Search

The Ironwood tree (Casuarina equisetifolia) holds a significant ecological role in Guam where a decline in Ironwood trees was first documented in 2002. Studies have linked the Ironwood tree decline (IWTD) to bacteria from the Ralstonia solanacearum complex and wetwood bacteria, specifically Klebsiella oxytoca and Klebsiella variicola. Presence of termites was first found to be associated with IWTD in 2010; however, the role of termites in IWTD is still not clear. The Asian subterranean termite, Coptotermes gestroi (Wasmann) (Blattodea: Rhinotermitidae) frequently attacks Ironwood trees. As workers of this soil-dwelling species of the lower termites harbor a diverse microbial community in their bodies, we examined whether C. gestroi workers carry IWTD-associated bacteria and could, therefore, act as vectors. We described the bacterial community in C. gestroi workers using 16S rRNA gene sequencing and tested the impact of factors related to the location and health of the Ironwood tree the termites were collected from on termite bacterial diversity. Feeding assays were performed to assess if workers show preference in consumption depending on the amount of Ralstonia and wetwood bacteria in the food source. Health of Ironwood trees and level of site management impacted the bacterial composition of C. gestroi termite workers attacking the trees. Although C. gestroi workers equally consumed food sources with high and low Ralstonia and wetwood bacteria load in lab experiments, Ralstonia and other IWTD-related bacteria were not detected in considerable amounts in termite workers collected from trees. Thus, C. gestroi workers are not a vector for bacteria associated with IWTD in Guam. [ABSTRACT FROM AUTHOR]

Understanding the environmental drivers of microbial H 2 metabolisms is crucial for evaluating the risks for geological hydrogen storage. This study investigates how mineralogy and temperature affect H 2 consumption kinetics and metabolic activity of a microbial consortium containing methanogens, homoacetogens and sulfate reducers, incubated at 25, 34 and 40 °C under H 2 /CO 2 (80/20, v/v; 2 bars) with different rock powders (basalt, calcite, gypsum, and sandstone). The presence of gypsum favors sulfate reduction over methanogenesis and homoacetogenesis, especially at 25 °C. Methanogenesis is dominant at 34 and 40 °C with all sulfate-free mineralogies. At 25 °C, homoacetogenic bacteria are favored over methanogens and acetate production varies with the mineralogy. This suggests interactions of the microbial community with the rock powders, which may serve as a surface to form biofilms. These metabolic shifts are associated with radical changes in microbial populations, highlighting that ecosystems plasticity towards H 2 also depends on the mineralogical composition of the reservoir. • Both temperature and mineralogy affect H 2 consumption kinetics. • Gypsum powder favors sulfate reduction over methanogenesis and homoacetogenesis. • Low temperature favors homoacetogenesis over methanogenesis. • Proportions of methanogenesis and homoacetogenesis vary with the substrate mineralogy. • Metabolic shifts are associated with radical changes in microbial populations. [ABSTRACT FROM AUTHOR]

Background: Pinus koraiensis cone essential oil (PEO) contains functional compounds such as monoterpene hydrocarbons, and the administration of PEO reduced methane (CH4) emissions during growing phase of goats. However, the mode of action of PEO driven CH4 reduction is not known, especially how the administration of PEO can affect rumen microbiota and host metabolism in goats during the fattening phase. This study aimed to elucidate the potential microbial and host responses PEO supplementation in goats using metataxonomics (prokaryotes and protozoa) and metabolomics (rumen fluid and serum). Results: Ten fattening Korean native goats were divided into two dietary groups: control (CON; basal diet without additives) and PEO (basal diet + 1.5 g/d of PEO) with a 2 × 2 crossover design and the treatment lasted for 11 weeks. Administration of PEO reduced CH4 concentrations in the exhaled gas from eructation by 12.0–13.6% (P < 0.05). Although the microbial composition of prokaryotes (bacteria and archaea) and protozoa in the rumen was not altered after PEO administration. MaAsLin2 analysis revealed that the abundance of Selenomonas, Christensenellaceae R-7 group, and Anaerovibrio were enriched in the rumen of PEO supplemented goats (Q < 0.1). Co-occurrence network analysis revealed that Lachnospiraceae AC2044 group and Anaerovibrio were the keystone taxa in the CON and PEO groups, respectively. Methane metabolism (P < 0.05) was enriched in the CON group, whereas metabolism of sulfur (P < 0.001) and propionate (P < 0.1) were enriched in the PEO group based on microbial predicted functions. After PEO administration, the abundance of 11 rumen and 4 serum metabolites increased, whereas that of 25 rumen and 14 serum metabolites decreased (P < 0.1). Random forest analysis identified eight ruminal metabolites that were altered after PEO administration, among which four were associated with propionate production, with predictive accuracy ranging from 0.75 to 0.88. Additionally, we found that serum sarcosine (serum metabolite) was positively correlated with CH4 emission parameters and abundance of Methanobrevibacter in the rumen (|r|≥ 0.5, P < 0.05). Conclusions: This study revealed that PEO administration reduced CH4 emission from of fattening goats with altered microbial interactions and metabolites in the rumen and host. Importantly, PEO administration affected utilizes various mechanisms such as formate, sulfur, methylated amines metabolism, and propionate production, collectively leading to CH4 reduction. The knowledge is important for future management strategies to maintain animal production and health while mitigate CH4 emission. [ABSTRACT FROM AUTHOR]

Kombucha is a fermented tea with a combination of yeast and bacteria. Kombucha teas may have a variable microbiota based on geographic origin and cultural conditions. The microbial flora of kombucha has been studied with culture-dependent methods. But, the improvement of the metataxonomic approach has broadened our perspective on fermented foods. In this study, a kombucha mother was procured from an artisanal supplier in Türkiye. High-throughput new-generation sequencing (16S rRNA and Internal Transcribed Spacer (ITS)) was carried out to investigate the microbial communities of kombucha after 7 days of fermentation in both liquid tea (L) and pellicle (P). Microbial counts, pH (4.42 ± 0.01 and 3.50 ± 0.02), and TA% (0.26 ± 0.02 and 0.60 ± 0.04) were also detected on the first and 7th days of fermentation. According to metataxonomic results, the dominant bacteria were Komagataeibacter obediens (%21.13), an acetic acid-producing bacteria, and the dominant fungal genus was Pichia kudriavzevii (64.35%) in L while Romboutsia sp. CE17 was the dominant bacteria (7%) and Pichia kudriavzevii was also the dominant yeast in P. This study also revealed different species which were not common in kombucha including propionic acid and butyric acid-producing bacteria such as Anaerotignum propionicum and Butyrivibrio fibrisolvens, a butyrivibriocin producing bacteria. Accordingly, different yeast species were detected such as Tetrapisispora phaffii and Ogataea polimorpha. [ABSTRACT FROM AUTHOR]

Background: Menstrual cups (MCs) are increasingly used to collect cervicovaginal secretions to characterise vaginal mucosal immunology, in conjunction with high vaginal swabs (HVS) for metataxonomics, particularly in HIV transmission studies. We hypothesised that both methods of collecting bacterial biomass are equivalent for 16S rRNA gene sequencing. Material and Methods: Cervicovaginal fluid (CVF) samples from 16 pregnant women with HIV-1 (PWWH) were included to represent the major vaginal bacterial community state types (CST I-V). Women underwent sampling during the second trimester by liquid amies HVS followed by a MC (Soft disc™) and samples were stored at -80°C. Bacterial cell pellets obtained from swab elution and MC (500 µL, 1 in 10 dilution) were resuspended in 120 µL PBS for DNA extraction. Bacterial 16S rRNA gene sequencing was performed using V1-V2 primers and were analysed using MOTHUR. Paired total DNA, bacterial load, amplicon read counts, diversity matrices and bacterial taxa were compared by sampling method using MicrobiomeAnalyst, SPSS and R. Results: The total DNA eluted from one aliquot of diluted CVF from an MC was similar to that of a HVS (993ng and 609ng, p=0.18); the mean bacterial loads were also comparable for both methods (MC: 8.0 log10 16S rRNA gene copies versus HVS: 7.9 log10 16S rRNA gene copies, p=0.27). The mean number of sequence reads generated from MC samples was lower than from HVS (MC: 12730; HVS:14830, p=0.05). The a-diversity metrices were similar for both techniques; MC Species Observed: 41 (range 12-96) versus HVS: 47 (range 16-96), p=0.15; MC Inverse Simpson Index: 1.98 (range 1.0-4.0) versus HVS: 0.48 (range 1.0-4.4), p=0.22). The three most abundant species observed were: Lactobacillus iners, Lactobacillus crispatus and Gardnerella vaginalis. Hierarchical clustering of relative abundance data showed that samples obtained using different techniques in an individual clustered in the same CST group. Conclusion: These data demonstrate that despite sampling slightly different areas of the lower genital tract, there was no difference in bacterial load or composition between methods. Both are suitable for characterisation of vaginal microbiota in PWWH. The MC offers advantages, including a higher volume of sample available for DNA extraction and complimentary assays. [ABSTRACT FROM AUTHOR]

