1. Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element
- Author
-
Nozomu Hiraiwa, Yuetsu Tanaka, Mitsuaki Yoshida, Reiji Kannagi, Keijiro Yoritomi, Tomonori Yabuta, Miki Hiraiwa, and Takeshi Suzuki
- Subjects
Gene Expression Regulation, Viral ,Transcriptional Activation ,Fucosyltransferase ,viruses ,Immunology ,Activating transcription factor ,CREB ,Second Messenger Systems ,Biochemistry ,Jurkat cells ,Jurkat Cells ,Structure-Activity Relationship ,Transactivation ,Sequence Homology, Nucleic Acid ,Coactivator ,Cyclic AMP ,Humans ,Phosphorylation ,Cyclic AMP Response Element-Binding Protein ,Promoter Regions, Genetic ,Transcription factor ,Human T-lymphotropic virus 1 ,Activating Transcription Factor 2 ,Models, Genetic ,biology ,Genes, pX ,Terminal Repeat Sequences ,Gene Products, tax ,Cell Biology ,Hematology ,Fucosyltransferases ,Molecular biology ,Long terminal repeat ,Cancer research ,biology.protein ,5' Untranslated Regions ,Transcription Factors - Abstract
Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.
- Published
- 2003
- Full Text
- View/download PDF