and 1 μL mL−1 ITS) improved maturation rates up to 26.2%, although there were no statistically significant differences compared with high oxygen and ITS (20% O2 and 1 μL mL−1 ITS) and low oxygen without ITS (5% O2 and 0 μL mL−1 ITS) groups. These treatments were able to increase MII rates compared with the control group (20% O2 and 0 μL mL−1 ITS). Parthenogenetic activation was performed on the low oxygen with or without ITS supplemented groups. The untreated group generated higher degeneration rates after 7 days of culture, and cleavage rates were low for both groups. Nevertheless, an oocyte at the 8-cell stage was obtained in the ITS-supplemented group. Taken together, these results indicate that ITS supplementation and low oxygen tension during IVM improve canine oocyte maturation.

We recently developed and validated a methodology based on early morphokinetics to predict 6 categories of bovine embryos, including 4 categories of blastocysts: early hatching blastocysts (EHB), hatching blastocysts (HB), low hatching blastocysts (LHB), and arrhythmic blastocysts (AB) (Reis et al. 2018 Anim. Reprod. 15, 601). We hypothesised that different early morphokinetic pathways could (1) be accompanied by different biological patterns (EGA, etc.) and (2) influence interaction with environmental constraints (cryopreservation, etc.). The objective of this study was (1) to investigate whether transcriptomic differences between the predicted EHB, HB, LHB, or AB could be observed immediately after the fourth embryonic cycle (just after EGA); (2) to assess cryotolerance of these morphokinetic categories. Time lapses were produced during 4 days post invitro insemination (dpi) (Reis et al. 2018). Study 1: 128 embryos having finished the fourth embryonic cycle were individually dry frozen at 4.7 dpi, classified as EHB, HB, LHB, or AB, and pooled into four batches of eight embryos/category (total 16 samples). Total RNA was extracted, amplified using the SMARTseq V4 ultralow input kit (Clontech), libraries were prepared using the Nextera XT Illumina library preparation kit, and sequenced (paired-end 50-34bp) on an Illumina NextSEqn 500 instrument. Identification of differentially expressed genes was achieved using Limma package (R). The P-values were adjusted using the Benjamini and Hochberg false discovery rate (Saenz-de-Juano et al. 2014). Fold change >2 or 135µm and −2µm at zona pellucida) were slow frozen at 6.2 or 7 dpi, classified as EHB (n=8), HB (n=29), LHB (n=32), or AB (n=21), and further thawed and cultured invitro for 72h. Cryotolerance was evaluated at 24 and 72h post-thawing. Statistical analysis was performed using chi-square or Fisher test. Study 1: the AB category presented 258, 699, and 899 upregulated genes and 40, 62, and 60 downregulated in comparison to LHB, HB, and EHB, respectively. The functional comparison of the two extremes (EHB vs. AB), at 4.7 dpi, showed that AB embryos present intense transcription regulation activity. The monocarboxylic acid binding pathway was upregulated in EHB. Study 2: the post-thawing invitro survival was similar between EHB, HB, LHB, and AB (50%, 34.5%, 31.3%, and 42.9%, respectively). The hatching/alive ratio in EHB category tended to be lower than AB (1/4 vs. 8/9; P=0.052). Frozen/thawed EHB and HB presented reduced hatching rates, whereas LHB and AB significantly increased the hatching potential after thawing compared with their not-frozen counterparts of the learning database (25% vs. 100%; 50% vs. 100%; 70% vs. 11%; 88.9% vs. 18%, respectively). Morphokinetic prediction highlighted a new classification of bovine embryos with different biological features. This could contribute to improve practice on IVF embryo transfer taking into account these differences.

Cryopreservation of oocytes and embryos is an essential technique for invitro-produced cattle worldwide. One of the great difficulties of cryopreservation of oocytes and blastocysts is the accumulation of lipids in the cytoplasm when produced invitro. The lipid metabolism of oocytes and embryos is classically regulated by the cAMP pathway. Furthermore, previous studies have suggested that the cyclic guanosine monophosphate (cGMP) pathway may also be involved in modulating lipid metabolism through protein kinase G activation. The objective of this study was to investigate the lipid profile of bovine blastocysts produced invitro when stimulated by specific stimulator of cGMP synthesis (NPPB). Pools of oocytes were matured invitro for 24h in tissue culture medium 199, with 15% bovine serum, 0.5µgmL−1 FSH, 5µgmL−1 LH, 0.8mM L-glutamine, and 50µgmL−1 gentamicin at 38.5°C and 10−6 M NPPB. The control group was matured without NPPB. After 22h, the oocytes were fertilised invitro with frozen sperm. The IVM oocytes were fertilised and cultured according standard procedures (Rubessa et al. 2011 Theriogenology 76, 1347-1355). After the 7 days (Day 7), the blastocysts (from early blastocyst to expanded blastocyst) were collected, washed in methanol:water (vol/vol) 1:3, and frozen at −80°C. The lipid extraction of the samples was performed based on the standard protocol (Bligh and Dyer 1959 Can. J. Biochem. Physiol. 37, 911-917) but adapted for small samples. The samples were diluted and analysed in the Agilent 6410 QQQ (Agilent Technologies) mass spectrometer and analysed according to the multiple reaction monitoring method described by de Lima et al. (2018 J. Mass Spectrom. 53, 1247-1252). Data for 3 replicates/group were normalized and then submitted to t-test statistical analysis and principal component analysis, by Metaboanalyst 4.0, with a significance level of 5%. The rates of cleavage and blastocysts were not affected when we used the mGC stimulator presenting a 61% rate of cleavage for both groups, and 24.4% and 25% of blastocyst rate for control and NPPB, respectively (P

The objective of this study was to investigate the addition of linoleic acid albumin (LAA) to invitro culture medium to improve the development of blastocysts with low permeability and fluidity in serum-supplemented medium. Currently, vitrification and slow freezing are performed as cryopreservation methods of bovine embryos. Recently, it was reported that invivo embryos stored at 4°C for 168h retained their pregnancy competence. For IVF, embryo development and cryotolerance are highly influenced by the presence of serum in the culture medium. Thus, this study aimed to confirm the survivability of invitro fertilized embryos cultured in medium supplemented with LAA after low-temperature storage. The cumulus-oocyte complex collected from slaughterhouse-derived ovaries was matured for 20h in tissue culture medium-199 supplemented with 0.02 AUmL−1 FSH and 5% calf serum (CS). After cumulus-oocyte complexes were incubated with 5×106 spermatozoa per mL for 6h and the presumptive zygotes were removed, their cumulus cells were cultured with CR1aa supplemented with 5% CS (control) or CR1aa supplemented with 0.3mgmL−1 LAA and 5% CS (LAA group) for 7 or 8 days. The code 1 or 2 blastocysts that developed on Days 7 and 8 were used in this study. The developed blastocysts were equilibrated to the low temperature storage medium (25mM HEPES buffered tissue culture medium-199 supplemented with 50% fetal calf serum (FCS)) for 20min and stored in a refrigerator at 4±1°C for 48 or 72h. After low-temperature storage, the blastocysts were diluted in a buffer (Dulbecco's phosphate-buffered saline) supplemented with 10% FCS for 10min, washed three times with tissue culture medium-199 supplemented with 20% FCS and 0.1mM β-mercaptoethanol, and cultured in the same medium. Thereafter, blastocyst survival (re-expansion) and hatching were observed for up to 72h. The data were analysed using the chi-squared test with Yates's correction. The results of 48-h low-temperature storage of blastocysts for the control (n=55) and LAA (n=28) groups showed significant differences (P

