Search

Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

HTLV-1 Tax oncoprotein exerts pleiotropic effects on cellular regulatory systems, trans-activation and trans-repression of transcription and promotion of the cell cycle, through interaction with various cellular factors. Here, we report Tax-mediated inhibition of DNA topoisomerase I. The interaction of Tax with topoisomerase I was demonstrated in vitro and also in vivo, and inhibition of DNA relaxation activity of topoisomerase I was clearly shown. These results suggested that Tax has a novel potential to affect various cellular processes, such as transcription and maintenance of genomic stability, in which DNA topoisomerase I is involved.

TREB5/hXBP-1/HTF is a basic region leucine zipper protein which binds to a cyclic AMP responsive element (CRE)-like element in both human T-cell leukemia virus type 1 and human major histocompatibility complex (MHC) class II genes. To analyze the structure and transcription regulation of the TREB5 gene, we isolated the mouse TREB5 gene and cDNA. The mouse TREB5 gene contains five exons and four introns and spans approximately 5 kb. The deduced amino acid sequence of mouse TREB5 exhibited 77% and 94% homology to human and rat TREB5, respectively. The b-zip structure is completely conserved in mouse, rat and human. Southern blot analysis of the mouse genomic DNA demonstrated that positive bands exactly coincide with those expected from sequences of the cloned genes, indicating that the mouse TREB5 gene is present as a single copy. The transcription start site of the mouse TREB5 gene was mapped to -15 bp upstream from the ATG initiation codon. Promoter analysis of serial deletion mutants revealed that the -142 bp upstream region is the minimum sequence to promote mouse TREB5 gene expression and that the -1.0 kb upstream region is required for full promoter activity.

HTLV-1 Tax oncoprotein interacts with various cellular factors and modulates transcription and the cell cycle. To identify more cellular targets, we employed the yeast two hybrid system with Tax using a human cDNA library, and isolated a cDNA encoding the human counterpart of Drosophila discs large tumor suppressor protein, hDLG. Tax binding to hDLG was confirmed in vitro and also in HTLV-1-infected T-cells. Furthermore, hDLG was found to be efficiently phosphorylated in Tax-transfected cells and HTLV-1-infected T-cells. The C-terminus of Tax and the PDZ domain of hDLG were responsible for the binding of Tax to hDLG. The C-terminal peptide of Tax prevented the binding of hDLG to APC tumor suppressor gene product, suggesting inhibition of hDLG function by Tax. Over-expression of hDLG in NIH3T3 cells by microinjection induced a reduction of BrdU incorporation into DNA, but co-expression of Tax suppressed this inhibitory effect of hDLG. These results suggest that hDLG arrested the cell cycle and that Tax canceled this inhibitory action of hDLG through targeting hDLG. Therefore, Tax affects this novel regulatory pathway of the cell cycle alteration, of which seems to play a role in the development of human cancer.

Tax protein of human T-cell leukemia virus type 1 (HTLV-1) is a potent transcriptional regulator which can activate or repress specific cellular genes and has been proposed to contribute to leukemogenic processes in adult T-cell leukemia. The molecular mechanism of Tax-mediated trans-activation has been well investigated. However, trans-repression by Tax remains to be studied in detail, although it is known to require a specific DNA element such as E-box or p53 binding site. Examining possible mechanisms of trans-repression, we found that co-expression of E47 and p300 activated E-box dependent transcription and this activation was efficiently repressed by Tax. In this system, Tax bound to p300 and decreased the level of p300 complexed on the E-box element. Similarly, Tax inhibited transcription directed by p53 and CBP, reducing the level of CBP on the p53 binding site. These results indicate that Tax interferes with recruitment of CBP/p300 into protein complexes on E-box and p53 binding site through its binding to CBP/p300. In contrast to these findings, we observed that Tax increased the level of CBP on the viral 21-bp enhancer which is trans-activated by Tax. From these observations, we propose a universal mechanism for Tax-mediated trans-repression and trans-activation of transcription in which Tax binds to CBP/p300 and determines the accessibility of CBP/p300 to protein complexes on specific DNA element.

Tax protein of human T-cell leukemia virus type 1 (HTLV-1) is a potent trans-activator of specific sets of target genes, and on the other hand, it is a trans-repressor of other sets of genes. It is also an inhibitor of the tumor suppressor protein p16 INK4a and thus has been thought to contribute to induction of adult T-cell leukemia (ATL). We examined the mutagenic effects of Tax on a cellular gene, hypoxanthine guanine phosphoribosyltransferase ( hprt ), and LacI gene in lambda shuttle vector exogenously integrated in Big Blue Rat-2 (BBRat-2) cells. Expression of Tax in BBRat-2 cells enhanced the frequency of HPRT (−) phenotype severalfold. Tax-expressing cell clones, BBTax-1 and -2 established from BBRat-2 cells, gave rise to an average mutation frequency of 5.9 × 10 −5 in LacI gene, but Tax-negative cell clones, BBRat-C1 and -C2, showed 2.1 × 10 −5 . The 2.8-fold increase in mutation frequency in the presence of Tax indicates that Tax expression enhanced mutation frequency in chromosomal DNA. However, neither the mutation spectrum of base transitions, transversions, and deletions/insertions nor the loci of the mutations were significantly affected by Tax expression. These findings indicate that Tax has the capability to induce random mutations and suggest that Tax would be able to modulate cellular phenotypes through mutation of the cellular genome.

