Search

Cell-free DNA (cfDNA) analysis, specifically circulating tumor DNA (ctDNA) analysis, provides enormous opportunities for noninvasive early assessment of cancers. To date, PCR-based methods have led this field. However, the limited sensitivity/specificity of PCR-based methods necessitates the search for new methods. Here, we describe a direct approach to detect KRAS G12D mutated genes in clinical ctDNA samples with the utmost LOD and sensitivity/specificity. In this study, MutS protein was immobilized on the tip of an atomic force microscope (AFM), and the protein sensed the mismatched sites of the duplex formed between the capture probe on the surface and mutated DNA. A noteworthy LOD (3 copies, 0.006% allele frequency) was achieved, along with superb sensitivity/specificity (100%/100%). These observations demonstrate that force-based AFM, in combination with the protein found in nature and properly designed capture probes/blockers, represents an exciting new avenue for ctDNA analysis.

The soluble interleukin-2 receptor α (sIL-2Rα) is a broad indicator of clinical disease activity in various inflammatory diseases. Here we have developed, for the first time, a rapid, washing-free colorimetric aptasensor based on a sIL-2Rα aptamer (Kd =1.33 nm). The aptasensor was fabricated with Au nanoparticles (AuNPs) adsorbing sIL-2Rα aptamers. On addition of sIL-2Rα, the aptamers become desorbed from the AuNPs, and this in turn weakens the absorption corresponding to AuNP-catalyzed oxidation of ortho-phenylenediamine (oPD) with H2 O2 . The aptasensor was characterized by TEM imaging, ζ potential measurements, dynamic light scattering (DLS) analysis, and UV/Vis spectrometry, followed by further optimization. The fabricated sensor exhibited great analytical performance, with a linear range of 1 to 100 nm and a detection limit of 1 nm both in buffer and in spiked human serum within 25 min. Other proteins, such as bovine serum albumin (BSA), IL-17Rα, IL-5Rα, IL-13Rα2 , and CD166, showed negligible effects on the aptasensor. Thanks to the great advantages of the aptamers and AuNPs, this aptasensor provides a rapid, simple, and inexpensive process that might offer insights into various diagnostic applications of sIL-2Rα.

Patients with pancreatic and colorectal cancers have elevated levels of activated leukocyte cell adhesion molecule (ALCAM) in their blood compared to healthy individuals. To this end, sensitive detection of soluble fraction of ALCAM (sALCAM), also called CD166, was performed using enzyme-linked antibody aptamer (ELAA) assay. For the assay, aptamer specific for sALCAM was used as a capturing probe and polyclonal antibody modified with an enzyme was used as a detecting probe for colorimetric visualization. The ELAA assay was able to detect sALCAM as low as 0.31 ng/mL. In addition, the assay enabled the differentiation of sALCAM from other proteins in buffer as well as in human serum. The ELAA assay provides cost-effective, highly sensitive, and reproducible detection of sALCAM.

Cardiac troponin I (cTnI) is well-known as a promising biomarker for the early diagnosis of acute myocardial infarction (AMI). In this work, single-stranded DNA aptamers against cTnI were identified by the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. The aptamer candidates exhibited a high selectivity and sensitivity toward both cTnI and the cardiac Troponin complex. The binding affinities of each aptamer were evaluated based on their dissociation constants (Kd) by surface plasma resonance. The Tro4 aptamer that had the highest binding capacity to cTnI showed a very low Kd value (270 pM) compared with that of a cTnI antibody (20.8 nM). Furthermore, we designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles. The developed aptasensor demonstrated an excellent analytical performance for cTnI with a wide linear range of 1-10 000 pM in a buffer and a detection limit of 1.0 pM (24 pg/mL; S/N = 3), which was noticeably lower than the cutoff values (70-400 pg/mL). The specificity of the aptamers was also examined using nontarget proteins, demonstrating that the proposed sensor responded to only cTnI. In addition, cTnI was successfully detected in a human serum albumin solution. On the basis of the calibration curve that was constructed, the concentrations of cTnI in a solution supplemented with human serum were effectively measured. The calculated values correlated well with the actual concentrations of cTnI. It is anticipated that the highly sensitive and selective aptasensor for cTnI could be readily applicable for the accurate diagnosis of AMI.