Porcine immature oocytes can survive vitrification at high rates and retain their ability to undergo maturation and fertilization; however, the procedure reduces their competence for subsequent embryo development via unknown mechanisms (Somfai et al. 2014 Plos One 9, e97731). The aim of the present study was to clarify whether our vitrification procedure at the germinal vesicle stage triggers apoptosis in oocytes and subsequent developing embryos. Immature porcine cumulus-oocyte complexes obtained from slaughterhouse-derived ovaries were vitrified and warmed by our method (Appeltant et al. 2018 Cryobiology 85, 87-94) immediately after collection (vitrified group). The oocytes were equilibrated in 2% (vol/vol) ethylene glycol and 2% (vol/vol) propylene glycol for 13-15min. Then, they were vitrified by dropping them into liquid nitrogen in 2-μL microdrops of a medium composed of 17.5% ethylene glycol, 17.5% propylene glycol, 0.3M sucrose, and 50mgmL−1 polyvinylpyrrolidone. After warming, they were subjected to IVM, fertilization (IVF), and embryo culture using chemically defined media (Yoshioka et al. 2008 J. Reprod. Dev. 54, 208-213). From each collected batch, a group of oocytes was processed without vitrification (control group). Apoptosis was assayed in membrane-intact oocytes at the end of IVM and in cleavage-stage embryos on Day 2 after IVF (Day 0) by the CaspACE FITC-VAD-FMK In Situ Caspase Marker (Promega; Experiment 1), deoxynucleotidyl transferase (TdT) dUTP nick-end labelling (TUNEL; Experiment 2), and analysis of mRNA levels by RT-qPCR for the pro-apoptotic Bax and CASP3 genes (Experiment 3). Each experiment was replicated three times. Data were analysed by Kruskal-Wallis test followed by Dunn's multiple comparisons test. The mean survival rate of vitrified oocytes was 89.2%. There was no significant difference between the control and vitrified groups in relative caspase levels in IVM oocytes and in 2- to 4-cell embryos after IVF; however, significantly increased caspase activity (P

The development of markers for reproductive function has been a goal for the embryo production industry and reproductive biology as a method to improve success and increase the ability to explain reproductive phenomena. Cattle and buffalo are bovines that show different reproductive parameters raised in the same conditions. The aim of this work was to compare the results of the invitro production of cows (Bos indicus) and buffalo (Bubalus bubalis) from animals kept under the same conditions of feeding and handling. This study was conducted in an Argentinian commercial herd of buffalo and cattle located in the province of Corrientes (−27.742859 latitude, −57.773611 longitude) during the breeding season of 2018 (March-May). Twenty animals of each species were used. Anti-Mullerian hormone (AMH) levels of each animal were determined using ELISA. Standardized protocols were used for oocyte aspiration, maturation, fertilisation, and culture of the embryos, and frozen semen of a single proven bull was used in each species. The numbers of follicles, oocytes, and embryos were recorded and analysed individually and grouped by species (Table 1). The normality of the data was evaluated with the D’Agostino and Shapiro-Wilk tests and the comparisons between species using the Mann-Whitney and ANOVA tests, and correlation analysis was performed using the Spearman test. Values are shown as median and range. A P-value 0.05). There were no significant differences in the number of follicles and the quality of the oocytes. Significant differences were found in the number of oocytes cleaved of 4 (0-17) vs. 0.5 (0-4) and blastocysts per animal of 1.5 (0-15) vs. 0.1 (0-2) for cows and buffalo, respectively. The number of blastocysts in relation to the number of oocytes cleaved did not show statistical significance. In spite of the difference in the AMH levels and the embryo production parameters, which were lower in buffalo, no correlation was found between AMH and the parameters studied in both species. The results obtained here are confirmed by others in the literature. Levels of AMH as a marker for embryo production are not useful in cattle and buffalo and do not explain the differences observed, certainly AMH is a marker for quantity as the preserver of the ovarian reserve. Table 1.Comparison of individual values of AMH levels, oocyte quality, and embryo production between cattle and buffalo Parameter Median (range) P-value Cattle Buffalo AMH (pgmL−1) 688.5 (45.3-2394) 73.8 (14.8-262.5)

In vitro embryo production (IVP) can increase the reproductive potential and genetic quality of cattle, as well as other species. This powerful assisted reproduction tool can be used to produce embryos from prepubertal calves, reducing the generation interval. A recent sexed semen technology known as ULTRA (ST Genetics), completely modified the technique, the media and sperm concentration. In field trials with AI there was no difference between conventional semen (CONV) and ultra-sexed semen at a concentration of 4 million per straw (ULTRA-4M). The combined use of IVP and ULTRA-4M can decrease the selection time for improving dairy and beef cattle herd genetics. The objective of this research was to compare the CONV and ULTRA-4M semen using bovine IVP and prepubertal calves. The research was carried out in the reproduction laboratory of the Facultad de Estudios Superiores Cuautitlan - Universidad Nacional Autonoma de Mexico (FESC-UNAM). The IVP was performed with a continuous in vitro culture (IVC) system. The ovaries were collected in Campeche, Mexico, from Bos indicus × Bos taurus crossbred calves (6 months old) using surgical castration (for export to the United States) and transported to the laboratory (FESC-UNAM) in BO-HEPES-IVM (Bioscience™), in an oocyte transporter (WTA). Vitrogen media were used for IVF and IVC. For IVM, the cumulus-oocyte complexes (COCs) were selected (only grades 1 and 2) and matured for 24 h at 38.5°C. Matured oocytes (n = 600, divided equally into five replicates) were divided into 2 groups, the CONV group and the ULTRA-4M group. The IVF process was conducted with CONV and ULTRA-4M semen from the same bull (Holstein) at a concentration of 2 × 106 and 0.5 × 106 spermatozoa mL−1, respectively, for 18 h in 38.5°C, 5% CO2, 95% air, and 100% humidity. The presumptive zygotes were denuded by pipetting and set in IVC until Day 7 at 38.5°C, 5% CO2, 5% O2, and 90% N2 at 100% humidity. The cleavage results were recorded 56 h after the beginning of IVC. The cleavage rate, embryos with more than 6 cells, and blastocysts on Day 7 of culture were evaluated. The statistical analysis was carried out with the GLM procedure of the SAS software (version 9.3; SAS Institute Inc.) to evaluate the results of CONV vs. ULTRA-4M (α level = 0.05). The percentage of cleavage for CONV was 46% ± 1.4 and 43.2% ± 1.4 for ULTRA-4M. The results for embryos with more than 6 cells in the CONV and ULTRA-4M groups were 16% ± 0.6 and 14% ± 0.6, respectively. The percentage of blastocysts on Day 7 for CONV was 9% ± 0.6 and 8% ± 0.6 for ULTRA-4M. There were no significant differences between groups (P > 0.05) for all variables analysed. In conclusion, under the conditions of this research the ULTRA-4M and CONV produced similar results for IVP.

Somatic cell nuclear transfer (SCNT) is an assisted reproductive technology with potential for its application in agriculture, biomedicine, and biotechnology. However, the SCNT efficiency is low. Failure in embryo production by SCNT could be associated mainly with chemical activation treatments or the donor cell type. In this context, we compare the use of latrunculin A (LatA), instead of cytochalasin B during the activation with roscovitine (Rosco), versus the treatment of donor cells with demecolcine (D-cells) followed by activation just with Rosco to compare cloning efficiency. The aim of this study was to evaluate the invitro developmental competence as well as the gene expression pattern of key genes (CDX2, OCT4, SOX2, and NANOG) in blastocysts obtained from the two treatments. To do this, cumulus-oocyte complexes were collected from cow ovaries obtained from slaughterhouses and were IVM for 21h. After cumulus-cell removal, enucleation was performed as described by Gambini et al. (2014 PLoS ONE 9, e110998; https://doi.org/10.1371/journal.pone.0110998). The G0/G1 cells or D-cells were fused to the oocytes. For activation, reconstructed zygotes were treated with 5μM ionomycin for 4min followed by 5-h incubation into different randomly activation groups: D-cells + 50μM Rosco (SCNT-Demec), G0/G1 cells + 50μM Rosco/10μM LatA (SCNT-LatA), and G0/G1 cells + 50μM Rosco/5μgmL−1 cytochalasin B (SCNT-Ctrol). Parthenogenetic controls were also included: Part-Demec, Part-LatA, and Part-Ctrol. Activated oocytes were cultured in synthetic oviductal fluid with amino acids medium until blastocyst stage. Rates of cleavage, morulae, and blastocysts were evaluated at Days 2, 5, and 7 of invitro culture, respectively. Relative abundance of mRNA coding for the four genes was compared between SCNT-Demec, SCNT-LatA, SCNT-Ctrol, and IVF groups by RTqPCR. Data was analysed by Fisher's exact test for invitro culture (P