We have isolated a novel cDNA clone encoding interferon (IFN) consensus sequence-binding protein in adult T-cell leukemia cell line or activated T cells (ICSAT); this protein is the human homolog of the recently cloned Pip/LSIRF. ICSAT is structurally most closely related to the previously cloned ICSBP, a member of the IFN regulatory factor (IRF) family of proteins that binds to interferon consensus sequences (ICSs) found in many promoters of the IFN-regulated genes. Among T-cell lines investigated, ICSAT was abundantly expressed in human T-cell leukemia virus type 1 (HTLV-1)-infected T cells. When the HTLV-1 tax gene was expressed or phorbol myristake acetate-A23187 stimulation was used, ICSAT expression was induced in Jurkat cells which otherwise do not express ICSAT. When the binding of ICSAT to four different ICSs was tested, the relative differences in binding affinities for those ICSs were determined. To study the functional role of ICSAT, we performed cotransfection experiments with the human embryonal carcinoma cell line N-Tera2. ICSAT was demonstrated to possess repressive function over the gene activation induced by IFN stimulation or by IRF-1 cotransfection. Such repressive function is similar to that seen in IRF-2 or ICSBP. However, we have found that ICSAT has a different repressive effect from that of IRF-2 or ICSBP in some IFN-responsive reporter constructs. These results suggest that a novel mechanism of gene regulation by "differential repression" is used by multiple members of repressor proteins with different repressive effects on the IFN-responsive genes.

Tax protein of HTLV-1 triggers transcriptional activation through enhancers, NF-kappa B binding site, 21-bp enhancer, and serum response element. Previously, we demonstrated binding of Tax to transcription factors NF-kappa B1 p105 and p50. Here, we report that Tax enhances expression of NF-kappa B2 at the mRNA level and proteins; the effect was more apparent on the p52 expression than on its precursor p100, suggesting post-translational regulation. Consistent with these observations, HTLV-1-infected T-cell lines expressed higher levels of p52. Tax binds to the protein products p52 and p100 which inhibits NF-kappa B proteins forming cytoplasmic complexes; the binding to p100 was preferential over NF-kappa B1 p105. However, Tax did not induce efficient dissociation of the cytoplasmic complexes p100/c-Rel or p100/p65, and thus did not induce nuclear translocation of c-Rel or p65. This was in sharp contrast to the previous observation that Tax dissociated the p105/c-Rel and I kappa B-gamma/p65 complexes. These results indicate that HTLV-1 Tax interacts with NF-kappa B2 p100 and p52 and upregulate the NF-kappa B function, but their contribution to Tax-mediated transcriptional regulation differs from those of NF-kappa B1.

The cyclic AMP-response element (CRE), a transcriptional enhancer, is regulated by CREB (CRE-binding protein) which is the leucine zipper protein phosphorylated by protein kinase A in response to cAMP signal. The highly homologous protein CREM (CRE-modulator) is thought to modulate CREB-stimulated transcription, and is also involved in transcriptional control during spermatogenesis. In this paper, we report two types of cDNAs of human CREM (hCREM), type 1 and type 2; type 1 is a group of human counterparts of the mouse CREM alpha and type 2 is a novel form having a distinct 5' exon which is unrelated to any species of the CREB and CREM isoforms so far described. This unique 5' region of type 2 hCREM may suggest its independent expression from type 1 CREM. The specific 5' region of type 2 hCREM consisted of 88 bp, containing an initiation codon for translation, but no possible phosphorylation site, suggesting different roles from type 1 CREM. Both type 1 and 2 hCREMs are expressed in lymphoid and non-lymphoid cell lines. Their excess expression by transfection induced suppression of cAMP-mediated activation of transcription, suggesting their negative regulation of CRE-mediated transcription.

Deletion mutants in the 5′ upstream sequence of the human CYP21A2 gene demonstrated a novel regulatory DNA element responsible for cAMP-dependent expression of the gene in the transient expression system using Y-1 cells (mouse adrenocortical tumor cell line). This regulatory element (-2574 to -2489 bp) was also found to exhibit a strong enhancer activity through heterologous promoters in response to cAMP and to contain a sequence like the cAMP-responsive element (CRE) and a CAAT-like sequence. The CRE-like sequence has a five-base motif (5′-TGACG-3′) of the palindromic CRE consensus (TGACGTCA). Competitive gel mobility shift assays using nuclear extracts of bovine adrenal cortex with sequences typical of the binding sites for the binding proteins of CRE and the CAAT-like sequence revealed that these binding proteins, or related factors, bound to their cognate DNA binding sites in the upstream enhancer region of the CYP21A2 gene. These two enhancer elements and their cognate binding factors cooperate with previously identified tissue-specific enhancers (adrenal-specific protein factor and Ad4-like sequences) and their binding factors to express a high level of cAMP-responsive expression of the CYP21A2 gene.