Background and aims: The gut microbiota is implicated in the pathogenesis of colorectal cancer (CRC). We aimed to map the CRC mucosal microbiota and metabolome and define the influence of the tumoral microbiota on oncological outcomes. Methods: A multicentre, prospective observational study was conducted of CRC patients undergoing primary surgical resection in the UK (n = 74) and Czech Republic (n = 61). Analysis was performed using metataxonomics, ultra-performance liquid chromatography-mass spectrometry (UPLC-MS), targeted bacterial qPCR and tumour exome sequencing. Hierarchical clustering accounting for clinical and oncological covariates was performed to identify clusters of bacteria and metabolites linked to CRC. Cox proportional hazards regression was used to ascertain clusters associated with disease-free survival over median follow-up of 50 months. Results: Thirteen mucosal microbiota clusters were identified, of which five were significantly different between tumour and paired normal mucosa. Cluster 7, containing the pathobionts Fusobacterium nucleatum and Granulicatella adiacens, was strongly associated with CRC (PFDR = 0.0002). Additionally, tumoral dominance of cluster 7 independently predicted favourable disease-free survival (adjusted p = 0.031). Cluster 1, containing Faecalibacterium prausnitzii and Ruminococcus gnavus, was negatively associated with cancer (PFDR = 0.0009), and abundance was independently predictive of worse disease-free survival (adjusted p = 0.0009). UPLC-MS analysis revealed two major metabolic (Met) clusters. Met 1, composed of medium chain (MCFA), long-chain (LCFA) and very long-chain (VLCFA) fatty acid species, ceramides and lysophospholipids, was negatively associated with CRC (PFDR = 2.61 × 10−11); Met 2, composed of phosphatidylcholine species, nucleosides and amino acids, was strongly associated with CRC (PFDR = 1.30 × 10−12), but metabolite clusters were not associated with disease-free survival (p = 0.358). An association was identified between Met 1 and DNA mismatch-repair deficiency (p = 0.005). FBXW7 mutations were only found in cancers predominant in microbiota cluster 7. Conclusions: Networks of pathobionts in the tumour mucosal niche are associated with tumour mutation and metabolic subtypes and predict favourable outcome following CRC resection. E9vQ1bxk-JdT4E6GMYGhRX Video Abstract [ABSTRACT FROM AUTHOR]

Metatranscriptomics is a promising technique for the characterization of active members of microbial populations and their functions. Only a subset of the functional potential of the gut microbiota is expressed and many functions are transcribed only by few organisms when broadly present, but corresponding information for many other habitats is lacking. Transcriptional activity may predict bacterial growth and death; undertranscription relative to the DNA abundance indicates loss of the taxa, while overtranscription precedes future growth. Metatranscriptomics has revealed medically relevant expression signatures as exemplified by signatures associated with preterm labor and risk for developing asthma. Metatranscriptomics has in proof-of-concept studies provided a higher diagnostic yield than metagenomics for detecting infectious diseases, but results should be validated. Metatranscriptomics has revolutionized our ability to explore and understand transcriptional programs in microbial communities. Moreover, it has enabled us to gain deeper and more specific insight into the microbial activities in human gut, respiratory, oral, and vaginal communities. Perhaps the most important contribution of metatranscriptomics arises, however, from the analyses of disease-associated communities. We review the advantages and disadvantages of metatranscriptomics analyses in understanding human health and disease. We focus on human tissues low in microbial biomass and conditions associated with dysbiotic microbiota. We conclude that a more widespread use of metatranscriptomics and increased knowledge on microbe activities will uncover critical interactions between microbes and host in human health and provide diagnostic basis for culturing-independent, direct functional pathogen identification. [ABSTRACT FROM AUTHOR]

Dry fermented sausage innovation trends are linked to consumer preferences for clean label and sodium-reduced foods. This study aims to evaluate the effect of the formulation and production process temperature on the dynamics of bacterial communities in fuet-type dry fermented sausages using metataxonomics. Six fuet batches were manufactured, including formulations without and with the addition of nitrifying salts (replaced or not by pork liver auto-hydrolysate as a colouring agent), processed at 3 to 12 °C, and a partial replacement of NaCl by KCl, processed at 12 °C. Fermentation was performed spontaneously or by a starter culture. Physicochemical characterisation and culture-dependent and independent bacterial analyses were performed at day 0, 4 and 12, at the end of ripening (aw < 0.90) and after storage. Temperature was the most important factor determining the change in pH, aw and lactic acid bacteria levels while the presence of a starter culture promoted a pH decrease. Metataxonomic analysis showed that low temperature processes and the absence of nitrifying salts allowed the growth of spoilage-related species, while sausages submitted to a mild temperature containing a starter culture and nitrifying salts showed less bacterial diversity. Liver auto-hydrolysate added putative probiotic species to the product. This study provides valuable information to manufacturers who want to innovate safely. [ABSTRACT FROM AUTHOR]

This research investigated the application of in-situ biological hydrogen methanation within a continuous stirred tank reactor (CSTR) system under mesophilic conditions, with sewage sludge used as the substrate. Two CSTRs with an effective capacity of 5 L were installed and loaded with inoculum sludge with a volatile solid (VS) concentration of 1.2–1.5 %. They were fed mixed waste sludge with an organic loading rate (OLR) of 1.5 g VS/L and an average sludge retention time (SRT) of 19 days under mesophilic conditions at 37 °C. One of the reactors operated as a control, while the other was injected with H 2 through a microceramic membrane diffuser with a H 2 :CO 2 ratio of 4:1. The results of this study revealed that the addition of H 2 and the recirculation of residual hydrogen in biogas led to a substantial increase in the production of methane from 157 L/kg VS to 275 L/kg VS. Increasing the methane content in biogas from 52 % to 78 % yielded an impressive 42.8 % higher methane production rate. Metataxonomic analysis of the microbial community via high-throughput sequencing techniques revealed that the dominant acetoclastic and hydrogenotrophic methanogens were Methanosaeta and Methanoregula , respectively, with greater abundances of both groups in the experimental bioreactor. The dynamics of their activity in both bioreactors were analyzed via qPCR, and the functional genes encoding methyl-coenzyme M reductase (mcrA gene) and hydrogenase Ni-Fe presented comparable changes between RI and RII. By optimizing key operational parameters and closely examining the dynamics of the microbial community, this approach can contribute significantly to sustainable bioenergy solutions while minimizing environmental impact. [Display omitted] • Study on in-situ hydrogen methanation in mesophilic CSTRs using sewage sludge as a substrate. • Methane yield increased by 75 %,from 157 to 275 L/kgVS, with CH 4 content rising from 52 % to 78 %. • H₂ addition and recirculation increased methane production by 42.8 %. • Methanosaeta and Methanoregula were dominant methanogens, linked to higher methane output. [ABSTRACT FROM AUTHOR]

Edible mushrooms contain biologically active compounds with antioxidant, antimicrobial, immunomodulatory and anticancer properties. The link between their anticancer and immunomodulatory properties with their possible prebiotic activity on gut micro-organisms has been the subject of intense research over the last decade. Lyophilized Pleurotus eryngii (PE) mushrooms, selected due to their strong lactogenic effect and anti-genotoxic, immunomodulatory properties, underwent in vitro static batch fermentation for 24 h by fecal microbiota from eight elderly apparently healthy volunteers (>65 years old). The fermentation-induced changes in fecal microbiota communities were examined using Next Generation Sequencing of the hypervariable regions of the 16S rRNA gene. Primary processing and analysis were conducted using the Ion Reporter Suite. Changes in the global metabolic profile were assessed by 1H NMR spectroscopy, and metabolites were assigned by 2D NMR spectroscopy and the MetaboMiner platform. PLS-DA analysis of both metataxonomic and metabolomic data showed a significant cluster separation of PE fermented samples relative to controls. DEseq2 analysis showed that the abundance of families such as Lactobacillaceae and Bifidobacteriaceae were increased in PE samples. Accordingly, in metabolomics, more than twenty metabolites including SCFAs, essential amino acids, and neurotransmitters discriminate PE samples from the respective controls, further validating the metataxonomic findings. [ABSTRACT FROM AUTHOR]