SummaryThe mismatch repair (MMR) initiation protein MutS forms at least two types of sliding clamps on DNA: a transient mismatch searching clamp (∼1 s) and an unusually stable (∼600 s) ATP-bound clamp that recruits downstream MMR components. Remarkably, direct visualization of single MutS particles on mismatched DNA has not been reported. We have combined real-time particle tracking with fluorescence resonance energy transfer (FRET) to image MutS diffusion dynamics on DNA containing a single mismatch. We show searching MutS rotates during diffusion independent of ionic strength or flow rate, suggesting continuous contact with the DNA backbone. In contrast, ATP-bound MutS clamps that are visually and successively released from the mismatch spin freely around the DNA, and their diffusion is affected by ionic strength and flow rate. These observations show that ATP binding alters the MutS diffusion mechanics on DNA, which has a number of implications for the mechanism of MMR.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

The angiotensin II type I receptor (AGTR1) has been implicated in diverse aspects of human disease, from the regulation of blood pressure and cardiovascular homeostasis to cancer progression. We sought to investigate the role of AGTR1 in cell proliferation, epithelial-mesenchymal transition (EMT), migration, invasion, angiogenesis and tumor growth in the breast cancer cell line MCF7. Stable overexpression of AGTR1 was associated with accelerated cell proliferation, concomitant with increased expression of survival factors including poly(ADP-ribose) polymerase (PARP) and X-linked inhibitor of apoptosis (XIAP), as well as extracellular signal-regulated kinase (ERK) activation. AGTR1-overexpressing MCF7 cells were more aggressive than their parent line, with significantly increased activity in migration and invasion assays. These observations were associated with changes in EMT markers, including reduced E-cadherin expression and increased p-Smad3, Smad4 and Snail levels. Treatment with the AGTR1 antagonist losartan attenuated these effects. AGTR1 overexpression also accelerated tumor growth and increased Ki-67 expression in a xenograft model. This was associated with increased tumor angiogenesis, as evidenced by a significant increase in microvessels in the intratumoral and peritumoral areas, and enhanced tumor invasion, with the latter response associated with increased EMT marker expression and matrix metallopeptidase 9 (MMP-9) upregulation. In vivo administration of losartan significantly reduced both tumor growth and angiogenesis. Our findings suggest that AGTR1 plays a significant role in tumor aggressiveness, and its inhibition may have therapeutic implications.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.

Single-molecule trajectory analysis has suggested DNA repair proteins may carry out a one-dimensional (1D) search on naked DNA encompassing >10,000 nucleotides. Organized cellular DNA (chromatin) presents substantial barriers to such lengthy searches. Using dynamic single-molecule fluorescence resonance energy transfer, we determined that the mismatch repair (MMR) initiation protein MutS forms a transient clamp that scans duplex DNA for mismatched nucleotides by 1D diffusion for 1 s (~700 base pairs) while in continuous rotational contact with the DNA. Mismatch identification provokes ATP binding (3 s) that induces distinctly different MutS sliding clamps with unusual stability on DNA (~600 s), which may be released by adjacent single-stranded DNA (ssDNA). These observations suggest that ATP transforms short-lived MutS lesion scanning clamps into highly stable MMR signaling clamps that are capable of competing with chromatin and recruiting MMR machinery, yet are recycled by ssDNA excision tracts.

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

A fluorescent method was developed for the detection of unpaired and mismatched DNAs using a MutS-fluorophore conjugate. The fluorophore, 2-(4'-(iodoacetoamido)anilino) naphthalene-6-sulfonic acid (IAANS), was site-specifically attached to the 469 position of Thermus aquaticus (Taq.) MutS mutant (C42A/T469C). The fluorophore labeled residue located at the dimer interface of the protein undergoes a drastic conformational change upon binding with mismatched DNA. The close proximity of the two identical fluorescent molecules presumably causes the self-quenching of the fluorophore, since fluorescence emission of the biosensor decreases with increasing concentrations of mismatched DNA. The order of binding affinity for each unpaired and mismatched DNA obtained by this method was DeltaT (Kd=52 nM)>GT (62 nM)>DeltaC (130 nM)>CT (160 nM)>DeltaG (170 nM)>DeltaA (250 nM)>CC (720 nM)>AT (950 nM). This order is comparable to the previous results of the gel mobility shift assay. Thus, this method can be a simple, useful tool for elucidating the mechanism of DNA mismatch repair as well as a novel probe for detecting of genetic mutation.