The absence of maternal-embryo signals could be an important cause of the poor pregnancy rates of invitro-produced embryos, compared with those collected invivo. In the context of paracrine communication, co-culture of embryo with amniotic-derived extracellular vesicles (EVs) improved their quality compared with control (CTR) (Perrini and Lange Consiglio 2018 Reprod. Fertil. Dev. 30, 658-671), and after cryopreservation, provided higher invitro embryo hatching and recipient pregnancy rate (Lange-Consiglio et al. 2019 Reprod. Fertil. Dev. 31, 155). After these results, the aim of this study was to evaluate microRNA (miRNA) profiling of invitro-produced blastocysts with or without EV supplementation, using invivo-produced blastocysts as CTR. Invitro embryos were produced based on our protocol (Perrini and Lange Consiglio 2018 Reprod. Fertil. Dev. 30, 658-671) with or without 100×106 EVsmL−1 in synthetic oviductal fluid with amino acids (SOFaa) on Day 5 post-fertilisation (Perrini and Lange Consiglio 2018 Reprod. Fertil. Dev. 30, 658-671). Grade 1 blastocysts (B7) were immediately snap frozen in liquid nitrogen for genomic study. These embryos were obtained from three replicates. Invivo embryos were obtained from three cows superovulated by Folltropin and inseminated by the same cryopreserved semen. After flushing, only B7 were snap frozen for genomic study. Samples for RNA isolation were obtained from 3 pools of 10 embryos each for each condition (vivo, vitro-CTR, and vitro+EVs). Total RNA was isolated by a NucleoSpin1 miRNA kit. Concentration and quality of RNA were determined by an Agilent 2100 Bioanalyzer. Libraries were prepared using TruSeq Small RNA Library Preparation kits (Illumina). Differential expression analyses between samples were run with the Bioconductor edgeR package (false discovery rate

Recently, it has been postulated that oviductal extracellular vesicles (oEV) might act as natural nanoshuttles bringing key components (small noncoding RNAs and proteins) of the oviduct into gametes and embryos. Furthermore, co-incubation of frozen-thawed oEV with in vitro-produced bovine embryos was reported to increase blastocyst rate and quality (Alminana et al. 2017 Reproduction 154, 153-168). The objective of this study was to determine the dose-dependent effect of oEV supplementation of embryo culture medium on the in vitro development and cryotolerance of embryos. Briefly, oEV were isolated by ultracentrifugation from a pool of oviductal fluids (8 cows/sample) collected at the slaughterhouse at the post-ovulatory stage and ipsilateral to ovulation and stored at −80°C until used. Slaughterhouse-derived bovine oocytes were in vitro matured and fertilised with frozen-thawed semen from one bull (4 replicates; 194 presumptive zygotes per group), according to our standard procedures. After IVF, groups of presumptive zygotes (n = 20/drop) were cultured under humidified air with 5% CO2, 5% O2 at 38.8°C for 7 days in 30 µL of synthetic oviductal fluid-bovine serum albumin supplemented with oEV at different protein concentrations: 0.5, 0.05, or 0.005 mg mL−1 and without (control). Cleavage rates were evaluated on Day 2 and blastocyst rates were assessed on Days 6 and 7 (IVF as Day 0). At Day 7, expanded grade 1 blastocysts were evaluated (International Embryo Technology Society classification) and embryos at the expanded grade 1 blastocyst stage were slow frozen in 1.5 M ethylene glycol + 0.1 M sucrose and stored in liquid nitrogen. For cryotolerance evaluation, embryos were thawed and cultured for 48 h in synthetic oviductal fluid-bovine serum albumin + 1% estrous cow serum. Hatching rates were assessed at 48 h post-thawing. Data were analysed by a logistic regression mixed model (SAS, SAS Institute Inc.; Glimmix procedure) followed by post-hoc Tukey for multiple comparisons. Differences were considered significant at P

The negative energy balance (NEB) in dairy cows, early postpartum, is related to reduced fertility. A metabolic characteristic of NEB is elevated levels of free fatty acids (NEFA) in blood and follicular fluid with an effect on the cumulus-oocyte complex (COC; Leroy et al. 2005 Reproduction 130, 485-495, https://doi.org/10.1530/rep.1.00735; Aardema et al. 2011 Biol. Reprod. 85, 62-69, https://doi.org/10.1095/biolreprod.110.088815; Aardema et al. 2013 Biol. Reprod. 88, 164, https://doi.org/10.1095/biolreprod.112.106062). In this study, we investigated the effect of elevated NEFA levels on granulosa cells and consequently steroid production during NEB. Both 17β-oestradiol (E2) and progesterone (P4) levels in follicular fluid and oocyte competence were measured during NEB, as oocyte competence and steroid production are related (Aardema et al. 2013 Theriogenology 80, 576-583, https://doi.org/10.1016/j.theriogenology.2013.05.025). Heifers were directed towards a control (CTR; n=6) or NEB group (NEB; n=6; fasting heifer model; Jorritsma et al. 2003 Theriogenology). Cycle synchronization and superstimulation were performed as previously reported; invivo matured oocytes were, by ovariectomy at 22h after the induced LH peak, individually collected from follicles (≥8 to ≤20mm) and invitro fertilized and cultured until Day 8. Levels of nonesterified fatty acids (NEFAs) in follicular fluid were, in CTR, 80μM palmitic (C16:0), 70μM stearic (C18:0), and 100μM oleic acid (C18:1) and, in NEB, 150μM C16:0, 100μM C18:0, and 200μM C18:1 (Aardema et al. 2013 Biol. Reprod. Vol, page range). Follicular fluid of individual follicles was frozen and stored at −20°C until E2 and P4 radioimmunoassay analysis. At Day 5 and 8 of culture, embryos were scored for developmental competence, according to Aardema et al. (2013 Biol. Reprod. Vol, page range). Oocytes developing to a blastocyst all originated from follicles with, formerly in control animals defined, optimal follicular fluid levels of E2 ≤0.25 μM and P4 ≥0.26 μM (Aardema et al. 2013 Theriogenology 80, 576-583, https://doi.org/10.1016/j.theriogenology.2013.05.025). Overall E2 levels in follicular fluid in NEB appeared to be lower than those in CTR. There was a reduced positive value of 0.33 (vs. 0.49 in CTR) for predicting the competence of oocytes to develop into a blastocyst, and reduced specificity of 0.26 (vs. 0.75 in CTR) for oocytes originating from follicles with optimal steroid levels in NEB. The sensitivity and negative predictive value were 1.0 in both NEB and CTR. Levels of P4 in follicular fluid were unaffected by NEB. The lower level of E2 indicates an effect of NEB on steroid synthesis in granulosa cells. Recently, it was demonstrated that invitro exposure to monounsaturated C18:1, in contrast to saturated C16:0 or C18:0, resulted in reduced E2 production and expression of CYP19A1 in granulosa cells (Sharma 2018 Endocrine Connections 8, 493-505, https://doi.org/10.1530/EC-19-0011). These data suggest that elevated levels of NEFAs, C18:1 in particular, affect the function of granulosa cells and the follicular steroid environment of the COC, in contrast to the effect of C18:1 on the COC, which appears to protect the oocyte against lipotoxic events by saturated NEFAs by massive lipid accumulation in cumulus cells (Aardema et al. 2011 Biol. Reprod. 85, 62-69, https://doi.org/10.1095/biolreprod.110.088815; Aardema et al. 2013 Biol. Reprod. 88, 164, https://doi.org/10.1095/biolreprod.112.106062). Elevated levels of C18:1 may also result in increased lipid storage in granulosa cells and could affect the steroid synthesis of cholesterol that is also stored in lipid droplets. How elevated NEFA levels during the NEB affect granulosa cells is under investigation.