The trans-activator protein Tax of human T-cell leukemia virus type 1 (HTLV-1) activates the viral 21-base-pair (bp) enhancer in the long terminal repeat and has been suggested to associate indirectly with the enhancer DNA. To demonstrate this, we used DNA-affinity precipitation assay and detected the Tax protein in 21-bp DNA-protein complexes isolated from HTLV-1-infected cells. To identify cellular components in the complexes, we tested various 21-bp DNA-binding proteins by gel electrophoretic mobility-shift assay. Each binding protein gave a shifted band of each 21-bp DNA-protein complex, and exogenously added Tax protein further shifted these bands of cAMP-responsive element (CRE) binding protein (CREB) and CRE modulator but did not shift other bands. Anti-Tax antibodies blocked formation of the complex, indicating complex formations of [Tax-CREB(or CRE modulator)-21-bp DNA]. The formations of these complexes paralleled the functional activities of Tax mutants. Furthermore, the Tax-CREB complex was detected in a nuclear extract of HTLV-1-infected cells, and the Tax-CREB-21-bp-DNA complex was demonstrated as a major component of Tax complexes containing the 21-bp DNA probe. These observations indicate that Tax protein binds to CREB and CRE modulator and the complexes then bind to the 21-bp enhancer, suggesting that the complex binding to the enhancer mediates trans-activation of transcription.

The human IL-3 gene, located on chromosome 5, contains several cis-acting DNA sequences, i.e. CLE (conserved lymphokine element) and a GC-rich region, similar to the GM-CSF gene. To investigate the role of these elements, the 5' flanking region of the IL-3 gene was attached to a bacterial chloramphenicol acetyltransferase (CAT) gene. The fusion plasmids were analyzed by an in vitro transcription system using Jurkat cell nuclear extract prepared from cells stimulated with phorbol-12-myristate-13-acetate and calcium ionophore (PMA/A23187), introduced into Jurkat cells, expressed transiently, and stimulated by co-transfection of human T cell leukemia virus type I (HTLV-I) encoded transactivator, p40tax. The GC-rich region enhanced TATA-dependent transcription in the in vitro transcription system and also strongly responded to p40tax stimulation in the in vivo cotransfection assay. Using this GC-rich region as a probe, we identified a constitutive DNA-protein complex, alpha, whose binding specificity correlates with transcription activity. However, this element is not sufficient for the expression of the IL-3 gene in response to T cell activation signals (PMA/A23187) and no sequence was found within the IL-3 gene which mediates the response to PMA/A23187. The enhancer sequence which responds to T cell activation signals may be located outside the IL-3 gene and may be shared by other lymphokines, possibly by GM-CSF. We propose that the GM-CSF enhancer (CLE2/GC box) which mediates the response to T cell activation signals may stimulate the expression of the IL-3 gene.

The long terminal repeat (LTR) of HTLV-1 consists of U3-R-U5 and contains elements which regulate the viral gene expression. In addition to these elements, we found that the U5 sequence contained a repressive element in the gene expression. Sequential deletions of the LTR substantially increased CAT expression of a LTR-CAT construct. The repressive effect was also observed at RNA level on unspliced RNA, but not on spliced RNA. These differential effects suggest that the U5 element is a cis-acting RNA element, since splicing within the R segment removed the U5 element. In the context of HTLV-1 gene expression, the U5 element would repress expression of unspliced genomic RNA of HTLV-1, but not subgenomic RNA.

I briefly review the discovery and characterization of the first human retrovirus, human T-cell leukemia virus type 1, focusing on contributions from Japanese researchers. The unique regulatory mechanisms for the viral regulation with Tax and Rex, etiology of ATL and possible leukemogenic mechanism with Tax are also discussed briefly.

TREB5 (hXBP-1) is a basic region leucine zipper protein which binds to a CRE-like element in both human T-cell leukemia virus type 1 and MHC class II genes. To study the function(s) of TREB5 in normal development, we have generated TREB5 deficient mice by gene targeting. Heterozygous mutant mice have not exhibited any obvious abnormalities; however, homozygous mutant embryos die between embryonic days 10.5 and 14.5. The major defect responsible for lethality is cellular necrosis of cardiac myocytes located at the atrium and the truncus arteriosus with its following ventricle. Necrotic alteration was not observed in either the endocardial cushion or the conotruncal ridge. These results indicate that TREB5 plays an essential role in maintenance and/or growth of cardiac myocytes during cardiogenesis.