Background: A growing body of evidence demonstrates a different bacterial composition in the oral cavity of patients with oral lichen planus (OLP). Patients and methods: Buccal swab samples were collected from affected and non-affected sites of six patients with reticular OLP and the healthy oral mucosa of six control subjects. 16S rRNA gene MiSeq sequencing and mass spectrometry-based proteomics were utilised to identify the metataxonomic and metaproteomic profiles of the oral microbiome in both groups. Results: From the metataxonomic analysis, the most abundant species in the three subgroups were Streptococcus oralis and Pseudomonas aeruginosa, accounting for up to 70% of the total population. Principal Coordinates Analysis showed differential clustering of samples from the healthy and OLP groups. ANCOM-BC compositional analysis revealed multiple species (including P. aeruginosa and several species of Veillonella, Prevotella, Streptococcus and Neisseria) significantly over-represented in the control group and several (including Granulicatella elegans, Gemella haemolysans and G. parahaemolysans) in patients with OLP. The metaproteomic data were generally congruent and revealed that several Gemella haemolysans-belonging peptidases and other proteins with inflammatory and virulence potential were present in OLP lesions. Conclusion: Our data suggest that several bacterial species are associated with OLP. Future studies with larger cohorts should be conducted to determine their role in the aetiology of OLP and evaluate their potential as disease biomarkers. [ABSTRACT FROM AUTHOR]

Kopanisti is a Greek PDO cheese, which is traditionally produced by the addition of an amount of over-mature Kopanisti, called Mana Kopanisti, to initiate cheese ripening. The aim of this study was the production of four types of Kopanisti cheese (A–D) using pasteurized cow milk, and a combination of the following starters/adjuncts in order to test their ability to be used in Kopanisti cheese production: A: Lactococcus lactis subsp. lactis and Lacticaseibacillus paracasei, B: L. lactis and Lc. paracasei/Mana Kopanisti, C: L. lactis and Lc. paracasei/Ligilactobacillus acidipiscis and Loigolactobacillus rennini, D: Lig. acidipiscis and Loig. rennini. Throughout production and ripening, classical microbiological, metataxonomics and physicochemical analyses were employed, while the final products (Day 35) were subjected to sensory analysis as well. Most interestingly, beta-diversity analysis of the metataxonomics data revealed the clusters constructed among the Kopanisti types based on the different inoculation schemes. On day 35, Kopanisti A–C types clustered together due to their similar 16S microbiota, while Kopanisti D was highly differentiated. On the contrary, ITS data clustered Kopanisti B and C together, while Kopanisti A and D were grouped seperately. Finally, based on the sensory evaluation, Kopanisti C appeared to have the most suitable bacteria cocktail for the Kopanisti cheese production. Therefore, not only were the conventional starters used, but also the Lig. acidipiscis and Loig. rennini strains could be used in a standardized Kopanisti cheese production that could lead to final products of high quality and safety. [ABSTRACT FROM AUTHOR]

Elderly was the most affected population during the first COVID-19 and those living in nursing homes represented the most vulnerable group, with high mortality rates, until vaccines became available. In a previous article, we presented an open-label trial showing the beneficial effect of the strain Ligilactobacillus salivarius CECT 30632 (previously known as L. salivarius MP101) on the functional and nutritional status, and on the nasal and fecal inflammatory profiles of elderly residing in a nursing home highly affected by the pandemic. The objective of this post-hoc analysis was to elucidate if there were changes in the nasal and fecal bacteriomes of a subset of these patients as a result of the administration of the strain for 4 months and, also, its impact on their fecal fatty acids profiles. Culture-based methods showed that, while L. salivarius (species level) could not be detected in any of the fecal samples at day 0, L. salivarius CECT 30632 (strain level) was present in all the recruited people at day 120. Paradoxically, the increase in the L. salivarius counts was not reflected in changes in the metataxonomic analysis of the nasal and fecal samples or in changes in the fatty acid profiles in the fecal samples of the recruited people. Overall, our results indicate that L. salivarius CECT 30632 colonized, at least temporarily, the intestinal tract of the recruited elderly and may have contributed to improvements in their functional, nutritional, and immunological status, without changing the general structure of their nasal and fecal bacteriomes when assessed at the genus level. They also suggest the ability of low abundance bacteria to train immunity. [ABSTRACT FROM AUTHOR]

Background: Post-mortem microbial communities are increasingly investigated as proxy evidence for a variety of factors of interest in forensic science. The reported predictive power of the microbial community to determine aspects of the individual’s post-mortem history (e.g., the postmortem interval) varies substantially among published research. This observed variation is partially driven by the local environment or the individual themselves. In the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach. Materials and methods: In the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach. Results: We found that season, temperature at the sampling site, BMI, and sex had a significant effect on the post-mortem microbiome, the presence of insects has a homogenizing influence on the total bacterial community, and that community consistency from repeat sampling decreases as the decomposition process progresses. Moreover, we demonstrate the importance of temperature at the site of sampling on the abundance of important diagnostic taxa. Conclusion: The results of this study suggest that while the bacterial community or specific bacterial species may prove to be useful for forensic applications, a clearer understanding of the mechanisms underpinning microbial decomposition will greatly increase the utility of microbial evidence in forensic casework. [ABSTRACT FROM AUTHOR]

Bacterial pathogens in the domestic environment present a risk to residents, particularly among susceptible populations. However, the impact of consumer demographic characteristics and food handling methods on kitchen microbiomes is not fully understood. The domestic kitchen bacterial communities of ten predominantly low-income families in Houston, TX, were assessed in conjunction with a cross-sectional food safety survey to evaluate differences in household and surface-specific microbiomes and bacterial foodborne pathogen presence. Three kitchen surfaces within each household, including the sink drain, the refrigerator handle, and the counter, were environmentally sampled and metataxonomically evaluated via targeted 16S rRNA sequencing. Disposable dish sponges were also acquired and examined. Results indicated that alpha diversity did not vary by the households, sampling locations, or demographic characteristics evaluated. Significant differences in beta diversity were observed among the bacterial communities of five pairs of households and between refrigerator handle and disposable dish sponge microbiomes. A total of 89 unique bacterial foodborne pathogens were identified across surface types. Each household contained at least one contaminated surface, and the most common bacterial foodborne pathogens identified were Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae. All parents reported washing their hands before meal preparation, washing fresh fruits and vegetables, and washing cutting boards with soap after use to prepare raw animal proteins. Gaps in food safety behaviors identified included a lack of serious concern for food contamination with germs and inappropriate handwashing, food handling, and cleaning behaviors. The number of unique bacterial foodborne pathogens identified within households was significantly higher among households whose respondent parent reported that they did not consider food contamination with germs to be a serious food safety problem (median: 41.0 species) compared to households whose respondent parent did consider food contamination to be a serious food safety problem (median: 3.0 species; p value=0.0218). These results demonstrate that domestic kitchen taxonomic abundance profiles vary according to household and surface type. Data suggest that low-income consumers may be at risk of foodborne pathogen exposure from contaminated home kitchen surfaces, and that food safety attitudes may directly contribute to this hazard. [ABSTRACT FROM AUTHOR]

Citrus is the most cultivated fruit crop worldwide. The modern citrus industry needs new bioproducts to overcome phytopathological threats, tolerate stresses and increase yield and quality. Mutualistic microbes from roots significantly impact host physiology and health and are a potentially beneficial resource. The bacterial microbiome can be surveyed to select potentially host-beneficial microbes. To achieve this goal, a prevalent "core-citrus" bacterial microbiome was obtained by picking those operational taxonomic units (OTUs) shared among samples within and across two Citrus rootstock genotypes grown in the same soil for more than 20 years. A sub-selection of main OTUs from the defined "core-citrus" microbiome was made based on abundance, host-enriched versus bulk soil, and rhizosphere-indicator species. In parallel, an extensive census of the cultivable microbiota was performed to collect a large number of bacterial citrus isolates. Metataxonomic data were linked to cultured microbes, matching 16S rRNA gene sequences from bacterial isolates with those counterpart OTU reference sequences from the selected bacterial "core-citrus" microbiome. This approach allowed selection of potentially host-beneficial bacteria to mine for agricultural probiotics in future biotechnological applications required for the citrus industry. [Display omitted] • Bacterial citrus microbiomes described using uncultured and cultured approaches. • The untapped diversity of host-associated bacteria as a source of benefits. • A collection of potentially beneficial bacteria for citrus is now available. • These bacteria could provide future agricultural probiotics required for the citrus industry. [ABSTRACT FROM AUTHOR]