Antral follicle count (AFC) performed after an oestrus synchronization protocol has been studied as a tool to select ewes with high potential for in vivo embryo production (Pinto et al. 2018 Theriogenology 113, 146-152). However, it would be interesting to know whether AFC assessed on a random day of the oestrous cycle correlates with the superovulatory response. The present study was conducted to evaluate the correlation between AFC at the beginning of progesterone (P4)-based oestrus synchronization protocol used as basis of superovulatory treatment and the number of corpora lutea (CL) 12 h before recovery of embryos in Santa Ines ewes. The study was conducted during September and October in northeast Brazil (03°40′26″S and 40°14′20″W) using 8 adult Santa Ines ewes. On a random day of oestrous cycle (Day 0) all ewes received an intravaginal device (CIDR) of progesterone (0.3 g, Eazi-breed, Zoetis), which remained for 9 days. On Day 7, the pFSH (133 mg, Folltropin V, Vetoquinol) treatment began, with 6 decreasing doses (25, 25, 15, 15, 10, and 10%) injected IM at 12-h intervals. On Day 9, 2 equal doses of D-cloprostenol were injected at a 12-h interval (37.5 µg, Prolise, Agener Uniao). All ewes showed oestrus and were mated by fertile rams. Flunixin meglumine (24.9 mg; Banamine, MSD Animal Health) was administered IM on Days 12, 13, and 15. On Day 16, non-surgical embryo recovery (NSER) was performed after cervical dilation using D-cloprostenol and oestradiol benzoate at 16 h and oxytocin 20 min before. Transrectal B-mode ultrasound evaluations (Z5 Vet, Mindray), frequency 7.5 MHz, were performed on Day 0 and 7 and 12 h before NSER to evaluate the ovarian population present. Pearson correlation analysis (P

Invitro oocyte maturation (IVM) in the domestic canine is yet to be optimized, with low rates of cumulus-oocyte complexes (COCs) reaching MII. This limits the progression of assisted reproductive technologies, which could benefit breeding programs for assistance dogs and endangered Canidae. Canine oocyte maturation differs from that in other mammals, with the ovulation of a COC in the germinal vesicle stage and nuclear maturation occurring in the oviduct. Because of this, the environment in which a canine COC matures is unlike that of other mammals, meaning that IVM protocols cannot be readily adapted. The aim of the current work was to determine (1) the effects of varying concentrations of FSH, human chorionic gonadotrophin (hCG), and oestradiol (E2) during IVM on meiotic resumption and nuclear maturation of canine COCs; and (2) the optimal medium base, either synthetic oviductal fluid (SOF) or tissue culture medium-199 (TCM). Reproductive tracts of bitches (6 months to 7 years of age) were collected from veterinary clinics within 2h of routine spaying. Ovaries were sliced using a scalpel blade, releasing the COCs into aspiration medium. The COCs were randomly allocated to a maturation medium consisting of one of the hormones at two concentrations (FSH: 5 or 10µgmL−1; hCG: 5 or 10IUmL−1; E2: 1 or 5µgmL−1) and for both SOF and TCM base. Each hormone was tested individually for a replicate of eight animals per hormone (total of 12 experimental groups; 24 animals). The COCs were cultured for 72h in their allocated medium and then denuded and stained with Hoechst 33258. Fluorescence microscopy was used to determine nuclear maturation stage. Nuclear maturation rates to MII were analysed using a general linear model with pairwise comparison (SPSS version 25; SPSS Inc./IBM Corp.) with each individual animal acting as a replicate. Canine COCs matured in a SOF-based media had higher rates of meiotic resumption (MI and MII) (SOF: 38.68%, n=515; TCM: 25.78%, n=542; P

Invitro embryo production (IVP) has become a reliable alternative for genetic improvement in beef and dairy herds. Maximizing embryo yield and pregnancy per donor are key factors. The aim of this study was to compare ovum pickup (OPU) yields, developmental competence of cumulus-oocyte complexes (COCs), and pregnancy rates from Angus donors in a commercial IVP setting. Donors (>4-year-old pluriparous open dry cows) were handled under the same feeding and environmental conditions. Treatment groups were organised as follows: Group 1: no synchronization (SYNCH; n=5); Group 2: SYNCH with no superstimulation (SOV; n=5); Group 3: SYNCH + SOV (n=5) and OPU 36h after last FSH injection; Group 4: SYNCH + SOV (n=5) and OPU 48h after last FSH injection; and Group 5: SYNCH + SOV (n=5) and OPU 72h after last FSH injection. Follicular waves in groups 2, 3, 4, and 5 were synched by gonadotrophin-releasing hormone (GnRH), prostaglandin F2α (PGF), and controlled internal drug release (CIDR). No pre-synch was used. Injections of FSH (pFSH=180mg, Folltropin) were performed IM twice a day, for three days. A minimum of three replicates were performed for each donor. A Mindray DP30V equipped with a micro-convex transducer 5.0-8.5MHz probe, disposable 20-gauge needle, and a flow rate of 15mL min−1 were used for OPU. All visible follicles (Foll) were punctured and retrieved into a 50-mL 36°C warmed tube with media (phosphate-buffered saline, bovine serum albumin (BSA), and heparin). Viable oocytes were classified according to IETS guidelines. The COCs were matured in 100µL of M199 medium supplemented with ALA-glutamine (0.1mM), Na pyruvate (0.2mM), gentamicin (5µgmL−1), epidermal growth factor (50ngmL−1), oFSH (50ngmL−1), bLH (3μgmL−1), cysteamine (0.1mM), and 10% fetal bovine serum (FBS) for 22 to 24h. Fertilization (Day 0) was carried out using highly fertile sires selected by discontinuous 40%/80% layers (PureSperm) and diluted to a final concentration of 1×106 spermmL−1. Matured oocytes were fertilized in 50µL of modified synthetic oviductal fluid (SOF) media supplemented with fructose (90µgmL−1), penicillamine (3µgmL−1), hypotaurine (11µgmL−1), and heparin (10µgmL−1). After 18h, presumptive zygotes were denuded and cultured under low oxygen tension in 50-µL drops of SOF-BSA for 7 days. On Day 3.5, 2% of FBS was added. On Day 7, fresh transferable (grade 1 and 2, IETS standards) blastocysts were implanted into synchronized recipient cows. Around Day 30, ultrasound diagnosis was performed to determined pregnancy rate (PR). We used ANOVA for comparisons of mean values and X2 test for proportions, α=0.05 (Table 1). In conclusion, synchronization, FSH stimulation, and 48-h coasting before OPU in Angus cows increased the number of collected viable oocytes and embryo development rates. More transferrable embryos and higher rates of PR per OPU were obtained using 36- and 48-h coasting, respectively. Table 1.Follicles (Foll), viable oocytes, cleavage, blastocysts, and pregnancy rates (PR) in Angus cows after ovum pickup (OPU) or invitro embryo production (IVP) SYNCH1 FSH Coasting Foll/OPU Oocytes/OPU Viable oocytes Cleavage,% Embryos,% Embryos/OPU PR,% PR/OPU NO NO NO 10.8a 9.0a 8.9a 63a 25a 2.3a 45a 1.0a YES NO NO 10.1a 8.4a 8.1a 73b 27b 2.2a 51b 1.1a YES YES 36H 16.5b 13.8b 13.6b 70c 29b 4.0b 46a 1.8b YES YES 48H 16.1b 13.4b 13.3b 69c 28b 3.8c 52b 2.0b YES YES 72H 15.6b 13.0b 12.6b 64a 22c 2.8d 55b 1.6c a-dValues with different superscripts in the same column differ (P