The long terminal repeat (LTR) of human T-cell leukemia virus type 1 (HTLV-1) has two distinct DNA elements, one copy of TRE2S and three copies of a 21-bp sequence that respond to the viral trans -activator protein, Tax. Either multiple copies of the 21-bp sequence or a combination of one copy each of TRE2S and 21-bp sequence is required for efficient trans activation by Tax. In the trans activation of multiple copies of 21-bp sequence, CREB/ATF protein plays an essential role in forming a complex with Tax. To understand the role of TRE2S in trans activation of one copy of 21-bp sequence, we examined protein binding to the DNA elements by DNA affinity precipitation assay including Gli2 protein binding to TRE2S and CREB protein binding to 21-bp sequence. Binding of CREB to a DNA probe containing both elements, TRE2S-21bp probe, was dependent on Gli2 protein under restricted conditions and was enhanced in a dose-dependent fashion by the binding of Gli2 protein to the same probe. Mutation in either element abolished the efficient binding of CREB. A glutathione S -transferase fusion protein of a fragment of Gli2 was able to bind to CREB. Therefore, Gli2-CREB interaction on the DNA probe is proposed to stabilize CREB binding to DNA. Tax can bind to CREB protein on the DNA; therefore, stabilization of DNA binding of CREB results in more recruitment of Tax onto DNA. Conversely, Tax increased the DNA binding of CREB, although it had almost no effect on the binding of Gli2. These results suggest that Gli2 binds to the DNA element and interacts with CREB, resulting in more recruitment of Tax, which in turn stabilizes DNA binding of CREB. Similar cooperation of the protein binding to TRE2S-21bp probe was also observed in nuclear extract of an HTLV-1-infected T-cell line. Consistent with the Gli2-CREB interaction on the DNA elements, Tax-mediated trans activation was dependent on the size of the spacer between TRE2S and 21-bp sequence. The effective sizes of the spacer suggest that TRE2S in the LTR would cooperate with the second and third copies of the 21-bp sequence and contribute to trans activation of the viral gene transcription.

The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity.

TREB5 (hXBP-1) protein is a transcription factor that recognizes the CRE-like element in enhancers of human T-cell leukemia virus and MHC class II gene and activates their transcription. TREB5 is a member of the CREB/ATF family, containing a basic amino acid region and leucine zipper structure (b-Zip structure). To characterize the key domain of TREB5 for transcriptional activation, mutational analysis was carried out. The C-terminal region of 148-221 amino acids was identified as an activation domain and was also active when fused to Gal4 DNA binding domain. This domain contains three unique regions rich in glutamic acid, glutamine, or serine/threonine and is active in both osteosarcoma (HOS) and T (Jurkat) cell lines. All of these three regions are essential; however, a part of the serine/threonine region was dispensable in Jurkat, but not in HOS cells. In addition to the activation domain, the N-terminal region showed activity in conjunction with the b-Zip structure, but not with the Gal4 DNA binding domain. Furthermore, this region showed activity in Jurkat cells, but not in HOS cells. These results suggest that TREB5 has two activational functions in transcription and may provide diversity in cell-type-specific transcriptional activation, possibly through dimerization with other b-Zip proteins and phosphorylation.

Human T-cell leukemia virus type I causes adult T-cell leukemia and tropical spastic paraparesis, and its regulator protein Tax has been implicated in the pathogenic activity of human T-cell leukemia virus type I. Tax activates transcription of viral and cellular genes through specific enhancers: the 21-bp enhancer of human T-cell leukemia virus type I, the nuclear factor kappa B (NF-kappa B)-binding site of the interleukin 2 receptor alpha gene, and the serum-responsive element of c-fos. Tax binds to enhancer-binding proteins including cAMP-responsive element-binding protein, cAMP-responsive element modulator, transcription factor NF-kappa B p50 and p67SRF, and associates with each enhancer DNA indirectly. In addition to this mechanism, we report here that Tax binds to inhibitory factor kappa B gamma (I-kappa B) gamma, which forms a complex with NF-kappa B protein heterodimer p50-p65 or homodimer p50-p50 and retains them in the cytoplasm. Tax binding to I-kappa B gamma induces nuclear translocation of NF-kappa B p65. In association with this nuclear translocation of p65, transcription directed by the kappa B enhancer is strongly activated. Tax binds to the ankyrin motifs of I-kappa B gamma, suggesting its possible interaction with many other proteins carrying ankyrin motifs contributing to various regulatory processes. This is a different mechanism of transcriptional activation by the oncoprotein Tax and seems to be independent from the trans-activation through indirect binding to enhancer DNAs.

The wild-type p53 protein suppresses transformation, but certain missense mutants of p53 can transform cells. Although the wild-type p53 protein contains a transcriptional activation domain, no p53-responsive element has been identified. Here, we identified the p53-responsive element within the Tax-responsive element [21-base-pair (bp) enhancer] of human T-cell leukemia virus type I. Mutation analysis of the 21-bp enhancer indicated that the 16-bp sequence containing the cAMP-responsive element and its surrounding sequence was responsible for p53-induced transactivation. This 16-bp sequence was demonstrated to bind specifically to wild-type human p53 protein in vitro. Using a series of deletion mutants of p53, we showed that almost the entire region of p53 is needed for the transactivating capacity. Furthermore, the transforming mutants of p53 were unable to act as transcriptional activators. The p53-responsive element identified here should be useful to analyze the mechanism by which p53 regulates expression of a set of genes with a negative effect on cellular growth.

