Search

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4- N -methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

MicroRNAs (miRNAs) are regulatory small non-coding RNAs that function as translational repressors. MiRNAs are involved in most cellular processes, and their expression and function are presided by several factors. Amongst, miRNA editing is an epitranscriptional modification that alters the original nucleotide sequence of selected miRNAs, possibly influencing their biogenesis and target-binding ability. A-to-I and C-to-U RNA editing are recognized as the canonical types, with the A-to-I type being the predominant one. Albeit some bioinformatics resources have been implemented to collect RNA editing data, it still lacks a comprehensive resource explicitly dedicated to miRNA editing. Here, we present MiREDiBase, a manually curated catalog of editing events in miRNAs. The current version includes 3,059 unique validated and putative editing sites from 626 pre-miRNAs in humans and three primates. Editing events in mature human miRNAs are supplied with miRNA-target predictions and enrichment analysis, while minimum free energy structures are inferred for edited pre-miRNAs. MiREDiBase represents a valuable tool for cell biology and biomedical research and will be continuously updated and expanded at https://ncrnaome.osumc.edu/miredibase ., (© 2021. The Author(s).)

Pathway analysis is a wide class of methods allowing to determine the alteration of functional processes in complex diseases. However, biological pathways are still partial, and knowledge coming from posttranscriptional regulators has started to be considered in a systematic way only recently. Here we will give a global and updated view of the main pathway and subpathway analysis methodologies, focusing on the improvements obtained through the recent introduction of microRNAs as regulatory elements in these frameworks.

Posttranscriptional cross talk and communication between genes mediated by microRNA response element (MREs) yield large regulatory competing endogenous RNA (ceRNA) networks. Their inference may improve the understanding of pathologies and shed new light on biological mechanisms. A variety of RNA: messenger RNA, transcribed pseudogenes, noncoding RNA, circular RNA and proteins related to RNA-induced silencing complex complex interacting with RNA transfer and ribosomal RNA have been experimentally proved to be ceRNAs. We retrace the ceRNA hypothesis of posttranscriptional regulation from its original formulation [Salmena L, Poliseno L, Tay Y, et al. Cell 2011;146:353-8] to the most recent experimental and computational validations. We experimentally analyze the methods in literature [Li J-H, Liu S, Zhou H, et al. Nucleic Acids Res 2013;42:D92-7; Sumazin P, Yang X, Chiu H-S, et al. Cell 2011;147:370-81; Sarver AL, Subramanian S. Bioinformation 2012;8:731-3] comparing them with a general machine learning approach, called ceRNA predIction Algorithm, evaluating the performance in predicting novel MRE-based ceRNAs., (© The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

RNA editing is a finely tuned, dynamic mechanism for post-transcriptional gene regulation that has been thoroughly investigated in the last decade. Nevertheless, RNA editing in non-coding RNA, such as microRNA (miRNA), have caused great debate and have called for deeper investigation. Until recently, in fact, inadequate methodologies and experimental contexts have been unable to provide detailed insights for further elucidation of RNA editing affecting miRNAs, especially in cancer.In this work, we leverage on recent innovative bioinformatics approaches applied to a more informative experimental context in order to analyze the variations in miRNA seed region editing activity during a time course of a hypoxia-exposed breast cancer cell line. By investigating its behavior in a dynamic context, we found that miRNA editing events in the seed region are not depended on miRNA expression, unprecedentedly providing insights on the targetome shifts derived from these modifications. This reveals that miRNA editing acts under the influence of environmentally induced stimuli.Our results show a miRNA editing activity trend aligning with cellular pathways closely associated to hypoxia, such as the VEGF and PI3K/Akt pathways, providing important novel insights on this poorly elucidated phenomenon., (© The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.)