It is well known that the engrailed-2 (EN2) protein, a biomarker for prostate cancer, strongly binds to a specific DNA sequence (5'-TAATTA-3') to regulate transcription. Based on this intrinsic property, DNA probes with additional flanked sequences were designed and optimized. Various measurements, such as electrophoresis mobility shift assay, surface plasmon resonance, and quantitative fluorescence assay were performed to investigate the feasibility of the DNA probes. Then, the affinities of the DNA probes to the target protein were quantitatively determined using FAM-modified DNA probes and magnetic beads, resulting in dissociation constants ranging from 61.03 to 98.84nM. To develop an early diagnosis platform for prostate cancer, an ultrasensitive electrochemical biosensor based on the electrodeposition of gold nanoparticles was designed. The EN2 protein was quantitatively detected using the electrochemical biosensor, and the calculated detection limit was found to be 5.62fM. Finally, the specificity and applicability of the biosensor were verified using several proteins and an artificial urine medium. The impedance signals increased in the cases of EN2, suggesting that the system exhibited high selectivity to only EN2.

The crystal structure of the RNA duplex, r(GUAUGUA)dC, with a 3'-terminal deoxy C residue, has been determined at 1.38 A resolution. The r(GUAUGU) hexameric consensus sequence is present at the exon-intron junction in pre-mRNAs of yeast and higher eukaryotic organisms. The crystal belongs to the rhombohedral space group R3. The hexagonal unit cell dimensions are a = b = 39.71 A, c = 68.15 A and gamma = 120 degrees with one duplex in the asymmetric unit. The structure was solved using the molecular replacement method. The final model contains 332 atoms of the duplex and 67 solvent molecules. The R-factor is 17.6% (Rfree of 23.1%) for 4035 reflections with For = 1.5sigma(F) in the resolution range 10.0 to 1.38 A. The duplex is of the A-type with a pseudodyad relating the two strands. The RNA helix is slightly distorted, in spite of the presence of two adjacent G x U wobble base-pairs located at the center of the helix. The twist angle between the wobble pairs, 38.1 degrees, is above the average value and those between the wobble base-pairs and the flanking Watson-Crick base-pairs, 26.7 degrees and 26.3 degrees, respectively, are lower than the average values. The twist between the junction base-pairs are about 24 degrees. The G x U wobble pairs are bridged by water molecules and solvated in the grooves. G x U base-pairs are as stable as the Watson-Crick A x U pairs and only slightly less stable than the G x C pairs accounting for their frequent occurrence in RNA.

Malaria, a major burden of disease caused by parasites of the genus Plasmodium, is widely spread in tropical and subtropical regions. Here, we have successfully developed a diagnostic technique for malaria. The proposed method is based on the interaction among the Plasmodium lactate dehydrogenase (pLDH), which is a biomarker for malaria, and pL1 aptamer against Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum lactate dehydrogenase (PfLDH). In addition, the cationic polymers, poly(diallyldimethylammonium chloride) (PDDA) and poly(allylamine hydrochloride) (PAH), aggregate gold nanoparticles (AuNPs) that should be possible to observe the change in color from red to blue, which depends on the concentration of pLDH. Using this aptasensor, pLDH proteins were successfully detected with low detection limits. Moreover, the specificity test proved that the aptasenor is very specific in targeting proteins over other interfering proteins. In addition, the pLDH from infected blood samples of the two main species of malaria were also detected. The limits of detection for P. vivax were determined as 80 parasites/μl for PDDA and 74 parasites/μl for PAH. The aptasenor has great advantages that can simply and rapidly diagnose malaria. Thus, the developed aptasensor for detection of pLDH can offer an effective and sensitive diagnosis of malaria.

Correct diagnosis and successful therapy are extremely important to enjoy a healthy life when suffering from a disease. To achieve these aims, various cutting-edge technologies have been designed and fabricated to diagnose and treat specific diseases. Among these technologies, aptamer–nanomaterial hybrids have received considerable attention from scientists and doctors because they have numerous advantages over other methods, such as good biocompatibility, low immunogenicity and controllable selectivity. In particular, aptamers, oligonucleic acids or peptides that bind to a specific target molecule, are regarded as outstanding biomolecules. In this review, several screening techniques for aptamers, also called systematic evolution of ligands by exponential enrichment (SELEX) methods, are introduced, and diagnostic and therapeutic aptamer applications are also presented. Furthermore, we describe diverse aptamer–nanomaterial conjugate designs and their applications for diagnosis and therapy. A wide variety ofnanoparticle complexes that target specific biomolecules are revolutionizing disease diagnostics and therapies. Hunho Jo and Changill Ban at Pohang University of Science and Technology, South Korea, reviewed recent advances into the medical uses of aptamerscomplexed with nanoparticles. Aptamers arepeptides or small sections of DNA or RNA that can target and bind to specific chemicals in the body. In a complex, they effectively act as guides escorting nanoparticles to the places where they are needed. For example, aptamers can lead fluorescent nanoparticles to cancer cells to ensure clear imaging and diagnosis of tumors. The authors describe several promising aptamer-nanoparticle complexes, including probes for detecting cocaine and diagnosing breast cancer,as well asa drug delivery system that targets specific brain cells and may provide a therapy for Alzheimer's disease.