The kappa B sequence (GGGACTTTCC) binds a factor, NF-kappa B, that is constitutively found in its functional, DNA binding form only in B lymphocytes. A factor with apparently indistinguishable sequence specificity can be induced in many other cell types, where it is used to regulate inducible gene expression. For example, kappa B-related sequences have been shown to be important for the transcription of a few inducible genes, such as the interleukin 2 receptor alpha-chain gene and the beta-interferon gene. However, these genes are not constitutively active in B lymphocytes, suggesting that other regulatory mechanisms must play a role in determining the patterns of expression. We have investigated the constitutive and inducible transcriptional activity mediated by five kappa B-related sequence elements in two different cell types. We show that in S194 plasma cells the activity of each element correlates well with the relative affinity of B-cell-derived NF-kappa B for that element. This leads to significantly lower transcription enhancement by sites derived from the interleukin 2 receptor or T-cell receptor genes in S194 cells. However, in either EL-4 (T) cells or S194 cells, both lower-affinity sites can be significantly induced by the tax gene product of human T-cell leukemia virus type I, showing that NF-kappa B activity can be modulated even in a B-cell line that constitutively expresses this factor.

Rex protein of human T-cell leukemia virus type 1 (HTLV-1) induces cytoplasmic expression of unspliced gag/pol mRNA and singly spliced env mRNA and thus is essential for replication of the virus. This regulation requires a cis-acting rex-responsive element (RXE), located in the 3' region of the viral RNA. By external deletion, we have identified RXE composed of 205 nucleotides. The secondary structure of RXE was confirmed by studies on its susceptibility to nuclease digestions to consist of four stem-loops and a long stretch of stem structure. Substitution and deletion mutations revealed that two regions of the stem-loops and their secondary structures are essential for rex regulation. Similar secondary structures were found in the corresponding regions of HTLV-2, bovine leukemia virus and human immunodeficiency virus. Furthermore, a sequence of 11 nucleotides in the RXE was found to be conserved in the secondary structures of HTLV-1, HTLV-2, and bovine leukemia virus. These observations suggest that the secondary structure as well as the conserved sequence may be important in expression of unspliced RNA even with diverged sequences as observed in these viruses.

The pX gene of human T-cell leukemia virus type I (HTLV-I) encodes a protein that activates the expression of viral genes in trans. Plasmid constructs designed to express the pX gene under the control of either the temperature-inducible lambda PL promoter or the trp promoter were used to transform several Escherichia coli strains, including murein-lipoprotein and Ion mutant strains. Upon induction it was possible to detect the synthesis of a new polypeptide of approximately 40 kDa which reacted specifically with serum from an ATL patient.

Human T-cell leukemia virus type 1 (HTLV-1) has two trans-acting regulator genes, tax and rex, in the pX region. The tax gene is a trans-acting transcriptional activator of the long terminal repeat (LTR) and also of the cellular gene for IL-2Rα. The latter seems to explain initiation of abnormal growth of HTLV-1 infected cells. The rex gene is a posttranscriptional regulator accumulating gag and env mRNA and also indirectly suppressing the transcription. The regulation requires two cis-acting elements, the LTR sequence at the 3′ terminus and 5′ splice signal, suggesting a novel mechanism of RNA processing in the nucleus. These two trans-activator genes are essential for efficient replication of HTLV-1 and also explain its poor replication competence and tendency to be latent in vivo.Key words: HTLV-1, trans-activation, posttranscriptional regulation, RNA splicing.

We developed a novel promoter system, designated SR alpha, which is composed of the simian virus 40 (SV40) early promoter and the R segment and part of the U5 sequence (R-U5') of the long terminal repeat of human T-cell leukemia virus type 1. The R-U5' sequence stimulated chloramphenicol acetyltransferase (CAT) gene expression only when placed immediately downstream of the SV40 early promoter in the sense orientation. The SR alpha expression system was 1 or 2 orders of magnitude more active than the SV40 early promoter in a wide variety of cell types, including fibroblasts and lymphoid cells, and was capable of promoting a high level of expression of various lymphokine cDNAs. These features of the SR alpha promoter were incorporated into the pcD-cDNA expression cloning vector originally developed by Okayama and Berg.

The transcriptional enhancer sequence has recently been demonstrated in the hepatitis B viral genome. This enhancer sequence has also been shown to increase the activity of HBcAg gene promoter. Using the chloramphenicol acetyltransferase gene expression system, we demonstrated that the intrinsic promoter activity of HBsAg gene promoter was stronger than that of HBcAg gene promoter in both human hepatoma cell lines, Hep3B and HuH-7. Furthermore, we showed that the HBV enhancer sequence not only stimulated the HBcAg gene promoter activity, but also stimulated the HBsAg gene promoter activity in both Hep3B and HuH-7 cells. The enhancer sequence increased the HBsAg gene promoter activity 20-fold in both Hep3B and HuH-7 cell lines, while the increase of the HBcAg gene promoter was 2- and 8-fold in Hep3B and HuH-7 cells, respectively.