Maternal metabolic disorders are associated with elevated concentrations of palmitic acid (PA), which is known to jeopardize bovine oocyte and embryo development and quality. Analyses of PA-exposed bovine oocytes and embryos point toward oxidative stress (OS)-related pathways. Previous research has shown that the detrimental effects of PA exposure during oocyte IVM cannot be alleviated by antioxidant supplementation, e.g. Trolox (TR, water-soluble vitamin E), during IVM or invitro culture (IVC). In contrast, supplementing TR during IVM could protect developing zygotes from PA-induced lipotoxicity by increasing their development into 4-cell embryos and Day 8 blastocysts. In the present study, we examined the effects of TR during IVM or IVC on PA-exposed oocytes and embryos by evaluating OS and mitochondrial membrane potential (MMP) of the produced ≥2-cell Day 2 embryos (Table 1). Bovine cumulus-oocyte complexes (COCs) were matured, fertilised, and cultured in 2 experiments. In Experiment 1, COCs were exposed to pathophysiological follicular PA concentrations (150 µM), and subsequent embryos were cultured under solvent control (ethanol) conditions (PA-SC). The TR treatment was applied during IVM or IVC (100 µM; PATR-SC, PA-TR). In Experiment 2, COCs were matured under SC conditions, and subsequent embryos were exposed to pathophysiological oviductal PA concentrations (230 µM; SC-PA). The TR treatment was applied during IVM or IVC (100 µM; TR-PA, SC-PATR). In each experiment, a SC was included (SC-SC). A total of 126 and 137 Day 2 embryos were stained with JC-1 and CellRox Deep Red in Experiment 1 and Experiment 2 (3 repeats), respectively. The MMP was evaluated as active/total mitochondria and OS as OS/total mitochondria and analysed by one-way ANOVA. Exposure of oocytes and embryos to PA significantly increased OS and MMP in Day 2 embryos compared with controls. Regardless of the moment of PA exposure, TR treatment during IVM increased MMP even more. The increased MMP levels in PA-exposed oocytes and embryos were not influenced by TR treatment during IVC. Regardless of the antioxidant effect of TR, increased embryonic OS levels observed in PA-exposed oocytes and embryos could not be reversed to control levels by TR treatment during IVM or IVC. However, when OS levels were expressed on active mitochondria, we found that TR treatment before the PA insult (TR-PA) generated Day 2 embryos that displayed significantly lower OS/active mitochondria rates compared with SC-PA-treated embryos. Taken together, we conclude that the combination of relatively low OS levels with highly active mitochondria may be a mechanism implicated in the protective effect of TR before the PA insult on embryo developmental competence. Table 1.Effects of TR during IVM or IVC on PA-exposed oocytes and embryos in Experiments 1 and 2 Controls PA exposure TR during IVM TR during IVC SC-SC PA-SC PATR-SC PA-TR Exp. 1 MMP 0.39±0.02a 0.53±0.02b 0.65±0.02c 0.50±0.02b OS 0.55±0.04a 0.68±0.04b 0.78±0.03b 0.59±0.03ab SC-SC SC-PA TR-PA SC-PATR Exp. 2 MMP 0.39±0.02a 0.50±0.02b 0.65±0.02c 0.58±0.02b OS 0.55±0.04a 0.69±0.04b 0.70±0.03b 0.71±0.02b abcDifferent letters in the same row indicate significant differences (P

Colony-stimulating factor 2 (CSF2) is an important maternal regulator of embryonic development. Treatment of in vitro-produced embryos with CSF2 from Days 5 to 7 after insemination increased competence of embryos to establish pregnancy after transfer. One action of CSF2 is to protect embryos from stress. Treatment with CSF2 reduced heat-shocked induced apoptosis in morulae and regulated expression of multiple genes involved in cellular stress responses in the blastocyst. Here we tested whether CSF2 would promote survival of embryos to another stress: cryodamage caused by vitrification. Ovaries were recovered from an abattoir and used to harvest cumulus-oocyte complexes (COCs). Groups of 10 COCs were matured for 20-22 h. After maturation, COCs were fertilised with 1 × 106 mL−1 isolate-purified spermatozoa from a pool of frozen-thawed semen from 3 bulls. Fertilization proceeded for 20-22 h. Cumulus cells were removed from putative zygotes using 1000 U mL−1 hyaluronidase by agitation and putative zygotes were cultured in groups of 30 in 50-µL drops of synthetic oviducal fluid-bovine embryo 2 (SOF-BE2) medium until Day 7 after insemination. Drops of cultured embryos were randomly assigned to receive either 10 ng mL−1 recombinant bovine CSF2 or vehicle [90% (vol/vol) SOF-BE2 and 10% (vol/vol) Dulbecco's phosphate-buffered saline containing 1 mg mL−1 bovine serum albumin) on Day 5. Blastocyst-stage embryos were selected for vitrification at Day 7. Blastocysts were vitrified in open-pulled straws and rewarmed according to procedures of Vajta et al. (1996 Theriogenology 45, 683-689). After warming, embryos were cultured for 72 h in groups of 5-12 in SOF-BE2 containing 10% fetal bovine serum and 50 µM dithiothreitol. Blastocysts were assessed for re-expansion (defined as restoration of a reconstituted blastocoele) and hatching (defined as partial or completion exit from the zona pellucida). A total of 11 replicates were performed using 1745 zygotes treated with CSF2 and 1690 zygotes treated with vehicle. The number of blastocysts vitrified were 280 for CSF2 and 289 for vehicle. Data on percent presumptive zygotes becoming blastocysts and on blastocyst re-expansion and hatching after thawing were calculated for each replicate and analysed by analysis of variance using the GLIMMIX procedure of SAS (SAS Institute Inc.). The percentage of putative zygotes that became blastocysts was not affected by treatment (21.5 ± 1% for CSF2 vs. 20.9 ± 1% for vehicle). Overall, CSF2 increased (P = 0.021) the percentage of blastocysts that re-expanded (77.8 + 0.05% vs. 73.3 + 0.05%), but there was no effect of CSF2 on the percentage of blastocysts that underwent hatching (39.3 + 0.06% vs. 37.4 + 0.06%). In conclusion, CSF2 increased blastocyst survival following vitrification. Further work will be performed to evaluate whether CSF2 also increases survival of vitrified embryos after embryo transfer. Support was provided by NIH R01 HD088352.

Embryo aggregation consists of placing more than one zona-free (ZF) embryo in contact during development to obtain a unique structure. It has been reported in different species that aggregated cloned embryos show certain benefits compared with nonaggregated embryos. One way to obtain these benefits in IVF embryos would be to generate a transient chimera by the introduction of trophoblastic cells. Bovine trophoblastic cells can be obtained by embryo bisection of blastocysts, cutting asymmetrically to use trophoblasts (Tr) for aggregation and leaving aside the portion that contains the inner cell mass (ICM). Taking all this into account, the objectives of this work are to study the aggregation of Tr at different days of development and to determine the appropriate time of aggregation. To this aim, cumulus-oocyte complexes (COCs) collected from slaughterhouse ovaries were matured in tissue culture medium 199 containing 10% fetal bovine serum, 10 µg mL−1 FSH, 0.3 mM sodium pyruvate, 100 mM cysteamine and 2% antibiotic-antimycotic for 24 h, at 6.5% CO2 in humidified air and 38.5°C. We performed IVF with 16 × 106 spermatozoa per mL for 5 h. Afterwards, presumptive zygotes were cultured in synthetic oviductal fluid (SOF) for 7 days in a humidified atmosphere at 38.5°C, 5% O2, 5% CO2, and 90% N2. In Experiment 1, embryo bisection of Day 7 blastocysts was performed manually under stereoscopic observation with a microblade to obtain Tr. These were aggregated, with the bisected part containing the ICM (n = 22) or with ZF embryos of Days 4 (n = 23), 5(n = 25), or 6 (n = 22) and blastocysts (n = 25), and placed in microwells in a 100-μL SOF drop covered by mineral oil (Gambini et al. 2012 Biol. Reprod. 87, 15; https://doi.org/10.1095/biolreprod.112.098855). In Experiment 2, ZF synchronous whole embryos were aggregated in microwells at different developmental days: Day 3 (n = 18), 4 (n = 18), 5 (n = 47), 6 (n = 48), and 7 (n = 45). In both experiments, aggregation was assessed at Day 8. In Experiment 1, no aggregation was observed between the Tr and the embryos or the bisected ICM. Experiment 2 showed embryo aggregation on Days 3 (55%), 4 (27%), and 5 (61%), whereas on Days 6 and 7 no aggregation was observed. According to these results, we can conclude that, in our culture conditions, Tr obtained by blastocyst bisection have no capacity for aggregation. Day 6 and 7 whole ZF embryos also do not aggregate. As a general conclusion, there is a period from Days 0-5 of the in vitro development of bovine embryos in which aggregation is possible. Aggregation of blastocyst-derived Tr to cloned or high-value IVF embryos, aiming for quality improvement, is not an effective strategy.