Objectives: To characterize the healthy ocular surface microbiota at the species level, including cultured and uncultured taxa. Methods: We integrated the metataxonomic method with culturomics and genome sequencing analysis of selected isolated strains to better illustrate the taxonomic structure of the ocular surface microbiota. The metataxonomics used the full-length 16S rRNA gene sequences and the operational phylogenetic unit strategy, which can precisely identify the cultured and uncultured or potentially new taxa to species level based on the phylogenetic tree constructed. Results: We detected 1,731 operational phylogenetic units (OPUs) in 196 healthy eyes from128 people, affiliated to 796 cultured species, 784 potentially new species, and 151 potentially new higher taxa. The microbiota for each eye had 49.17 ± 35.66 OPUs. Of the 796 cultured species, 170 (21.36%) had previously caused clinical infections. Based on where they were initially isolated, the ocular surface microbiota mainly came from human body sites (34.55%), the environment (36.93%), plants (9.05%), animals (4.90%), and others; 428 strains were isolated from 20 eyes, affiliated to 42 species, and had come from the environment (33.33%) and the skin (16.67%). Of these, 47.62% had previously caused clinical infections. Genome analysis of 73 isolators revealed that 68.5% of them carried antibiotic resistance genes. The most frequently isolated genera, namely Staphylococcus, Streptococcus, and Moraxella, had an average of 5.30, four, and three resistance genes per strain, respectively. Discussion: The study found that the ocular surface microbiota mainly came from the environment, plants, animals, food, and human body sites such as the skin, oral cavity, upper respiratory tract, etc. No core member of ocular surface microbiota was detected at the species level. The human eyes were invaded and colonized by bacteria from the exposed environment, some of which were capable of causing infections in humans and carried antibiotic resistance genes. Preventive measures should be developed to protect our eyes from danger. [ABSTRACT FROM AUTHOR]

This study examines the impact of the complex microbiota from long-term fermented kimchi, used as a backslop, on fermentation dynamics. The fermentation was conducted with autoclaved (group A) and non-autoclaved (NA) starter cultures. Bacterial and fungal communities were analyzed with 16S rRNA gene V4 and ITS2 region, respectively, and metabolites were profiled using gas chromatography–mass spectrometry. In the group NA, Levilactobacillus dominated at 64.3 % by day 5, while Pediococcus reached 57.4 % by day 50. Principal coordinate analysis showed that bacterial communities in both the starter culture and samples of the group NA became similar by the end of the fermentation (day 100); however, no significant differences were found in fungal community. Principal component analysis revealed distinct metabolite profiles, explaining 68.7 % of variability on PC1, with each group clustered separately by day 100. These results suggest that inoculating with microbiota from long-term fermentation can rapidly produce foods with desirable characteristics. • Bacterial community in kimchi resembled that of starter culture after 100 days. • Pediococcus constituted 57.4 % of total ASVs on day 50 in non-autoclaved group. • Metabolite profiles formed distinctly separated clusters based on time points. [ABSTRACT FROM AUTHOR]

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety. [ABSTRACT FROM AUTHOR]

The study of microbial communities or microbiotas in animals and environments is important because of their impact in a broad range of industrial applications, diseases and ecological roles. High throughput sequencing (HTS) is the best strategy to characterize microbial composition and function. Microbial profiles can be obtained either by shotgun sequencing of genomes, or through amplicon sequencing of target genes (e.g., 16S rRNA for bacteria and ITS for fungi). Here, we compared both HTS approaches at assessing taxonomic and functional diversity of bacterial and fungal communities during vermicomposting of white grape marc. We applied specific HTS workflows to the same 12 microcosms, with and without earthworms, sampled at two distinct phases of the vermicomposting process occurring at 21 and 63 days. Metataxonomic profiles were inferred in DADA2, with bacterial metabolic pathways predicted via PICRUSt2. Metagenomic taxonomic profiles were inferred in PathoScope, while bacterial functional profiles were inferred in Humann2. Microbial profiles inferred by metagenomics and metataxonomics showed similarities and differences in composition, structure, and metabolic function at different taxonomic levels. Microbial composition and abundance estimated by both HTS approaches agreed reasonably well at the phylum level, but larger discrepancies were observed at lower taxonomic ranks. Shotgun HTS identified ~1.8 times more bacterial genera than 16S rRNA HTS, while ITS HTS identified two times more fungal genera than shotgun HTS. This is mainly a consequence of the difference in resolution and reference richness between amplicon and genome sequencing approaches and databases, respectively. Our study also revealed great differences and even opposite trends in alpha- and beta-diversity between amplicon and shotgun HTS. Interestingly, amplicon PICRUSt2-imputed functional repertoires overlapped ~50% with shotgun Humann2 profiles. Finally, both approaches indicated that although bacteria and fungi are the main drivers of biochemical decomposition, earthworms also play a key role in plant vermicomposting. In summary, our study highlights the strengths and weaknesses of metagenomics and metataxonomics and provides new insights on the vermicomposting of white grape marc. Since both approaches may target different biological aspects of the communities, combining them will provide a better understanding of the microbiotas under study. [ABSTRACT FROM AUTHOR]

The ecological dysbiosis of a biofilm includes not only bacterial changes but also changes in their metabolism. Related to oral biofilms, changes in metabolic activity are crucial endpoint, linked directly to the pathogenicity of oral diseases. Despite the advances in caries research, detailed microbial and metabolomic etiology is yet to be fully clarified. To advance this knowledge, a meta‐taxonomic approach based on 16S rRNA gene sequencing and an untargeted metabolomic approach based on an ultra‐high performance liquid chromatography‐quadrupole time‐of‐flight mass spectrometry analysis (UHPLC/Q‐TOF‐MS) were conducted. To this end, an in vitro biofilm model derived from the saliva of healthy participants were developed, under commensal and cariogenic conditions by adding sucrose as the disease trigger. The cariogenic biofilms showed a significant increase of Firmicutes phyla (p = 0.019), due to the significant increase in the genus Streptococcus (p = 0.010), and Fusobacter (p < 0.001), by increase Fusobacterium (p < 0.001) and Sphingomonas (p = 0.024), while suffered a decrease in Actinobacteria (p < 0.001). As a consequence of the shift in microbiota composition, significant extracellular metabolomics changes were detected, showed 59 metabolites of the 120 identified significantly different in terms of relative abundance between the cariogenic/commensal biofilms (Rate of change > 2 and FDR < 0.05). Forty‐two metabolites were significantly higher in abundance in the cariogenic biofilms, whereas 17 metabolites were associated significantly with the commensal biofilms, principally related protein metabolism, with peptides and amino acids as protagonists, latter represented by histidine, arginine, l‐methionine, glutamic acid, and phenylalanine derivatives. [ABSTRACT FROM AUTHOR]

In this paper, we consider the development of reliable tools to assess the water quality and state of aquatic ecosystems in dynamic conditions a crucial need to address. One of such tools could be devised by monitoring the taxonomic structure of reservoirs' microbiomes. Microbial taxa's ecological and metabolic characteristics suggest their essential roles in maintaining the water ecosystem's environmental equilibrium. The study aimed to explain the role of diversity and seasonal variability of the microbial communities in the ecosystem stability on the example of Goczałkowice Reservoir (Poland). The structure of the reservoir microbiome was studied using bioinformatics and modeling techniques. Water was sampled periodically in July & November 2010, and April 2011 at four representative sites. The abundance and relative fraction of the limnetic taxonomic units were determined in respect to the physicochemical indices. Significant seasonal variations in the number of operational taxonomic units (OTU) were observed within the reservoir basin's main body but not at the main tributary's mouth. The highest values of the correlation coefficients between OTU and physicochemical variables were obtained for Burkholderiales, Pseudoanabenales, Rickettsiales, Roseiflexales, Methylophilales, Actinomycetales, and Cryptophyta. These microorganisms are proposed as indicators of environmental conditions and water quality. Metataxonomic analyses of the freshwater microbiome in the reservoir, showed that microorganisms constitute conservative communities that undergo seasonal and local changes regarding the relative participation of the identified taxa. Therefore, we propose that monitoring those variations could provide a reliable measure of the state of aquatic ecosystems. [ABSTRACT FROM AUTHOR]