The pX sequence of human T-cell leukemia virus type I codes for three products: p40x, p27x-III, and p21x-III. p40x is a transcriptional trans-activator that activates not only the viral long terminal repeat but also cellular genes for interleukin 2 and its receptor. p27x-III and p21x-III are not required for transcriptional activation, and their functions were unknown. Cotransfection experiments with defective human T-cell leukemia virus type I proviruses and various pX expression plasmids revealed that p27x-III, in addition to p40x, was required for gag gene expression. Furthermore, it was shown that p27x-III induced accumulation of a high level of unspliced viral gag mRNA. These results indicate that p27x-III is a post-transcriptional modulator of viral RNA whose transcription has been fully activated by p40x.

RNA of avian erythroblastosis virus (AEV) pseudotyped with RAV-1, AEV(RAV-1), and its fragments containing poly(A) were translated in an mRNA-dependent reticulocyte lysate. p74 and 46 were found to be AEV RNA specific out of several main products, pr76, p74, p46, and p37. p74 was translated from 30 S AEV RNA and contained some peptides homologous to pr76, but most peptides as specific. On the other hand p46 was translated from 20 S AEV RNA containing poly(A). However, no relation to known viral proteins was established. This preliminary observation suggests that the 5′-half of AEV genome encodes p74 and the 3′-half p46.

The Y73 strain of avian sarcoma virus recently isolated in Japan is defective in replication and is associated with subgroup A leukosis virus (YAV). The virus caused sarcoma but not acute leukosis when inoculated into chickens. Studies on the viral RNA showed that a 26S RNA, etimated to be 4.8 kilobases long, was Y73 viral RNA carrying a transforming gene. The 26S RNA has sequences in common with the RNA of an avian leukosis virus but no homology with the src gene sequence of avian sarcoma virus (ASV). Thus, Y73 has a unique sarcoma-inducing gene. A phosphorylated polyprotein of 90,000 daltons (p90) was immunoprecipitated from extracts of Y73-transformed chicken embryo cells by a variety of antisera reacting with gag gene products. When a bacteria-bound immunocomplex containing the p90 protein was incubated with [gamma-32P]ATP, the Y73-specific p90 and the IgG heavy chain were phosphorylated by a p90-associated protein kinase. The amino acid phosphorylated in vitro was exclusively tyrosine in both cases, whereas p90 phosphorylated in vivo contained phosphoserine as a major phospho amino acid with traces of phosphotyrosine and phosphothreoine.

Human T-cell leukemia virus type I (HTLV-I) is an etiological agent of adult T-cell leukemia and has a unique sequence, pX, that contains four possible open reading frames, I-IV. p40x was previously identified as the gene product of frame IV (x-lor) and was suggested to mediate transcriptional trans-activation of the viral long terminal repeats. We have identified two pX gene products, p27x-III and p21x-III, encoded by frame III, which mostly overlapped frame IV. These proteins were detected with rabbit antiserum against the synthetic peptide predicted from the 3' end of frame III. p27x-III is phosphorylated in cultured cells, and the phosphoprotein (pp27x-III) is localized in nuclei; some pp27x-III was tightly bound to nuclear components. p27x-III was detected in a number of cell lines that express other viral antigens, including a cell line previously reported to express only p40x as a viral protein. The function(s) of p27x-III and p21x-III is not known, but the tight binding of pp27x-III to nuclear components suggests that it is associated with regulation of viral gene expression.

Summary A glycoprotein with an approx. mol. wt. of 55000, encoded by spleen focus-forming virus (SFFV), was detected with an antiserum against xenotropic murine leukaemia virus (MuLV) in various cell lines infected with the Friend strain of SFFV, suggesting that the SFFV-specific RNA coding for gp55 is related to the xenotropic virus. The proteins from three cell lines differed from each other in molecular size and gave different peptide maps. The differences in the gp55 molecules were shown to depend on differences in the SFFV genome, but not on differences in glycosylation or processing of the precursor polypeptides of gp55 in the different cells. These results indicate virus strain specificity of SFFV in gp55 formation.

The gag gene of human T cell leukemia virus type I (HTLV-I) was fused to a lac’Z segment and fused proteins with gag-β-galactosidase were efficiently expressed under the control of the tryptophan promoter in Escherichia coli. It was found that not only the sequence around the initiation codon, but also the 3′-part of the gag gene segment greatly affected the efficiency of expression for these hybrid proteins. Modifying both the 5′ and 3′ regions, high level expressions of two forms of gag antigens have been achieved.

Chick embryo fibroblasts transformed by avian sarcoma viruses, B77, the Prague strain of Rous sarcoma virus (PR-RSV), and the Schmidt-Ruppin strain of RSV (SR-RSV) had lower activity of adenylate cyclase, but the same activity of cyclic AMP phosphodiesterase as control cells. The cells infected with their temperature-sensitive mutants in the transforming capacity also had reduced cyclase activity when grown at 36°, but normal activity when grown at 41°, showing a close correlation between viral transformation and cellular adenylate cyclase activity. The characteristics, Km value for ATP, Mg 2+ ion dependency, and sensitivity to NaF, of the adenylate cyclase activity reduced by viral transformation varied with the viral strain. It was concluded that the changes of the enzyme activity on transformation were specific to the virus strain used and were not related to the subgroup of virus.