We have found that the introduction of a single 2'-hydroxyl group on the sugar-phosphate backbone of the B-DNA decamer d(CCGGCGCCGG) transforms it to A-DNA. Thus, for the first time the X-ray structures of the same sequence have been observed in both the A and B-DNA conformations, permitting a comparison. Crystals of the DNA-RNA chimeric decamer d(CCGGC)r(G)d(CCGG) belong to the orthorhombic space group P2(1)2(1)2(1) with unit cell dimensions a = 25.63 A, b = 45.24 A and c = 47.99 A, and one decamer duplex in the asymmetric unit. The structure was solved by a rigid body search using the coordinates of the isomorphous structure d(CCCGGCCGGG) and refined to an R value of 0.136 using 2753 unique reflections at 1.9 A resolution. The final model contains 406 nucleotide atoms and 61 water molecules. The chimeric duplex exhibits typical A-DNA geometry, with all the sugars in the C(3')-endo puckering and the base-pairs inclined and displaced from the helix axis. The 2'-hydroxyl groups on rG6 and rG16 protrude into the minor groove surface and form different types of hydrogen bonds; that on strand 1 forms an intermolecular hydrogen bond with the furanose ring O(4') of a symmetry-related C1 residue, while that on strand 2 is involved in two water bridges. Crystal packing forces the G4-G17 base-pair in the top half of the duplex to slide significantly into the minor groove compared to the corresponding G7-G14 base-pair in the bottom half, resulting in these base-pairs exhibiting different base stacking and intermolecular interactions. The base G4 of the G4-G17 base-pair forms an unorthodox base "triple", G4*(G10-C11), hydrogen-bonding through its minor groove sites N(2) and N(3) to the minor groove atoms N(2) and O(2) of both bases of the G10-C11 base-pair of a symmetry-related molecule. The base G10 of this triple in turn forms a second similar unorthodox base triple, G10*(G3*C18), with the adjacent base-pair G3-C18 of the duplex, thus G10 is involved in a double triple. On the other hand, in the bottom half of the duplex, the C7-G14 base-pair is involved only in a single similar unorthodox base triple with G20, (C7-G14)*G20, while the adjacent base-pair rG6-C15 is involved in a novel quadruple with C1-G20, (rG6-C15) *(C1-G20), where the latter base-pairs are hydrogen-bonded to each other via the minor groove sites G(N(2))...C(O(2)).(ABSTRACT TRUNCATED AT 400 WORDS)

We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence, are introduced in this work. In a colorimetric method, gold nanoparticles (AuNPs) modified with complementary DNAs (cDNAs) were assembled by annealing. Aggregated AuNPs were then separated irreversibly by TmRecA and DNAzyme, leading to a distinct color change in the particles from purple to red. For the case of fluorometric detection, fluorescein isothiocyanate (FITC)-labeled DNA as a fluorophore and black hole quencher 1 (BHQ1)-labeled DNA as a quencher were used; successful strand exchange was clearly detected by variations in fluorescence intensity. In addition, alterations in the impedance of a gold electrode with immobilized DNA were employed to monitor the regular exchange of DNA strands. All three methods provided sufficient evidence of efficient strand exchange reactions and have great potential for applications in the monitoring of recombination, discovery of new DNAzymes, detection of DNAzymes, and measurement of other protein activities.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

DNA binding by MutL homologs (MLH/PMS) during mismatch repair (MMR) has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA) binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET) and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D) = 29 nM) while it dramatically decreases above 100 mM (K(D)>2 µM). Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

Chemically synthesized small interfering RNAs (siRNAs) can specifically knock-down expression of target genes via RNA interference (RNAi) pathway. To date, the length of synthetic siRNA duplex has been strictly maintained less than 30 bp, because an early study suggested that double-stranded RNAs (dsRNAs) longer than 30 bp could not trigger specific gene silencing due to the induction of nonspecific antiviral interferon responses. Contrary to the current belief, here we show that synthetic dsRNA as long as 38 bp can result in specific target gene silencing without nonspecific antiviral responses. Using this longer duplex structure, we have generated dsRNAs, which can simultaneously knock-down expression of two target genes (termed as dual-target siRNAs or dsiRNAs). Our results thus demonstrate the structural flexibility of gene silencing siRNAs, and provide a starting point to construct multifunctional RNA structures. The dsiRNAs could be utilized to develop a novel therapeutic gene silencing strategy against diseases with multiple gene alternations such as viral infection and cancer.