Background: Vaginal microbiota (VMB) composition is altered in women with cervical intra-epithelial neoplasia (CIN) compared to healthy controls and is associated with disease progression. However, the impact of CIN excision on the VMB and innate immunity is not known. This observational study aims to explore the impact of CIN excision on the VMB, antimicrobial peptides (AMP) and proinflammatory cytokines. Methods: We sampled 103 non-pregnant, premenopausal women at the time of excisional treatment for CIN and at their 6-month follow-up visit. A further 39 untreated controls with normal cytology were also sampled. We used metataxonomics to group vaginal swab samples into community state types (CSTs) and ELISA to quantify cytokine and AMP levels in matched vaginal secretions. Analyses were performed to compare the bacterial composition and immune analyte levels before and after CIN excision and in healthy controls. Results: Women with CIN had significantly higher rates of Lactobacillus species depletion pre-treatment compared to healthy controls (CST IV 21/103, 20% vs 1/39, 3%, p = 0.0081). Excision did not change the VMB composition, with CST IV remaining significantly more prevalent after excision compared to untreated, healthy controls (CST IV 19/103, 20% vs 1/39, 3%, p = 0.0142). Prevotella bivia and Sneathia amnii were significantly higher in samples before treatment compared to untreated controls, and Prevotella bivia remained significantly higher amongst the treated, with less Lactobacillus crispatus compared to untreated controls. IL-1β and IL-8 remained significantly elevated pre- (p < 0.0001 and p = 0.0014, respectively) and post-treatment (p < 0.0001 and p = 0.0035, respectively) compared to untreated controls. Levels of human beta-defensin-1 and secretory leukocyte protease inhibitor were both significantly reduced following CIN excision (p < 0.0001); however, their levels remained lower than controls post-treatment. Conclusions: Women with CIN have an increased prevalence of Lactobacillus sp. depletion, high-diversity VMB composition, and higher levels of proinflammatory cytokines and AMPs compared to normal controls. Surgical excision of the disease reduces levels of vaginal AMPs but does not alter VMB composition or cytokine levels. These findings suggest that women with CIN have an inherent predisposition to a high-diversity proinflammatory environment that is not corrected by disease excision. The failure to re-establish a Lactobacillus-enriched CST may explain why women remain at high risk of pre-invasive and invasive disease recurrence. [ABSTRACT FROM AUTHOR]

Characterization of microbial assemblages via environmental DNA metabarcoding is increasingly being used in routine monitoring programs due to its sensitivity and cost‐effectiveness. Several programs have recently been developed which infer functional profiles from 16S rRNA gene data using hidden‐state prediction (HSP) algorithms. These might offer an economic and scalable alternative to shotgun metagenomics. To date, HSP‐based methods have seen limited use for benthic marine surveys and their performance in these environments remains unevaluated. In this study, 16S rRNA metabarcoding was applied to sediment samples collected at 0 and ≥1,200 m from Norwegian salmon farms, and three metabolic inference approaches (Paprica, Picrust2 and Tax4Fun2) evaluated against metagenomics and environmental data. While metabarcoding and metagenomics recovered a comparable functional diversity, the taxonomic composition differed between approaches, with genera richness up to 20× higher for metabarcoding. Comparisons between the sensitivity (highest true positive rates) and specificity (lowest true negative rates) of HSP‐based programs in detecting functions found in metagenomic data ranged from 0.52 and 0.60 to 0.76 and 0.79, respectively. However, little correlation was observed between the relative abundance of their specific functions. Functional beta‐diversity of HSP‐based data was strongly associated with that of metagenomics (r ≥ 0.86 for Paprica and Tax4Fun2) and responded similarly to the impact of fish farm activities. Our results demonstrate that although HSP‐based metabarcoding approaches provide a slightly different functional profile than metagenomics, partly due to recovering a distinct community, they represent a cost‐effective and valuable tool for characterizing and assessing the effects of fish farming on benthic ecosystems. [ABSTRACT FROM AUTHOR]

The present study aimed to determine whether dietary supplementation with methanogen inhibitors during early life may lead to an imprint on the rumen microbial community and change the rumen function and performance of calves to 49-weeks of rearing. Twenty-four 4-day-old Friesian x Jersey cross calves were randomly assigned into a control and a treatment group. Treated calves were fed a combination of chloroform (CF) and 9,10-anthraquinone (AQ) in the solid diets during the first 12 weeks of rearing. Afterward, calves were grouped by treatments until week 14, and then managed as a single group on pasture. Solid diets and water were offered ad libitum. Methane measurements, and sample collections for rumen metabolite and microbial community composition were carried out at the end of weeks 2, 4, 6, 8, 10, 14, 24 and 49. Animal growth and dry matter intake (DMI) were regularly monitored over the duration of the experiment. Methane emissions decreased up to 90% whilst hydrogen emissions increased in treated compared to control calves, but only for up to 2 weeks after treatment cessation. The near complete methane inhibition did not affect calves' DMI and growth. The acetate:propionate ratio decreased in treated compared to control calves during the first 14 weeks but was similar at weeks 24 and 49. The proportions of Methanobrevibacter and Methanosphaera decreased in treated compared to control calves during the first 14 weeks; however, at week 24 and 49 the archaea community was similar between groups. Bacterial proportions at the phylum level and the abundant bacterial genera were similar between treatment groups. In summary, methane inhibition increased hydrogen emissions, altered the methanogen community and changed the rumen metabolite profile without major effects on the bacterial community composition. This indicated that the main response of the bacterial community was not a change in composition but rather a change in metabolic pathways. Furthermore, once methane inhibition ceased the methanogen community, rumen metabolites and hydrogen emissions became similar between treatment groups, indicating that perhaps using the treatments tested in this study, it is not possible to imprint a low methane microbiota into the rumen in the solid feed of pre-weaned calves. [ABSTRACT FROM AUTHOR]

This study investigated the effects of consumption of wheat-durum pasta added of Bifidobacterium animalis inactivated by gamma-irradiation (paraprobiotic) on health and gut microbiota of rats. Twenty-one male rats were divided into three groups as follow: control (Control) receiving standard diet; pasta control (PC) receiving diet containing pasta, and paraprobiotic pasta Bifidobacterium-irradiated (PPBI), receiving paraprobiotic pasta. The serum levels of glucose and total cholesterol were reduced (p < 0.05) in PPBI when compared to the Control (p < 0.05). PPBI showed high abundance (p ˂ 0.05) of Firmicutes and Actinobacteria and a lower abundance of Bacteriodes compared to Control and PC. Besides, the PPBI showed high abundance (p ˂ 0.05) of Clostridiales, Lactobacillales; Bifidobacteriales, Bacillales, and Coriobacteriales in comparison to Control. Specific genera such as Bifibacterium, Lactobacillus, Ruminococcus, Allobaculum, and Blautia were more related to PPBI. Findings reveal wheat-durum pasta as a potential vehicle for delivering paraprobiotics B. animalis. [ABSTRACT FROM AUTHOR]

The floods of 2018 caused havoc in the State of Kerala, situated in the extreme south‐west of India, in terms of infrastructure and health. This research article provides the first‐ever assessment of the bacterial diversity and its antibiotic susceptibility of the inundated areas of Pampa, Periyar and Vembanad waterbodies by comparing the data collected in two different time intervals succeeding the calamitous floods that is, immediately after flood and 5 months post‐flood. An elevated total coliform count was detected in the waterbodies after the flood thereby rendering it unsafe for drinking. Variation in bacterial diversity was observed in the river and lake water samples with a distinct increase in that of the river samples immediately after flood indicated by shannon diversity index (>5.5). Resistance to ampicillin and cefotaxime was observed in a major proportion of isolates from the three biotopes thus indicating the influence of antibiotic wastes accumulated from different sources of human interventions. Furthermore, operational taxonomic units clustering to Acinetobacter, Legionella, Pseudomonas and Burkholderia genera were detected by metataxonomic analysis which portray as a potential health risk in the future. The article emphasises the importance of adopting sanitation programmes for effective management of epidemic outbreaks post floods. [ABSTRACT FROM AUTHOR]