The efficiency of assisted reproductive technologies is critically dependent on the quality of the oocytes used to produce the embryos. The aim of the present research was to study dose-dependent effects of three cytokines: fibroblast growth factor 2 (FGF2), leukemia inhibitory factor (LIF), and insulin-like growth factor 1 (IGF1) individually on IVM in bovine oocytes and their consecutive development to blastocysts after artificial activation. Slaughterhouse-derived cumulus-oocyte complexes (COC) (n = 2052 COC) were cultured for 22 h in either standard maturation medium [TCM-199 supplemented with 10% fetal calf serum (FCS), 0.2 mM sodium pyruvate, 10 μg mL−1porcine FSH, and 10 μg mL−1 ovine LH; control] or maturation medium supplemented with different concentrations (5-160 ng mL−1) of FGF2, LIF, and IGF1. After IVM, matured oocytes were activated by culturing in 5 μM ionomycin solution for 5 min followed by 4 h in 2 mM 4-dimethylaminopyridine (DMAP) and 10 mg mL−1 cyclohexamide. Activated oocytes were cultured in CR1aa medium until Day 5 and then transferred to the same medium supplemented with 5% FCS and cultured until Day 7. All cultures were performed at 38.5°C and 5% CO2 in humidified air. At Days 2 and 7 after activation, cleavage and blastocyst rates were determined. In addition, obtained blastocysts were fixed with 4% paraformaldehyde, and the total cell number was determined by 4′,6-diamidino-2-phenylindole (DAPI) staining. The data from 4 to 6 replicates (77-140 oocytes per treatment) were analysed by ANOVA. After 22 h of culture, the rate of MII oocytes, assessed by the presence of the first polar body, did not differ between the groups and ranged from 74.4 to 90.7%. No statistical differences were found in the cleavage rate between oocytes matured in cytokine-treated groups compared with the control. Cleavage rates for the LIF experimental groups was 63.5 to 77.2%, for the IGF1 experimental groups was 68.1 to 80.7%, and for the FGF experimental groups 63.7 to 77.0%. Optimal concentrations of LIF (5 and 20 ng mL−1), and FGF2 (20 and 40 ng mL−1) increased (P

Preservation of feline embryos is useful in propagating endangered species, preserving valuable genetics, and supporting biomedical research. Although a wide variety of cryoprotectants (CP) and protocols are successfully used for vitrification of invitro-produced (IVP) embryos, there are often species-specific differences in viability of embryos post-warming. The purpose of this study was to evaluate the viability of IVP feline embryos after vitrification using two common CPs, propanediol (PrOH) or ethylene glycol (EG). Embryos were produced with oocytes and frozen-thawed epididymal sperm collected from local spay-neuter clinics using a published IVP protocol developed for producing domestic feline embryos. Day 7 early blastocysts (stage 5), blastocysts (stage 6), and expanded blastocysts (stage 7) were evaluated for quality (grade 1 or 2) and randomly assigned to one of three treatments: vitrification with PrOH (n=32), vitrification with EG (n=31), or control (n=47), which was allowed to continue in culture until Day 8. The vitrification protocol was as follows. The base medium for all vitrification media was a HEPES-buffered feline optimized culture medium (FOCMH). Embryos were placed in 0.5mL of equilibration medium (7.5% dimethyl sulfoxide, 7.5% PrOH or EG, 0.5M sucrose, 10% Ficoll, and 20% fetal calf serum (FCS)) for 5min at room temperature. Individual embryos were then moved to 20-μL drops of vitrification medium (15% dimethyl sulfoxide, 15% PrOH or EG, 0.5M sucrose, 10% Ficoll, and 20% FCS) at room temperature for 30s before being loaded onto Cryolock devices and plunged into liquid nitrogen. Warming was done using a 3-step process for all vitrified embryos. First, embryos were moved from liquid nitrogen directly to 0.5mL of 1M sucrose, 10% Ficoll, and 20% FCS at 37°C for 1min. Next, embryos were moved to 0.5mL of 0.5M sucrose, 10% Ficoll, and 20% FCS at 20°C for 3min. Finally, embryos were transferred to 0.5mL of FOCMH for 5min at 37°C. All warmed embryos were cultured in medium, optimized for feline embryos, with 5% FCS and evaluated for re-expansion of the blastocoele and progression in development at 24 and 48h. Results are from five replicates. Embryos vitrified in EG exhibited higher percentages of viable embryos 24h after warming (84%) than embryos vitrified in PrOH (59%; P0.05). Results indicate EG is a more successful CP treatment for vitrification of feline embryos when evaluating viability 24h post-warming. We report a higher viability of embryos post-thaw than previous studies using the same CPs (Pope et al. 2012 Reprod. Domest. Anim. 47, 125). This may be due to the shorter exposure time to the CPs we used during the vitrification process. We conclude that EG and PrOH are effective CPs for Day 7 feline IVP embryos using this protocol. Further research is needed to increase treatment numbers and evaluate pregnancy rates from embryos transferred post-warming.

In vivo-matured mouse oocytes were enucleated, and a single murine embryonic fibroblast (control or reprogrammed by introducing extracts from murine testis tissue, which showed expression of male germ cell-specific genes) was injected into the cytoplasm of the oocytes. The rate of blastocyst development and expression levels of Oct-4, Eomes and Cdx-2 were not significantly different in both experimental groups. However, the expression levels of Nanog, Sox9 and Glut-1 were significantly increased when reprogrammed cells were used as donor nuclei. Increased expression of Nanog can be supportive of complete reprogramming of somatic cell nuclear transfer murine embryos. The present study suggested that donor cells expressing male germ cell-specific genes can be reconstructed and can develop into embryos with normal high expression of developmentally essential genes.

The use of serologically detectable male (SDM; also called H-Y) antigens to identify male embryos may be limited by the source of anti-SDM antibody. In the present study, novel anti-SDM B9-Fab recombinant clones (obtained by chain shuffling of an A8 original clone) were used to detect SDM antigens on murine embryos. Murine morulae and blastocysts (n=138) were flushed from the oviducts of Kunming mice and incubated with anti-SDM B9-Fab for 30 min at 37°C. With an indirect immunofluorescence assay, the membrane and inner cell mass had bright green fluorescence (presumptive males). Overall, 43.5% (60/138) were classified as presumptive males and 56.5% (78/138) as presumptive females, with 85.0 and 88.5% of these, respectively, confirmed as correct predictions (based on PCR analysis of a male-specific [Sry] sequence). We concluded that the anti-SDM B9-Fab molecule had potential for non-invasive, technically simple immunological sexing of mammalian embryos.

Bovine interferon (bIFN) τ plays a crucial role in maternal-fetal recognition and was expressed using a Bombyx mori (Bm) nuclear polyhedrosis virus (silkworm baculovirus) gene expression system. The biological effects of Bm-recombinant bIFNτ (rbIFNτ) on prostaglandin (PG) F2α synthesis were investigated in cultured bovine endometrial epithelial cells with oxytocin (OT, 100 nM) and on the in vitro development of bovine embryos. Bm-rbIFNτ and OT were shown to suppress PGF2α production in a dose-dependent manner. When in vitro produced morula stage embryos were cultured for 72 hr in modified CR1aa medium supplemented with or without rbIFNτ, Bm-rbIFNτ (10 ng/ml) significantly promoted development to the expanded blastocyst stage. In conclusion, Bm-rbIFNτ was suggested to have the same bioactivity as native IFNτ.