The effect of wild-type and mutant MutL on the steady-state ATPase activity of MutS from Escherichia coli has been investigated in the absence and presence of 22, 50, and 75 base pair hetero- and homoduplex DNAs with open and blocked ends. The steady-state ATPase activity of MutS has been measured at 37 degrees C using a spectrophotometric method. The presence of MutL did not affect appreciably on the ATPase activity of MutS in the absence of DNA or in the presence of blocked end homoduplex DNAs. However, the addition of MutL affected oppositely on the ATPase activity of MutS in the presence of G-T mismatched DNAs depending on their end status. We have also found that only the ATPase active forms of MutL increased the ATPase activity of MutS in the presence of G-T mismatched DNAs with blocked ends. The results suggest that MutL ATPase activity is required to catalyze dissociation of the MutS sliding clamps.

Small interfering RNAs (siRNAs) are short, double-stranded RNAs that mediate efficient gene silencing in a sequence-specific manner by utilizing the endogenous RNA interference (RNAi) pathway. The current standard synthetic siRNA structure harbors a 19–base-pair duplex region with 3′ overhangs of 2 nucleotides (the so-called 19+2 form). However, the synthetic 19+2 siRNA structure exhibits several sequence-independent, nonspecific effects, which has posed challenges to the development of RNAi therapeutics and specific silencing of genes in research. In this study, we report on the identification of truncated siRNA backbone structures with duplex regions shorter than 19 bp (referred to as asymmetric shorter-duplex siRNAs or asiRNAs) that can efficiently trigger gene silencing in human cell lines. Importantly, this asiRNA structure significantly reduces nonspecific effects triggered by conventional 19+2 siRNA scaffold, such as sense-strand–mediated off-target gene silencing and saturation of the cellular RNAi machinery. Our results suggest that this asiRNA structure is an important alternative to conventional siRNAs for both functional genomics studies and therapeutic applications.

MutL is required to assist the mismatch repair protein MutS during initiation of the methyl-directed mismatch repair (MMR) response in various organisms ranging from prokaryotes to eukaryotes. Despite this necessity, the inherent propensity of MutL to aggregate has led to significant difficulties in determining its biological relationship with other MMR-related proteins. Here, we perform analysis on the thermostable MutL protein found in Thermotoga maritima MSB8 (TmL). Size exclusion chromatographic analysis indicates the lack of aggregated forms with the exception of a dimeric TmL. Small-angle X-ray scattering (SAXS) analysis reveals that the solution structures of the full-length TmL and its corresponding complexes with nucleotides and ssDNA undergo conformational changes. The elucidated TmL SAXS model is superimposed to the crystal structure of the C-terminal domain of Escherichia coli MutL. In addition, the N-terminal SAXS model of TmL exists as monomeric form, indicating that TmL has a structurally flexible N-terminal domain. TmL SAXS analysis can suggest a considerable possibility on a new 3D view of the previously unresolved full-length MutL molecule.

Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IFN-gamma was detected by its 5'-thiol-modified aptamer probe immobilized on the gold electrode. Interaction between IFN-gamma and the aptamer was recorded using electrochemical impedance spectroscopy and quartz crystal microbalance (QCM) with high sensitivity. The RNA-aptamer-based sensor showed a low detection limit of 100 fM, and the DNA-aptamer-based sensor detected IFN-gamma to 1 pM in sodium phosphate buffer. With QCM analysis, the aptamer immobilized on the electrode and IFN-gamma bound to the aptamer probe was quantified. This QCM result shows that IFN-gamma exists in multimeric forms to interact with the aptamers, and the RNA aptamer prefers the high multimeric state of IFN-gamma. Such a preference may describe the low detection limit of the RNA aptamer shown by impedance analysis. In addition, IFN-gamma was detected to 10 pM by the DNA aptamer in fetal bovine serum, a mimicked biological system, which has similar components to pleural fluid.