Our view of the periodontal microbial community has been shaped by a century or more of cultivation-based and microscopic investigations. While these studies firmly established the infection-mediated etiology of periodontal diseases, it was apparent from the very early days that periodontal microbiology suffered from what Staley and Konopka described as the "great plate count anomaly", in that these culturable bacteria were only a minor part of what was visible under the microscope. For nearly a century, much effort has been devoted to finding the right tools to investigate this uncultivated majority, also known as "microbial dark matter". The discovery that DNA was an effective tool to "see" microbial dark matter was a significant breakthrough in environmental microbiology, and oral microbiologists were among the earliest to capitalize on these advances. By identifying the order in which nucleotides are arranged in a stretch of DNA (DNA sequencing) and creating a repository of these sequences, sequence databases were created. Computational tools that used probability-driven analysis of these sequences enabled the discovery of new and unsuspected species and ascribed novel functions to these species. This review will trace the development of DNA sequencing as a quantitative, open-ended, comprehensive approach to characterize microbial communities in their native environments, and explore how this technology has shifted traditional dogmas on how the oral microbiome promotes health and its role in disease causation and perpetuation. [ABSTRACT FROM AUTHOR]

The human body immune system, metabolism and homeostasis are affected by microbes. Dysbiosis occurs when the homeostatic equilibrium is disrupted due to an alteration in the normal microbiota of the intestine. Dysbiosis can cause cancer, and also affect a patient's ability to respond to treatment. Metataxonomics seeks to identify the bacteria present in a biological sample, based on the sequencing of the 16S rRNA genetic marker. Precision medicine attempts to find relationships between the microbiota and the risk of acquiring cancer, and design new therapies targeting bacteria. Flexible and portable bioinformatic pipelines are necessary to be able to bring metataxonomics to the clinical field, which allow groups of biological samples to be classified according to their diversity in the microbiota. With this aim we implemented Metatax, a new pipeline to analyze biological samples based on 16S rRNA gene sequencing. The results obtained with our pipeline should complement those obtained by sequencing a patient's DNA and RNA, in addition to clinical data, to improve knowledge of the possible reasons for a disease or a worse response to treatment. [ABSTRACT FROM AUTHOR]

The current understanding of human gut microbial community is mainly limited to taxonomic features at the genus level. Here, we examined the human gut microbial community at the species level by metataxonomics. To achieve this purpose, a high-throughput approach involving operational phylogenetic unit analysis of the near full-length 16S ribosomal RNA (rRNA) gene sequence was used. A total of 1,235 species-level phylotypes (SLPs) were classified in the feces of 120 Chinese healthy individuals, including 461 previously classified species, 358 potentially new species, and 416 potentially new taxa, which were categorized into low, medium, and high prevalent bacteria groups based on their prevalence. Each individual harbored 186 ± 51 SLPs on average. There was no universal bacterial species shared by all the individuals. However, 90 ± 19 of 116 SLPs were shared in the high prevalent bacteria group. Thirty-two out of thirty-eight species in the high prevalent bacteria group detected in this study were also found in at least one previous study on human gut microbiota based on either culture-dependent or culture-independent approaches. Through compositional analysis, a hierarchical clustering of the prevalence and relative abundance of the 1,235 SLPs revealed two types of gut microbial communities, which were dominated by Prevotella copri and Bacteroides vulgatus , respectively. The type dominated by P. copri was more prevalent in northern China, while the B. vulgatus- dominant type was more prevalent in southern China. Therefore, P- and B-type gut microbial communities in China were proposed. It was found that 166 out of 461 known bacterial species have been previously reported as potential pathogens, and the individuals sampled for this study harbored 20 of these potential pathogenic species on average. The top two most abundant and prevalent potential pathogenic species were Klebsiella pneumoniae and Bacteroides fragilis. [ABSTRACT FROM AUTHOR]

The complex rumen microbiota exhibits some degree of host specificity. The undeveloped simple rumen microbiota is hypothetically more amendable. The objective of this study was to investigate if the rumen prokaryotic microbial assemblage of young calves can be reprogrammed by oral inoculation with rumen microbiota of adult cows. Twenty newborn male calves were randomly assigned to four groups (n = 5 per group), with two groups being orally inoculated with rumen microbiota (fresh rumen fluid) collected from two lactating dairy cows, while the other two groups receiving autoclaved rumen fluid collected from another two donor cows. Each calf was orally drenched with 100, 200, 300, 400, and 500 mL of the rumen fluid at d3, d7, d21, d42, and d50, respectively, after birth. The inoculation with rumen microbiota did not affect (P > 0.05) feed intake, average daily gain (ADG), heart girth, or feed conversion ratio but significantly (P < 0.01) lowered instance of diarrhea. At the age of 77 days (27 days post-weaning), all the calves were slaughtered for the sampling of rumen content and determination of empty rumen weight. Rumen fermentation characteristics were not affected (P > 0.05) by the inoculation. Rumen prokaryotic microbiota analysis using metataxonomics (targeting the V4 region of the 16S rRNA genes) showed that the calf rumen prokaryotic microbiota differed from that of the donors. Two Succinivibrionaceae OTUs, two Prevotella OTUs, and one Succiniclasticum OTU were predominant (relative abundance > 2%) in the donors, but only one Succinivibrionaceae OTU was found in the calves. On the other hand, five other Prevotella OTUs were predominant (>3%) in the calves, but none of them was a major OTU in the donors. No correlation was observed in relative abundance of major OTUs or genera between the donor and the calves. Principal coordinates analysis (PCoA) based on weighted UniFrac distance showed no significant (P > 0.05) difference in the overall rumen prokaryotic microbiota profiles among the four calf groups, and principal component analysis (PCA) based on Bray-Curtis dissimilarity showed no significant (P > 0.05) difference in functional features predicted from the detected taxa. Nor the calf rumen microbiota showed any clustering with their donor's. Repeated oral inoculation with rumen microbiota probably has a limited effect on the development of rumen microbiota, and the rumen microbiota seems to develop following a program determined by the host and other factors. [ABSTRACT FROM AUTHOR]

Conservation Agriculture has been the subject of numerous studies for decades. However, its impact on the soil microbial community has often been overlooked. Recent studies have shed light on the changes in soil bacterial composition resulting from modifications in tillage practices, particularly when compared to conventional tillage methods. However, there is a lack of soil microbial community analysis conducted under conservation tillage and rainfed conditions in the Mediterranean basin. A metataxonomic approach was employed to assess the influence of 19 years (2004–2022) of minimum tillage (MT) and no-till (NT) practices, along with crop rotation, on the soil bacterial community at upper layers (15 cm depth). This field study involved three different seasonal moments throughout the year. Results revealed that both sampling time and tillage management significantly influenced the structure of the bacterial community, whereas no effect was observed due to the crop. May showed a higher taxonomic diversity than July and December, showing differences in some o fthe most abundant phyla, such as Actinobacteria, Firmicutes and Proteobacteria. On the other hand, the long-term application of NT was found to lead to a significant decrease in bacterial diversity, with lower abundances of the phyla Chloroflexi, Gemmatimonadetes, and Armatimonadota, as well as an increase in k-strategist bacteria compared to MT. However, no significant effect on alpha diversity was observed as a result of tillage. no variations in phyla composition were observed attributable to crop, as the primary distinctions were identified among legume crops, which were associated with different sampling times. Therefore, our conclusion is that over this period, NT did not promote microbial diversity in the upper soil layers, despite notable shifts in bacterial composition occurring across seasonal time points in both tillage management systems. [Display omitted] • Sampling time is a critical factor in metataxonomic analysis of soils. • Tillage management has a significant effect on soil bacterial communities. • No-tillage significantly reduces soil bacterial diversity. • No-till practices promote the enrichment k-strategist taxa of bacteria. [ABSTRACT FROM AUTHOR]

The Bay of Bengal, located in the north-eastern part of the Indian Ocean is world's largest bay occupying an area of ~8,39,000 mile2. The variability in bacterial community structure and function in sediment ecosystems of the Bay of Bengal is examined by Illumina high-throughput metagenomic sequencing. Of five metataxonomics data sets presented, two (SD1 and SD2) were from stations close to the shore and three (SD4, SD5, and SD6) were from the deep-sea (~3000 m depth). Phylum Proteobacteria (90.27 to 92.52%) dominated the deep-sea samples, whereas phylum Firmicutes (65.35 to 90.98%) dominated the coastal samples. Comparative analysis showed that coastal and deep-sea sediments showed distinct microbial communities. Wolbachia species, belonging to class Alphaproteobacteria was the most dominant species in the deep-sea sediments. The gene functions of bacterial communities were predicted for deep-sea and coastal sediment ecosystems. The results indicated that deep-sea sediment bacterial communities were involved in metabolic activities like dehalogenation and sulphide oxidation. [ABSTRACT FROM AUTHOR]