Pre-implantation embryo development is a critical stage, in which several development and stress-response related transcription factors (TF) are involved. Exposing embryos to environmental insults alter some of these stress response-related TF. However, their expression pattern in male and female embryos and their release via exosomes is still unclear. Here, we aimed to investigate the effect of culture-induced oxidative stress on development and expression pattern of stress-related TF in male and female embryos and in respective spent media coupled with exosomes. For this, bovine male and female zygotes were in vitro produced using sexed semen and cultured under 5% and 20% oxygen in exosome-depleted SOFaa medium (SOF with amino acids). Blastocysts were subjected to total RNA isolation followed by quantitative RT-PCR analysis of the selected TF (Nrf2, KLF4, NOTCH1, SREBF2, E2F1, CAT1, SOD1, and OCT4), as well as protein abundance analysis using immunofluorescence and related phenotypes analysis, including reactive oxygen species (ROS) level and total cell count. Furthermore, the spent embryo culture media were collected for exosomes isolation and expression analysis of candidate TF. The data were statistically analysed using one-way ANOVA followed by multiple pair-wise comparisons using the Tukey post hoc test. Results showed that the blastocyst rates of both male (29.9% v. 34.9%) and female (16.7% v. 26.5%) bovine embryos were significantly lower in 20% than in 5% oxygen level. Female blastocysts subjected to the higher oxygen level showed increased ROS level (37.66 ± 1.70 v. 45.32 ± 2.05 in male and 29.42 ± 1.44 v. 45.51 ± 2.06 in female) and significantly reduced total cell count compared with the male embryo counterpart (136.55 ± 7.8 v. 112.75 ± 2.9 in male and 138.75 ± 2.0 v. 88.25 ± 4.3 in female cultured in 5% and 20% oxygen levels, respectively). Consequently, the expression levels of Nrf2, KLF4, SREBF2, CAT1, SOD1, and OCT4 were significantly increased in male embryos exposed to oxidative stress compared with those cultured under the lower oxygen level. However, NOTCH1 and E2F1 were significantly increased in female embryos exposed to oxidative stress compared with the male counterparts. The mRNA level of SREBF2 was significantly increased in male embryos cultured under both 5% and 20% O2 compared with female embryos. The protein expression level of Nrf2 and KLF4 was higher in embryos cultured at 20% v. 5% O2 with greater Nrf2 abundance in male embryos. Consequently, the male embryos produced at 20% O2 released a higher number of exosomes enriched with Nrf2, SOD1, and NOTCH1 mRNA than the other groups. Interestingly, the exosomal mRNA expression level of E2F1 tended to be higher in female embryos exposed to oxidative stress than their male counterparts. Taken together, the male embryos were more tolerant to oxidative stress than female embryos via the activation Nrf2-mediated oxidative stress response and development related TF. The release of these TF via exosomes could enhance cellular homeostasis maintenance under oxidative stress.

Routinely, bovine oocytes are matured in medium supplemented with 10% fetal bovine serum (FBS). However, due to the undefined nature of FBS and biosafety concerns, a standardized protein supplementation alternative is needed. We hypothesised that oocytes matured in defined medium supplemented with 5% serum substitute (DM) would have higher developmental competence than those matured in FBS-supplemented medium (Control). In 6 replicates, in vitro-produced embryos were produced during the summer season by aspirating cumulus-oocyte complexes from 2- to 8-mm follicles of abattoir ovaries (LAB-COC), or aspirated from FSH-stimulated Holstein and Jersey donors (OPU-COC, n=20; 53 sessions). The LAB-COC (n=1307) and OPU-COC (n=679) were matured for 23h in control medium or DM supplemented with pyruvate and gonadotropins at 6% CO2 in air, fertilized with semen from 1 of 3 or 15 bulls, respectively, and cultured in SCF2 at 38.5°C, 6% CO2, 5% O2 and 89% N2. On Day 7.5 post-fertilization, blastocyst rates were evaluated, and embryos (n=4/replicate) from each group of LAB-COC were stained with 1µg mL−1 Nile Red for lipid quantification, 5 µM Cell Rox® Green (Thermo Fisher Scientific, Waltham, MA, USA) for reactive oxygen species (ROS) assessment and 300 nM Mitotracker Red CMX-Rosamine (Thermo Fisher Scientific) for mitochondrial polarity. Images were obtained with confocal microscopy and fluorescent intensity (AFU) was measured by Image J software (National Institutes of Health, Bethesda, MD, USA) adjusted per cell number. Data were analysed by one-way ANOVA using SAS software (SAS Institute Inc., Cary, NC, USA). Results (Table 1) indicate similar cleavage and blastocyst rates and mitochondrial polarity for embryos from LAB-COC in Control v. DM (P>0.05). However, ROS and lipid content were higher in Control than in DM (P0.05). Results suggest that maturing oocytes (LAB and OPU) in DM maintain developmental competence, and the resulting embryos had lower lipid content and ROS than those matured in Control medium. Cryopreservation studies and evaluation of pregnancy rates are ongoing. Table 1.Developmental competence of oocytes matured in control or defined medium with 5% serum substitute (DM)

In vitro-produced (IVP) embryos are more easily damaged by cryopreservation than in vivo-derived embryos. Therefore, transportation of fresh IVP embryos in a manner that can maintain viability is necessary. This study was conducted to determine the preferable culture conditions for transport of embryos at 5 days post-insemination (dpi) in 1.5-mL microtubes. Cumulus-oocyte complexes derived from an abattoir were matured and then inseminated with frozen-thawed semen. Presumptive zygotes were cultured in mCR1aa (CR1)+5% calf serum (CS) until use. In Exp. 1, embryos with 5 blastomeres at 5 dpi were randomly assigned to 1 of 3 groups: 25mM Hepes-CR1aa (H-CR1)+5% CS or 25mM Hepes-M199 (H-M199)+5% CS in air, or CR1 in 5% CO2. Embryos were cultured in microdrops overlaid with liquid paraffin in a petri dish for 48h at 38.5°C. In Exp. 2, the optimal number of embryos to culture per microtube was assessed. Presumptive zygotes were cultured in groups of 20, 40, or 80 in 1mL of CR1 covered with liquid paraffin in microtubes in an incubator at 38.5°C in 5% CO2 until 7 dpi. For Exp. 3, culture of embryos in microtubes in a portable incubator was tested. At 5 dpi, 5-cell embryos (n=17 to 36 per microtube) were statically cultured in 1mL of CR1 or H-CR1 in microtubes in a portable incubator set at 38.5°C for 48h. The CR1 was pre-equilibrated in an incubator in 5% CO2 for 24h before use. Embryos were harvested from microtubes after 48h and were then cultured in microdrops of CR1 overlaid with liquid paraffin in a petri dish in an incubator at 38.5°C in 5% CO2 until 8 dpi. In Exp. 4, embryos (n=29 to 39 five-cell embryos per microtube) were transported in a portable incubator by land for 1000km over a period of 44h using the same conditions as in Exp. 3. Control embryos were statically cultured in microdrops of CR1 in an incubator in 5% CO2. Statistical analyses were carried out by ANOVA (Exp. 1 and 2), t-test (Exp. 3), or Fisher’s exact test (Exp. 4). In Exp. 1, there was no effect (P>0.05) of culture medium on blastocyst development at 7 dpi (27.6±2.3, 25.7±7.2, and 17.3±2.9% for CR1, H-CR1, and H-M199, respectively). In Exp. 2, blastocyst development at 7 dpi was not affected (P>0.05) by the number of presumptive zygotes cultured per microtube (43.6±8.3, 42.4±4.0, and 39.9±2.9% for 20, 40, and 80 presumptive zygotes, respectively). In Exp. 3, blastocyst development at 8 dpi was not affected (P>0.05) by culture medium (60.7±7.4 and 53.1±4.4% for CR1 and H-CR1, respectively); however, the pH of CR1 changed from 7.5 to 8.1 at 48h after culture. In Exp. 4, blastocyst development at 8 dpi was not affected (P>0.05) by transport (57.1, 64.4, and 75.5% for CR1, H-CR1, and control, respectively). These results indicate that IVP embryos harvested at 5 dpi can be transported by portable incubator with no effect on embryo development to the blastocyst stage. This work was supported by grants from the Project of the Bio-oriented Technology Research Advancement Institution, NARO (the special scheme project on advanced research and the development for next-generation technology).