RNAi is a powerful tool for the regulation of gene expression. It is widely and successfully employed in functional studies and is now emerging as a promising therapeutic approach. Several RNAi-based clinical trials suggest encouraging results in the treatment of a variety of diseases, including cancer. Here we present miR-Synth, a computational resource for the design of synthetic microRNAs able to target multiple genes in multiple sites. The proposed strategy constitutes a valid alternative to the use of siRNA, allowing the employment of a fewer number of molecules for the inhibition of multiple targets. This may represent a great advantage in designing therapies for diseases caused by crucial cellular pathways altered by multiple dysregulated genes. The system has been successfully validated on two of the most prominent genes associated to lung cancer, c-MET and Epidermal Growth Factor Receptor (EGFR). (See http://microrna.osumc.edu/mir-synth)., (© The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Background: MicroRNAs (miRNAs) are small noncoding RNAs that play an important role in the regulation of various biological processes through their interaction with cellular mRNAs. A significant amount of miRNAs has been found in extracellular human body fluids (e.g. plasma and serum) and some circulating miRNAs in the blood have been successfully revealed as biomarkers for diseases including cardiovascular diseases and cancer. Released miRNAs do not necessarily reflect the abundance of miRNAs in the cell of origin. It is claimed that release of miRNAs from cells into blood and ductal fluids is selective and that the selection of released miRNAs may correlate with malignancy. Moreover, miRNAs play a significant role in pharmacogenomics by down-regulating genes that are important for drug function. In particular, the use of drugs should be taken into consideration while analyzing plasma miRNA levels as drug treatment. This may impair their employment as biomarkers., Description: We enriched our manually curated extracellular/circulating microRNAs database, miRandola, by providing (i) a systematic comparison of expression profiles of cellular and extracellular miRNAs, (ii) a miRNA targets enrichment analysis procedure, (iii) information on drugs and their effect on miRNA expression, obtained by applying a natural language processing algorithm to abstracts obtained from PubMed., Conclusions: This allows users to improve the knowledge about the function, diagnostic potential, and the drug effects on cellular and circulating miRNAs.

Triple negative breast cancer (TNBC) is a heterogeneous disease at the molecular, pathologic and clinical levels. To stratify TNBCs, we determined microRNA (miRNA) expression profiles, as well as expression profiles of a cancer-focused mRNA panel, in tumor, adjacent non-tumor (normal) and lymph node metastatic lesion (mets) tissues, from 173 women with TNBCs; we linked specific miRNA signatures to patient survival and used miRNA/mRNA anti-correlations to identify clinically and genetically different TNBC subclasses. We also assessed miRNA signatures as potential regulators of TNBC subclass-specific gene expression networks defined by expression of canonical signal pathways.Tissue specific miRNAs and mRNAs were identified for normal vs tumor vs mets comparisons. miRNA signatures correlated with prognosis were identified and predicted anti-correlated targets within the mRNA profile were defined. Two miRNA signatures (miR-16, 155, 125b, 374a and miR-16, 125b, 374a, 374b, 421, 655, 497) predictive of overall survival (P = 0.05) and distant-disease free survival (P = 0.009), respectively, were identified for patients 50 yrs of age or younger. By multivariate analysis the risk signatures were independent predictors for overall survival and distant-disease free survival. mRNA expression profiling, using the cancer-focused mRNA panel, resulted in clustering of TNBCs into 4 molecular subclasses with different expression signatures anti-correlated with the prognostic miRNAs. Our findings suggest that miRNAs play a key role in triple negative breast cancer through their ability to regulate fundamental pathways such as: cellular growth and proliferation, cellular movement and migration, Extra Cellular Matrix degradation. The results define miRNA expression signatures that characterize and contribute to the phenotypic diversity of TNBC and its metastasis.

microRNAs (miRNAs) have been shown to play a crucial role in the most important biological processes and their dysregulation has been connected to a variety of diseases, including cancer. The number of computational tools for the analysis of miRNA related data is continuously increasing. They range from simple look-up resources to more sophisticated tools for functional analysis of miRNAs. These systems may help to investigate the role of miRNAs in key biological processes and their involvement in diseases. The ultimate goal is to allow the development of regulatory models describing complex processes and the effects of their dysregulation.Here we review the most important and recent methods for the analysis of miRNA expression profiles and the tools available on the web for target prediction and functional analysis of miRNAs.Particular emphasis is given to the integration of heterogeneous data, including target predictions and expression profiles, which can be used to infer miRNA/phenotype associations and for the generation of network models of miRNA function.