Mitigation of greenhouse gas emissions is relevant for reducing the environmental impact of ruminant production. In this study, the rumen microbiome from Holstein cows was characterized through a combination of 16S rRNA gene and shotgun metagenomic sequencing. Methane production (CH4) and dry matter intake (DMI) were individually measured over 4–6 weeks to calculate the CH4 yield (CH4y = CH4/DMI) per cow. We implemented a combination of clustering, multivariate and mixed model analyses to identify a set of operational taxonomic unit (OTU) jointly associated with CH4y and the structure of ruminal microbial communities. Three ruminotype clusters (R1, R2 and R3) were identified, and R2 was associated with higher CH4y. The taxonomic composition on R2 had lower abundance of Succinivibrionaceae and Methanosphaera, and higher abundance of Ruminococcaceae, Christensenellaceae and Lachnospiraceae. Metagenomic data confirmed the lower abundance of Succinivibrionaceae and Methanosphaera in R2 and identified genera (Fibrobacter and unclassified Bacteroidales) not highlighted by metataxonomic analysis. In addition, the functional metagenomic analysis revealed that samples classified in cluster R2 were overrepresented by genes coding for KEGG modules associated with methanogenesis, including a significant relative abundance of the methyl‐coenzyme M reductase enzyme. Based on the cluster assignment, we applied a sparse partial least‐squares discriminant analysis at the taxonomic and functional levels. In addition, we implemented a sPLS regression model using the phenotypic variation of CH4y. By combining these two approaches, we identified 86 discriminant bacterial OTUs, notably including families linked to CH4 emission such as Succinivibrionaceae, Ruminococcaceae, Christensenellaceae, Lachnospiraceae and Rikenellaceae. These selected OTUs explained 24% of the CH4y phenotypic variance, whereas the host genome contribution was ~14%. In summary, we identified rumen microbial biomarkers associated with the methane production of dairy cows; these biomarkers could be used for targeted methane‐reduction selection programmes in the dairy cattle industry provided they are heritable. [ABSTRACT FROM AUTHOR]

The genus Treponema contains a number of human and animal pathogenic as well as symbiotic bacteria that are found in vastly different anatomical and environmental habitats. Our understanding of the species range, evolution, and biology of these important bacteria is still limited. To explore the diversity of treponemes, we established, validated, and tested a novel metataxonomic approach. As the informative nature of the hypervariable regions of the 16S rRNA gene differ, we first analyzed each variable region independently. Considering the in silico results obtained, we established and validated the sequencing of the V4-region of the 16S rRNA gene using known mixtures of Treponema species as well as a selected number of clinical samples. The metataxonomic approach was able to identify Treponema to a near-species level. We demonstrate that using a spirochete-specific enrichment, our method is applicable to complex microbial communities and large variety of biological samples. The metataxonomic approach described provides a useful method to unravel the full diversity and range of Treponema in various ecosystems. [ABSTRACT FROM AUTHOR]

Purpose: To compare bacteria recovered by standard cultures and metataxonomics, particularly with regard to ventilator-associated pneumonia (VAP) pathogens, and to determine if the presence of particular bacteria or microbiota in tracheal and oropharyngeal secretions during the course of intubation was associated with the development of VAP.Methods: In this case-control study, oropharyngeal secretions and endotracheal aspirate were collected daily in mechanically ventilated patients. Culture and metataxonomics (16S rRNA gene-based taxonomic profiling of bacterial communities) were performed on serial upper respiratory samples from patients with late-onset definite VAP and their respective controls.Results: Metataxonomic analyses showed that a low relative abundance of Bacilli at the time of intubation in the oropharyngeal secretions was strongly associated with the subsequent development of VAP. On the day of VAP, the quantity of human and bacterial DNA in both tracheal and oropharyngeal secretions was significantly higher in patients with VAP than in matched controls with similar ventilation times. Molecular techniques identified the pathogen(s) of VAP found by culture, but also many more bacteria, classically difficult to culture, such as Mycoplasma spp. and anaerobes.Conclusions: Molecular analyses of respiratory specimens identified markers associated with the development of VAP, as well as important differences in the taxa abundance between VAP and controls. Further prospective trials are needed to test the predictive value of these markers, as well as the relevance of uncultured bacteria in the pathogenesis of VAP. [ABSTRACT FROM AUTHOR]

Although the diversity of microbial communities (microbiota) inhabiting body niches are of proven importance to health in both humans and non-human animals, the functional importance of these collective genomes (microbiome) to the adaptive potential of their hosts has only recently been considered within a conservation framework. If loss of gut biodiversity threatens the health (and therefore the fitness of individuals), and this loss can be correlated with the adaptive potential of a species in changing environments, measuring functional composition of the microbiota from non-invasive samples, such as faeces and skin swabs, could provide a useful and practical tool for determining conservation priorities. This article reviews the evidence for adaptive potential of microbiota in wild species, and proposes future directions. While there is ample indication of inter- and intra-specific variation in microbiota diversity, there is little evidence that diversity per se confers fitness. However, there are convincing examples showing that microbiota flexibility, composition and function may well be sources of adaptive potential, although case studies are relatively few, and the analytical approaches needed to demonstrate the mechanisms underlying host-microbiota interactions have only recently been developed. [ABSTRACT FROM AUTHOR]

The operational temperature and nature of the substrates are two critical parameters in shaping the functional microbiota and determining the biogas productivity of field-scale anaerobic digesters. Elucidating microbial ecological configurations and dynamics as a function of parametric (temperature, pH, substrate variability etc.) variations is pivotal for effective process management, improving the process stability and digestion efficiency of large field-scale anaerobic digesters. Seventeen field-scale digesters treating food waste leachate, municipal wastewater sludge (MWS), and manure at 10 different sites across the Republic of Korea were studied to assess how substrate variations, including co-digestion and seasonal variation, affect biogas productivity and the compositional dynamics of the digester microbiota. The 16S rRNA gene metataxonomics and predictive metabolic pathway profiling revealed significant differences in the phylogenetic composition of the microbiota between the digester types depending on the presence of MWS in the substrate (p < 0.005). A clear compositional divergence was observed between the MWS and non-MWS substrate groups, with a high prevalence of Firmicutes and versatile organic matter-degrading genera (Fastidiosipila , Acholeplasma , etc.) in the non-MWS digesters, resulting in a significantly high biogas yield (53.4 Nm3/t). Predictive metabolic pathway profiling demonstrated the importance of acetoclastic methanogenesis in all anaerobic digestion groups subjected to the study. The results of this study suggest that metataxonomics and microbiota dynamics are good indicators of the process stability and efficiency of field-scale digesters across the parametric variations of field anaerobic digester systems. • Microbiota dynamics in large field-scale AD of various substrates were assessed. • A significant microbiota variance was observed between MWS and FWL-fed digesters. • Microbial dynamics of FWL digester group reflect significantly high biogas yield. • FWL digesters had high METH-ACETATE-PWY (acetoclastic methanogenesis) activity. [ABSTRACT FROM AUTHOR]

The metataxonomic approach combining 16S rRNA gene amplicon sequencing using the PacBio Technology with the application of the operational phylogenetic unit (OPU) approach, has been used to analyze the fecal microbial composition of the high-altitude and herbivorous Tibetan antelopes. The fecal samples of the antelope were collected in Hoh Xil National Nature Reserve, at an altitude over 4500 m, the largest depopulated zone in Qinghai-Tibetan Plateau, China, where non-native animals or humans may experience life-threatening acute mountain sickness. In total, 104 antelope fecal samples were enrolled in this study, and were clustered into 61,258 operational taxonomic units (OTUs) at an identity of 98.7% and affiliated with 757 OPUs, including 144 known species, 256 potentially new species, 103 potentially higher taxa within known lineages. In addition, 254 comprised sequences not affiliating with any known family, and the closest relatives were unclassified lineages of existing orders or classes. A total of 42 out of 757 OPUs conformed to the core fecal microbiome, of which four major lineages, namely, un-cultured Ruminococcaceae, Lachnospiraceae, Akkermansia , and Christensenellaceae were associated with human health or longevity. The current study reveals that the fecal core microbiome of antelope is mainly composited of uncultured bacteria. The most abundant core taxa, namely, uncultured Ruminococcaceae , uncultured Akkermansia , uncultured Bacteroides , uncultured Christensenellaceae , uncultured Mollicutes , and uncultured Lachnospiraceae , may represent new bacterial candidates at high taxa levels, and several may have beneficial roles in health promotion or anti-intestinal dysbiosis. These organisms should be further isolated and evaluated for potential effect on human health and longevity. [ABSTRACT FROM AUTHOR]