This study investigated the effect of bovine serum albumin (BSA), charcoal:dextran stripped fetal bovine serum (CDS FBS), and heat-inactivated FBS (HI FBS) in maturation medium on their ability to support in vitro oocyte maturation, cumulus cell-oocyte gap junctional communication, and development of bovine embryos. Charcoal:dextran treatment of FBS removes lipophilic chemicals, certain steroid hormones, and certain growth factors; however, HI FBS have a lot-to-lot variation in steroid hormones level that can affect the reproducibility of experimental findings. Oocytes were cultured in TCM-199 supplemented with either 8% (w/v) BSA, 10% (v/v) CDS FBS, or 10% (v/v) HI FBS and 1µg mL−1 oestradiol-17β, 10µg mL−1 FSH, 10ng mL−1 epidermal growth factor, 0.6mM cysteine, 0.2mM sodium pyruvate, and followed by IVF, and the zygotes were cultured in SOF-BE1 medium. The developmental ability and quality of bovine embryos were determined by assessing their cell number, lipid content, mitochondrial activity, gene expression, immunocytochemistry, and cryo-tolerance. The differences in embryo development between experimental groups were analysed by 1-way ANOVA. The Duncan’s multiple range tests were used to test the differences between the treatments. The level of statistical significance was set at P

Cryopreservation of testicular tissue (TT) allows retention of valuable genetic material that can be used for conservation of endangered species, such as the northern white rhinoceros (NWR; Ceratotherium simum cottoni). Previously, we found that cryopreservation of NWR TT with a slow controlled cooling rate (CR) method induced morphological alterations in the seminiferous tubules (ST). However, the relative influence of CR, type of medium, and condition of TT from the aged NWR male on TT integrity was not clear. Due to the limited availability of rhinoceros TT, we used the horse as a model for optimization of TT cryopreservation. We evaluated the effect of (1) cryoprotectant solution [PBS (PBS +1.5 M dimethyl sulfoxide) v. DMEM (DMEM/F12 + 10.0% fetal bovine serum + 0.05 M sucrose + 1.5 M dimethyl sulfoxide)] and (2) CR [CR1 (−2.0°C min−1 from 0°C to −4.0°C, −15°C min−1 to −12°C, and −0.3°C min−1 to −40°C in a programmable freezer) v. CR2 (same as CR1 but cooled to −8°C and held for 5 min before cooling to −40°C) v. CR3 (−1.0°C min−1 from 0°C to −80°C in a CoolCell® freezing device; Corning, Corning, NY, USA)] on the structural integrity of ST from a 2-year-old horse (n = 20 ST), cell viability, and expression of spermatogonial stem cells (SSC; GFRα1, and GRP125) and pluripotent markers (SSEA-4, SSEA-1, and OCT-4) in spermatogonial cells isolated from TT frozen with the above treatments (n = 3). We found a positive interaction between CR and cryoprotectant solution on structural integrity of fixed and stained TT after freezing in PBS and CR2 that resulted in lower detachment of epithelium cells from the basement membrane (score ± standard error of the mean; 0.50 ± 0.1) than that of TT frozen in PBS and CR1 and CR3 (1.00 ± 0.1 and 1.80 ± 0.1, respectively; P

This study aimed to investigate the effect of Kit ligand (KL), a growth factor that regulates folliculogenesis in mammalian ovaries, on growth of buffalo oocytes in early antral follicles in vitro. Cumulus-oocyte complexes were dissected from early antral follicles (1mm) of slaughtered buffaloes and cultured in Dulbecco’s minimum essential medium supplemented with fetal bovine serum, sodium pyruvate, gentamycin, hypoxanthine, dexamethasone, cysteine, polyvinylpyrolidione, l-ascorbic acid, oestradiol-17β, and androstenedione in a 96-well culture plate at 38.5°C under an atmosphere of 5% CO2 in air for 6 days. The culture medium was supplemented with 0, 50, and 100 ng/mL KL (recombinant human SCF, Cat. No. H8416, R&D Systems, Minneapolis, MN, USA). Sixty oocytes were cultured in each group with 6 replications. In vitro-grown oocytes were cultured for maturation in tissue culture medium-199 supplemented with 5% fetal bovine serum, sodium pyruvate, gentamycin, and 100 ng/mL FSH at 38.5°C for 24h under an atmosphere of 5% CO2 in air. The oocytes were then stained with aceto-orcein and examined under a differential interference contrast microscope. Data were analysed using SAS/STAT version 9.1.3 for Windows (SAS Institute Inc., Cary, NC, USA) by one-way ANOVA and means compared with Tukey’s HSD test. The mean diameter of oocytes measured at the time of seeding on the culture substrate was 100.6±0.4μm (n=180). After 6 days of culture, the diameters of oocytes increased to 110.8±0.5, 114.0±0.5, and 115.0±0.6µm in 0, 50, and 100 ng/mL KL-treated groups, respectively. The survival rates were 60.0±6, 81.2±1.2, and 92.0±4.9% in 0, 50, and 100 ng/mL KL-supplemented oocytes at Day 6. Moreover, KL pretreatment enhanced maturation of buffalo oocytes dose dependently. A small proportion of oocytes (8.4%) treated with 50 ng/mL KL reached the MII stage. This number increased to 25% when oocytes were treated with 100 ng/mL KL. These results show that KL enhances growth, viability, and meiotic progression of buffalo oocytes in vitro.

Once formed, bovine blastocysts differentiate while growing exponentially from 150-200 μm (Days 7 or 8) to 200-250 mm (Days 17 to 18; Sandra et al. 2017 Annu. Rev. Anim. Biosci. 5, 205-228). Thus, the length of the conceptus doubles every day between Days 9 and 16 (Berg et al. 2010 Theriogenology 73, 250-260); however, this was observed on whole conceptuses. The objective of the current study was to test whether this elongation rate is similar when the embryonic disc has been excised. Six heifers were used to produce Day-15 conceptuses, either fully developed in vivo or developed in vivo for a week after embryo transfer of Day 8 in vitro-produced blastocysts. Day 15 conceptuses were recovered, measured, and cut into pieces to produce trophoblastic vesicles (TV; Heyman et al. 1984 J. Reprod. Fertil. 70, 533-540) of 4 ± 0.07 or 4.4 ± 0.65 mm long (mean ± standard error of the means) for in vivo- or in vitro-produced TV, respectively. All TV were transferred into oestrus-synchronized recipients (5 heifers and 1 cow). Each female received 8-9 TV so that a total of 24 in vivo-derived and 26 in vitro-produced TV were transferred in utero for a period of 3 days. The TV originating from different Day-15 conceptuses were mixed at the time of transfer, so that each recipient received the TV from different origins (conceptus and donor cow). Transcervical collection was used at Day 15 and 18 for conceptus and TV recovery (Richard et al. 2015 Theriogenology 83, 1101-1109). At Day 18, TV elongation size was analysed (mean ± standard error of the means) by unpaired t-test using GraphPad Prism software (GraphPad Inc., San Diego, CA, USA). At Day 15, conceptuses from the in vivo and in vitro groups displayed different sizes and length variabilities (24-32 v. 2-24 mm, respectively). At Day 18, TV recovery rate was 79% for the in vivo- v. 62% for the in vitro-derived group and mean elongation rate (over 3 days) was ×5.4 (minimum = 2.5, maximum = 10) v. ×7.6 (minimum = 0.7, maximum = 20.5), respectively. There was no significant difference for TV size between groups at Day 18 (21.75 ± 2.24 mm v. 33.38 ± 11.63 mm, respectively). Altogether, the variability in length at Day 15 was previously reported, the difference in TV recovery between in vivo and in vitro groups reached 17% and was similar to the loss of 11% that occurs in the first week after classical embryo transfer. In opposition to studies where in vitro-produced conceptuses were shorter than in vivo-developed ones, in vivo and in vitro groups of TV likely followed similar growth. Whether this reflects a normal growth awaits further studies.

The aims of this study were to decrease the apoptotic index and increase cryotolerance of bovine embryos produced in vitro with the addition of 1 µM docosahexaenoic acid (DHA). On Day 1, presumed zygotes were cultivated with 1µM DHA (Sigma, St. Louis, MO, USA; n=437), and without the agonist (control group; n=450). The cleavage rate (%) was evaluated on Day 2 and the development of blastocysts on Day 7. Embryos before and after vitrification were fixed for the TUNEL trial. After vitrification, the embryos were heated and re-cultivated to evaluate the hatching rate at 12, 24, 36, 48, 60, and 72h. A sample of re-cultivated embryos at 12h of DHA (n=5), and without the agonist (control group; n=6), was frozen for mass spectrometry (MALDI-MS). Statistical analyses of deviance were carried out considering generalized mixed linear models, and the effect of the collection day (block) was considered as random. For the count variables, the Poisson distribution and the log link function were considered. In the cases of variables represented by rates, binomial distribution and the logit link function were used. In the study of cryotolerance, ANOVA of the hatching rate for each one of the times evaluated was carried out. In cases of significance of the effect of treatments, the Dunnett test was applied to compare treatments. Multivariate and univariate statistical models were used for analysis of MALDI-MS. All analyses were made using the GLIMMIX procedure of the SAS software (SAS Institute Inc., Cary, NC, USA). The cleavage rate was not different between the groups (P>0.05) and the production of blastocysts was lower in the DHA group (P0.05) compared with the control group. Phosphatidylcholine [phosphatidylcholine (32: 0)+H] was more abundant (P