A provirus clone of simian T-cell leukemia virus isolated from a pigtailed monkey (PT-STLV), which is 90% homologous to HTLV-I, was shown to be biologically active in transfection assay. In transfected cells, gp61env, Pr55gag, and the mature gag proteins p24, p21, and p15 were detected, and type C particles were produced. The virus could be transmitted from the transfectants to recipient cells by cocultivation. In this biologically active provirus clone, a coding frame, possibly for protease, was identified between the gag and pol genes. The corrected sequence of the protease region of HTLV-I was also found to have a single open reading frame overlapping the gag and pol genes, although it has an amber codon in the middle of the frame. Thus, a single coding frame, which is different from those of gag and pol, is common to proteases of the HTLV family including HTLV-I.

A retrovirus (ATLV) was unequivocally demonstrated in human adult T-cell leukemia (ATL) cell lines by density (1.152-1.155 g/cm3) in a sucrose gradient, reverse transcriptase activity insensitive to actinomycin D, RNA labeled with [3H]uridine, and specific proteins with molecular weights of 11,000, 14,000, 17,000, 24,000, and 45,000. Furthermore, cDNA prepared by endogenous reaction with detergent-treated virions hybridized to 35S RNA containing poly(A), which was inducible by IdUrd treatment of a T-cell line derived from leukemic cells of the ATL, and the integrated form of ATLV proviral DNA was detected in T-cell lines derived from ATL. The ATLV proviral DNA was also detected in fresh peripheral lymphocytes from all five patients with ATL tested so far but not in those from healthy adults. On the other hand, ATLV protein of Mr 42,000 was found to be at least one of the ATL-associated antigen(s) that were previously detected in ATL-leukemic cells by all sera from patients with ATL. These findings on the close association of ATLV protein and proviral DNA with ATL are direct evidence for the possible involvement of the retrovirus ATLV in leukemogenesis of human ATL.

A mutant of the Prague strain of Rous sarcoma virus (RSV) has two deletions near the 5′-terminus of its src gene. The mutant (dl 5) induced fusiform morphological transformation in chick embryo fibroblasts (CEF) in contrast to the round type morphological transformation induced by wild type (wt) RSV. The partially deleted src of dl 5 was shown to code for a 52K protein which has tyrosine kinase activity as high as that of p60src In dl 5-transformed cells, a 36K protein was heavily phosphorylated, while two proteins (MW = 55K and 57K) were dephosphorylated to the same extent as compared with cells transformed by wt RSV. The relative abundance of phosphotyrosine in vinculin was almost the same in both dl 5- and wt RSV-transformed cells after extended passage of dl 5-transformed cells without marked changes in their morphology. On the other hand, the amounts of vinculin and fibronectin in dl 5-transformed cells were twice those in wt RSV-transformed cells, although less than the amounts in uninfected cells. These results suggest that events leading to cellular morphological transformation are neither directly correlated with phosphorylation of the 36K protein, with dephosphorylation of the 55K and 57K proteins, nor with the level of phosphorylation of tyrosine residues in vinculin, but rather are correlated with the amount of vinculin and fibronectin.

A rapid approach for detecting tentative membrane proteins which are transiently phosphorylated/dephosphorylated is described. Cell fractionation is unnecessary, as are other manipulations of sample preparation during which artifactual modifications or sample loss might occur. The method is shown to be useful for the detection of such phosphorylation during cellular response to the binding of specific ligand. Two-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis was performed successively through gels of different sieving sizes. These "primary" gels were then subjected to "detergent blotting," a variation of electroblotting in which polyacrylamide gel containing the nonionic detergent Nonidet-P40 (secondary gel) was inserted between the primary gel and a Zeta-Probe membrane. Phosphorylated interleukin 2 receptors were selectively retained in the secondary gel. Upon stimulation of human platelets with thrombin, at least 11 polypeptides were found to be rapidly phosphorylated/dephosphorylated using the method. Among them, five phosphorylated polypeptides were trapped in the secondary gel, suggesting that they might be membrane proteins. This technique should be useful to rapidly screen transiently phosphorylated/dephosphorylated membrane proteins which might be involved in membrane transductional signaling.

Promoter function for gene expression of the long terminal repeat (LTR) of human T-cell leukemia virus type I (HTLV-I) was studied by constructing plasmids containing the LTR sequence. The gene encoding chloramphenicol acetyltransferase (CATase) was linked to an HTLV-I LTR sequence (pLTR-CAT) by replacing the simian virus 40 promoter in plasmid pSV2-CAT with the LTR sequence. The transient CATase activities of cells transfected with the plasmids were compared. The results are summarized as follows: The HTLV LTR was active even in an epithelial cell line, with efficiency similar to that of the simian virus 40 promoter. pLTR-CAT expressed high CATase activity, 40-200 times that expressed by pSV2-CAT, in HTLV-I-infected T-cell lines, such as the human cell lines MT-2 and HUT-102, or in HTLV-I-infected rat cell lines. This enhanced activity of the LTR seems to be associated with HTLV gene expression, since only low activity of pLTR-CAT was observed in the HTLV-infected cell line MT-1, in which only a small percent of cells express viral antigens. In HTLV-infected rat cell lines, the pX-encoded protein p40x was the only viral protein detected. Thus, we suggest that p40x is the factor associated directly or indirectly with the enhanced activity of the LTR.