Fermented sausages have a long tradition originating from Europe and they constitute a significant part of the Mediterranean diet. This kind of products has a specific microbiota that is typical of the region or area where they are produced. Therefore, in order to protect the traditional aspect of these products, it is essential to understand the microbial ecology during fermentation by studying the dynamic changes that occur and to select autochthonous starter cultures that can be used in the production. In this paper we summarize the state of the art concerning the selection and use of starter cultures and ecology aspects of naturally fermented sausages. We pay particular attention to the application of bacteriocinogenic strains as they could provide an additional tool in the prevention of foodborne pathogens as well as enhancing the competitiveness of the starter organisms. Microbial ecology of fermented sausages has been determined by traditional microbiological methods, but the introduction in food microbiology of new molecular techniques complements the studies carried out so far and allows scientists to overcome the limitations of traditional methods. Next Generation Sequencing (NGS) techniques represent a change in the way microbiologists address ecology and diversity in foods. Indeed the application of metataxonomics and metagenomics will permit a detailed understanding of microbial ecology. A thorough knowledge of the mechanisms behind the biological processes will enhance meat fermentation control and modulation to obtain products with desired organoleptic properties. [ABSTRACT FROM AUTHOR]

Whilst the interplay between host genetics and the environment plays a pivotal role in the aetiopathogenesis of cancer, there are other key contributors of importance as well. One such factor of central and growing interest is the contribution of the microbiota to cancer. Even though the field is only a few years old, investigation of the 'cancer microbiome' has already led to major advances in knowledge of the basic biology of cancer risk and progression, opened novel avenues for biomarkers and diagnostics, and given a better understanding of mechanisms underlying response to therapy. Recent developments in microbial DNA sequencing techniques (and the bioinformatics required for analysis of these datasets) have allowed much more in-depth profiling of the structure of microbial communities than was previously possible. However, for more complete assessment of the functional implications of microbial changes, there is a growing recognition of the importance of the integration of microbial profiling with other omics modalities, with metabonomics (metabolite profiling) and proteomics (protein profiling) both gaining particular recent attention. In this review, we give an overview of some of the key scientific techniques being used to unravel the role of the cancer microbiome. We have aimed to highlight practical aspects related to sample collection and preparation, choice of the modality of analysis, and examples of where different omics technologies have been complementary to each other to highlight the significance of the cancer microbiome. [ABSTRACT FROM AUTHOR]

Recent advances in Next-Generation Sequencing (NGS) make comparative analyses of the composition and diversity of whole microbial communities possible at a far greater depth than ever before. This brings new challenges, such as an increased dependence on computation to process these huge datasets. The demand on system resources usually requires migrating from Windows to Linux-based operating systems and prior familiarity with command-line interfaces. To overcome this barrier, we developed a fully automated and easy-to-install package as well as a complete, easy-to-follow pipeline for microbial metataxonomic analysis operating in the Windows Subsystem for Linux (WSL)--Bioinformatics Through Windows (BTW). BTW combines several open-access tools for processing marker gene data, including 16S rRNA, bringing the user from raw sequencing reads to diversity-related conclusions. It includes data quality filtering, clustering, taxonomic assignment and further statistical analyses, directly in WSL, avoiding the prior need of migrating from Windows to Linux. BTW is expected to boost the use of NGS amplicon data by facilitating rapid access to a set of bioinformatics tools for Windows users. Moreover, several Linux command line tools became more reachable, which will enhance bioinformatics accessibility to a wider range of researchers and practitioners in the life sciences and medicine. BTW is available in GitHub (https://github.com/vpylro/BTW). The package is freely available for noncommercial users. [ABSTRACT FROM AUTHOR]

Bile acids, the products of concerted host and gut bacterial metabolism, have important signaling functions within the mammalian metabolic system and a key role in digestion. Given the complexity of the mega-variate bacterial community residing in the gastrointestinal tract, studying associations between individual bacterial genera and bile acid processing remains a challenge. Here, we present a novel in vitro approach to determine the bacterial genera associated with the metabolism of different primary bile acids and their potential to contribute to inter-individual variation in this processing. Anaerobic, pH-controlled batch cultures were inoculated with human fecal microbiota and treated with individual conjugated primary bile acids (500 µg/ml) to serve as the sole substrate for 24 h. Samples were collected throughout the experiment (0, 5, 10, and 24 h) and the bacterial composition was determined by 16S rRNA gene sequencing and the bile acid signatures were characterized using a targeted ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) approach. Data fusion techniques were used to identify statistical bacterial-metabolic linkages. An increase in gut bacteria associated bile acids was observed over 24 h with variation in the rate of bile acid metabolism across the volunteers (n = 7). Correlation analysis identified a significant association between the Gemmiger genus and the deconjugation of glycine conjugated bile acids while the deconjugation of taurocholic acid was associated with bacteria from the Eubacterium and Ruminococcus genera. A positive correlation between Dorea and deoxycholic acid production suggest a potential role for this genus in cholic acid dehydroxylation. A slower deconjugation of taurocholic acid was observed in individuals with a greater abundance of Parasutterella and Akkermansia. This work demonstrates the utility of integrating compositional (metataxonomics) and functional (metabonomics) systems biology approaches, coupled to in vitro model systems, to study the biochemical capabilities of bacteria within complex ecosystems. Characterizing the dynamic interactions between the gut microbiota and the bile acid pool enables a greater understanding of how variation in the gut microbiota influences host bile acid signatures, their associated functions and their implications for health. [ABSTRACT FROM AUTHOR]

Soil microbial communities' assembly is strongly tied to changes in temperature and moisture. Although microbial functional redundancy seems to overcome taxonomical composition changes, the sensitivity and resilience of soil microbial communities from subtropical regions in response to seasonal variations are still poorly understood. Thus, the development of new strategies for biodiversity conservation and sustainable management require a complete understanding of the soil abiotic process involved in the selection of microbial taxa and functions. In this work, we used state of the art molecular methodologies (Next Generation Sequencing) to compare the taxonomic (metataxonomics) and functional (metatranscriptomics) profiles among soil samples from two subtropical natural grasslands located in the Pampa biome, Brazil, in response to short-term seasonal variations. Our data suggest that grasslands maintained a stable microbial community membership along the year with oscillation in abundance. Apparently soil microbial taxa are more susceptible to natural climatic disturbances while functions are more stable and change with less intensity along the year. Finally, our data allow us to conclude that the most abundant microbial groups and functions were shared between seasons and locations reflecting the existence of a stable taxonomical and functional core microbiota. [ABSTRACT FROM AUTHOR]

One benefit of animal-mediated seed dispersal is that dispersers may deposit the seeds in protected or enriched microhabitats favorable for seedling survival. Ants are a common seed disperser, and seeds deposited in soils occupied by ant colonies have higher germination and survival rates, benefits attributed to enriched soil conditions and protection from seed predators and fire. Fungal pathogens also devastate young plants, and fungal protection may be an additional benefit of ant-mediated seed dispersal. Ants secrete anti-microbial compounds that appear to suppress the spread of fungal and bacterial diseases in ant colonies, and they confer fungal pathogen protection to the seeds they handle. If fungal protection is a potential benefit of ant-mediated dispersal, we expected that ant-occupied soil (soils inhabited by ants for colony nesting) would contain fewer phytopathogenic fungi than proximate soils without ant nests. We tested this hypothesis with ant soils from the Aphaenogaster rudis complex; the dominant seed-dispersing ants in eastern deciduous forests. We investigated published Aphaenogaster soil fungi data and conducted our own metataxonomic analysis of ant-occupied and unoccupied soils to identify phytopathogenic fungi and investigate whether ant colony presence corresponds with reduced plant fungal pathogens in the soil. We found reduced phytopathogenic fungi presence and richness in soils containing ant colonies as compared to nearby control soils indicating that the presence of ant colonies was concomitant with a reduction in plant pathogens. Ant chemical secretions protect colonies from microbial pathogens in the crowded, moist nest conditions. Plant seeds also thrive in these locations and environments, where they are subject to phytopathogenic fungi. Multiple hypotheses explain the benefits ant-mediated seed dispersal provides plants, but heretofore, fungal protection has been suggested, but not tested. Soil occupation by ants corresponds to phytopathogenic fungi declines, which have the potential to benefit plants. [ABSTRACT FROM AUTHOR]