Motivation: A-to-I RNA editing is an important mechanism that consists of the conversion of specific adenosines into inosines in RNA molecules. Its dysregulation has been associated to several human diseases including cancer. Recent work has demonstrated a role for A-to-I editing in microRNA (miRNA)-mediated gene expression regulation. In fact, edited forms of mature miRNAs can target sets of genes that differ from the targets of their unedited forms. The specific deamination of mRNAs can generate novel binding sites in addition to potentially altering existing ones., Results: This work presents miR-EdiTar, a database of predicted A-to-I edited miRNA binding sites. The database contains predicted miRNA binding sites that could be affected by A-to-I editing and sites that could become miRNA binding sites as a result of A-to-I editing., Availability: miR-EdiTar is freely available online at http://microrna.osumc.edu/mireditar., Contact: alessandro.lagana@osumc.edu or carlo.croce@osumc.edu, Supplementary Information: Supplementary data are available at Bioinformatics online.

MicroRNAs are small noncoding RNAs that play an important role in the regulation of various biological processes through their interaction with cellular messenger RNAs. They are frequently dysregulated in cancer and have shown great potential as tissue-based markers for cancer classification and prognostication. microRNAs are also present in extracellular human body fluids such as serum, plasma, saliva, and urine. Most of circulating microRNAs are present in human plasma and serum cofractionate with the Argonaute2 (Ago2) protein. However, circulating microRNAs have been also found in membrane-bound vesicles such as exosomes. Since microRNAs circulate in the bloodstream in a highly stable, extracellular form, they may be used as blood-based biomarkers for cancer and other diseases. A knowledge base of extracellular circulating miRNAs is a fundamental tool for biomedical research. In this work, we present miRandola, a comprehensive manually curated classification of extracellular circulating miRNAs. miRandola is connected to miRò, the miRNA knowledge base, allowing users to infer the potential biological functions of circulating miRNAs and their connections with phenotypes. The miRandola database contains 2132 entries, with 581 unique mature miRNAs and 21 types of samples. miRNAs are classified into four categories, based on their extracellular form: miRNA-Ago2 (173 entries), miRNA-exosome (856 entries), miRNA-HDL (20 entries) and miRNA-circulating (1083 entries). miRandola is available online at: http://atlas.dmi.unict.it/mirandola/index.html.

Background: Chromosomal fragile sites are heritable specific loci especially prone to breakage. Some of them are associated with human genetic disorders and several studies have demonstrated their importance in genome instability in cancer. MicroRNAs (miRNAs) are small non-coding RNAs responsible of post-transcriptional gene regulation and their involvement in several diseases such as cancer has been widely demonstrated. The altered expression of miRNAs is sometimes due to chromosomal rearrangements and epigenetic events, thus it is essential to study miRNAs in the context of their genomic locations, in order to find significant correlations between their aberrant expression and the phenotype., Principal Findings: Here we use statistical models to study the incidence of human miRNA genes on fragile sites and their association with cancer-specific translocation breakpoints, repetitive elements, and CpG islands. Our results show that, on average, fragile sites are denser in miRNAs and also in protein coding genes. However, the distribution of miRNAs and protein coding genes in fragile versus non-fragile sites depends on chromosome. We find also a positive correlation between fragility and repeats, and between miRNAs and CpG islands., Conclusion: Our results show that the relationship between site fragility and miRNA density is far more complex than previously thought. For example, we find that protein coding genes seem to be following similar patterns as miRNAs, if considered their overall distribution. However, once we allow for differences at the chromosome level in our statistical analysis, we find that distribution of miRNA and protein coding genes in fragile sites is very different from that of miRNA. This is a novel result that we believe may help discover new potential correlations between the localization of miRNAs and their crucial role in biological processes and in the development of diseases.