The pX sequence of human T-cell leukemia virus type I codes for two nuclear proteins, p40tax and p27rex, and a cytoplasmic protein, p21x-III.p40tax activates transcription from the long terminal repeat (LTR), whereas p27rex modulates posttranscriptional processing to accumulate gag and env mRNAs that retain intron sequences. In this paper, we identify two cis-acting sequence elements needed for regulation by p27rex: a 5' splice signal and a specific sequence in the 3' LTR. These two sequence elements are sufficient for regulation by p27rex; expression of a cellular gene (metallothionein I) became sensitive to rex regulation when the LTR was inserted at the 3' end of this gene. The requirement for these two elements suggests an unusual regulatory mechanism of RNA processing in the nucleus.

The DNA fragments of the 5' and 3' halves of the putative env gene predicted from the DNA sequence of human T-cell leukemia virus (HTLV) provirus were inserted into expression vectors pORF2 and pORF1, respectively, and two hybrid proteins composed of env polypeptides and beta-galactosidase were efficiently produced in Escherichia coli. The hybrid proteins containing the NH2-terminal (EH9) and COOH-terminal (EA1) halves were both immunologically reactive with sera from adult T-cell leukemia patients, demonstrating the utility of the hybrid proteins for diagnosis of HTLV infection. Rabbit antisera against these hybrid proteins detected the two glycoproteins gp62 and gp46, which were previously identified as HTLV env gene products. With these rabbit antisera, two properties of the env gene products were studied. (i) The antisera inhibited syncytia formation of cat S+L- cells induced by HTLV, suggesting that one or both of the env gene products of HTLV, gp62 and gp46, are involved in induction of cell fusion. (ii) The env product gp62 or gp46 or both products are exposed on the surface of HTLV-infected cells and might modulate the proliferation of HTLV-infected T cells in the host because the antisera against the hybrid proteins were cytotoxic on HTLV-producing cell lines. The latter conclusion also is supported by the fact that adult T-cell leukemia patients and healthy HTLV carriers have antibodies to the env gene products.

A transformation defective mutant ( TY 9) was obtained from the Prague strain of RSV by ultraviolet irradiation. It is a deletion mutant with slightly longer genomic RNA than ordinary td mutants isolated from the same strain by Vogt [ Virology 46 , 939–946 (1971)] . After several passages of cells infected with TY 9, partial expression of some characteristics of the transformed state was observed; these were fusiform shape, increased saturation density and hexose uptake, production of plasminogen activator, and colony-forming ability in soft agar medium.

The nucleotide sequence of glycine tRNA from yeast was determined on 32 P-labeled material. The molecule is 73 nucleotide long and can be folded into the “clover leaf” model.

A yeast glutamic acid tRNA, which specifically recognizes GAA codon but not GAG codon, was digested with RNase T1 and the nucleotide sequences of the fragments were determined. A minor nucleoside, 2-thiouridine derivative ( S ), was found in the presumed anticodon, S pUpCp. The possible function of this minor nucleoside for the specific recognition of GAA by this tRNA was discussed.

HTLV-1 Tax oncoprotein exerts pleiotropic effects on cellular regulatory systems, such as transcription and the cell cycle, through the interaction with various cellular factors. During our search for additional cellular targets of Tax using a yeast two-hybrid screening system, we isolated a cDNA encoding human DNA topoisomerase I. Tax was demonstrated to bind to topoisomerase I in vitro, and the Tax-topoisomerase I complex was also detected in HTLV-1-infected T-cells by immunoprecipitation. Furthermore, Tax inhibited the catalytic activity of topoisomerase I as measured by relaxation of supercoiled DNA, although complete inhibition was not observed under the conditions used. The binding of topoisomerase I to DNA was inhibited by the addition of the wild type of Tax but not by a mutant of Tax that cannot bind to topoisomerase I. Consistent with these observations, expression of Tax induced an in vivo reduction of the covalent association of topoisomerase I with chromosomal DNA, which accumulates in the presence of camptothecin. These results suggest that Tax has a novel potential to affect various cellular processes such as transcription and maintenance of genomic stability, in which DNA topoisomerase I is involved.

When stringent cells of Escherichi coli are starved for an amino acid, a guanine nucleotide derivative, MS1 , identified as ppGpp [l] , rapidly accumulates to relative high concentrations [2, 31 . The level of this derivative usually exceeds that of guanosine triphosphate [3,4], GTP (pppG), which in turn is in excess over guanosine diphosphate, GDP (ppG) [5]. In general, the level of MS1 can be directly correlated with the rate of cell growth [6] . We show here that MS1 can inhibit a step in protein synthesis; specifically the formation of the initiation complex containing formylmethionyltRNAf, 70 S ribosomes and messenger RNA.