The molecular mechanisms of the DNA mismatch repair (MMR) system have been uncovered over the last decade, especially in prokaryotes. The results obtained for prokaryotic MMR proteins have provided a framework for the study of the MMR system in eukaryotic organisms, such as yeast, mouse and human, because the functions of MMR proteins have been conserved during evolution from bacteria to humans. However, mutations in eukaryotic MMR genes result in pleiotropic phenotypes in addition to MMR defects, suggesting that eukaryotic MMR proteins have evolved to gain more diverse and specific roles in multicellular organisms. Here, we summarize recent advances in the understanding of both prokaryotic and eukaryotic MMR systems and describe various new functions of MMR proteins that have been intensively researched during the last few years, including DNA damage surveillance and diversification of antibodies.

The MutS DNA mismatch protein recognizes heteroduplex DNAs containing mispaired or unpaired bases. We have examined the oligomerization of a MutS protein from Thermus aquaticus that binds to heteroduplex DNAs at elevated temperatures. Analytical gel filtration, cross-linking of MutS protein with disuccinimidyl suberate, light scattering, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry establish that the Taq protein is largely a dimer in free solution. Analytical equilibrium sedimentation showed that the oligomerization of Taq MutS involves a dimer-tetramer equilibrium in which dimer predominates at concentrations below 10 microM. The DeltaG(0)(2-4) for the dimer to tetramer transition is approximately -6.9 +/- 0.1 kcal/mol of tetramer. Analytical gel filtration of native complexes and gel mobility shift assays of an maltose-binding protein-MutS fusion protein bound to a short, 37-base pair heteroduplex DNA reveal that the protein binds to DNA as a dimer with no change in oligomerization upon DNA binding.

MutS, MutL and MutH are the three essential proteins for initiation of methyl‐directed DNA mismatch repair to correct mistakes made during DNA replication in Escherichia coli . MutH cleaves a newly synthesized and unmethylated daughter strand 5′ to the sequence d(GATC) in a hemi‐methylated duplex. Activation of MutH requires the recognition of a DNA mismatch by MutS and MutL. We have crystallized MutH in two space groups and solved the structures at 1.7 and 2.3 A resolution, respectively. The active site of MutH is located at an interface between two subdomains that pivot relative to one another, as revealed by comparison of the crystal structures, and this presumably regulates the nuclease activity. The relative motion of the two subdomains in MutH correlates with the position of a protruding C‐terminal helix. This helix appears to act as a molecular lever through which MutS and MutL may communicate the detection of a DNA mismatch and activate MutH. With sequence homology to Sau 3AI and structural similarity to Pvu II endonuclease, MutH is clearly related to these enzymes by divergent evolution, and this suggests that type II restriction endonucleases evolved from a common ancestor.

The folding of aptamer immobilized on an Au electrode was successfully detected using label-free electrochemical methods. A thrombin binding DNA aptamer was used as a model system in the presence of various monovalent cations. Impedance spectra showed that the extent to which monovalent cations assist in folding of aptamer is ordered as K(+) > NH(4)(+) > Na(+) > Cs(+). Our XPS analysis also showed that K(+) and NH(4)(+) caused a conformational change of the aptamer in which it forms a stable complex with these monovalent ions. Impedance results for the interaction between aptamer and thrombin indicated that thrombin interacts more with folded aptamer than with unfolded aptamer. The EQCM technique provided a quantitative analysis of these results. In particular, the present impedance results showed that thrombin participates a folding of aptamer to some extent, and XPS analysis confirmed that thrombin stabilizes and induces the folding of aptamer.

It has been studied that DNA repair proteins search a target via a 1-dimensional diffusion along naked DNA. Due to the absence of the target on DNA this single-molecule tracking approach lacked of understanding the catalytic function of the repair proteins and moreover the mechanism of the downstream transactions for the repair of an error on the DNA. We present the catalytic processes of MutS, mismatch repair initiation protein, on a mismatched DNA that bears an unpaired nucleotide. Our single-molecule analysis reveals that MutS undergoes two distinct conformational changes during DNA mismatch repair (MMR). MutS forms a transient clamp that scans duplex DNA for the unpaired nucleotide and a different sliding clamp that is induced by ATP binding to the mismatch-bound MutS with unusual stability on DNA. These observations suggest a mechanism of how MMR machinery can be recruited for the strand incision, which is highly controversial.